Starting /dee2/code/volunteer_pipeline.sh SRR7170851 current disk space = 3087319453696 free memory = 1449168188 SRR7170851 SRAfilesize f87474e4abc461247012cb0e3013bea5 SRR7170851.sra SRR7170851.sra file validated SRR7170851 is paired end SRR7170851 is conventional basespace SRR7170851 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170851_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1815 34.0 33.0 34.0 32.0 34.0 2 33.1915 34.0 33.0 34.0 32.0 34.0 3 33.17775 34.0 33.0 34.0 31.0 34.0 4 33.36725 34.0 33.0 34.0 33.0 34.0 5 33.362 34.0 33.0 34.0 33.0 34.0 6 36.9125 38.0 37.0 38.0 36.0 38.0 7 37.3385 38.0 38.0 38.0 36.0 38.0 8 37.50825 38.0 38.0 38.0 37.0 38.0 9 37.47775 38.0 38.0 38.0 37.0 38.0 10-14 37.5001 38.0 38.0 38.0 37.4 38.0 15-19 37.40454999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.432100000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.440250000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.28775 38.0 38.0 38.0 37.0 38.0 35-39 37.28425 38.0 38.0 38.0 37.0 38.0 40-44 37.23805 38.0 38.0 38.0 36.6 38.0 45-49 37.16785 38.0 38.0 38.0 36.0 38.0 50-54 37.0298 38.0 38.0 38.0 36.0 38.0 55-59 36.982299999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.78269999999999 38.0 38.0 38.0 35.2 38.0 65-69 36.866 38.0 38.0 38.0 35.4 38.0 70-74 36.8628 38.0 38.0 38.0 35.0 38.0 75-79 36.705650000000006 38.0 38.0 38.0 34.6 38.0 80-84 36.4765 38.0 38.0 38.0 34.0 38.0 85-89 36.509049999999995 38.0 38.0 38.0 34.0 38.0 90-94 36.313849999999995 38.0 37.4 38.0 34.0 38.0 95-99 36.33655 38.0 37.6 38.0 33.8 38.0 100-104 36.0462 38.0 37.0 38.0 32.8 38.0 105-109 35.8341 38.0 37.0 38.0 31.4 38.0 110-114 35.490750000000006 38.0 36.2 38.0 30.2 38.0 115-119 35.2219 38.0 36.0 38.0 29.2 38.0 120-124 34.906099999999995 38.0 35.4 38.0 27.6 38.0 125-129 34.35725 38.0 34.0 38.0 25.0 38.0 130-134 33.99544999999999 38.0 33.0 38.0 23.8 38.0 135-139 33.321200000000005 38.0 33.0 38.0 20.2 38.0 140-144 32.28025 38.0 32.2 38.0 14.4 38.0 145-149 30.93735 37.0 30.0 38.0 8.0 38.0 150-151 24.921875 31.5 15.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 3.0 16 1.0 17 4.0 18 3.0 19 4.0 20 0.0 21 7.0 22 14.0 23 10.0 24 14.0 25 25.0 26 21.0 27 21.0 28 31.0 29 52.0 30 43.0 31 81.0 32 105.0 33 173.0 34 194.0 35 379.0 36 1039.0 37 1773.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.76539360872954 15.45856066510782 8.59963626916082 29.176409457001817 2 21.075 17.65 36.125 25.15 3 18.125 26.825 28.875 26.174999999999997 4 20.575 33.975 24.775 20.674999999999997 5 21.099999999999998 36.675000000000004 24.65 17.575 6 18.025 35.525 25.45 21.0 7 14.549999999999999 23.35 44.625 17.474999999999998 8 17.974999999999998 22.875 31.424999999999997 27.725 9 17.974999999999998 23.1 33.15 25.775 10-14 20.345 29.270000000000003 26.525 23.86 15-19 19.939999999999998 28.599999999999998 27.935 23.525 20-24 19.55 28.73 28.205000000000002 23.515 25-29 20.150000000000002 28.689999999999998 27.644999999999996 23.515 30-34 20.03 28.599999999999998 27.43 23.94 35-39 20.035 28.435 27.825 23.705000000000002 40-44 20.22 28.77 27.49 23.52 45-49 19.77 28.595 27.755000000000003 23.880000000000003 50-54 19.99 28.475 28.24 23.294999999999998 55-59 20.575 28.73 27.339999999999996 23.355 60-64 20.599999999999998 28.28 27.73 23.39 65-69 20.1 28.415000000000003 27.905 23.580000000000002 70-74 20.575 28.199999999999996 28.275 22.95 75-79 20.495 28.475 27.62 23.41 80-84 20.48 28.194999999999997 27.825 23.5 85-89 20.395 29.09 27.685 22.830000000000002 90-94 20.724999999999998 28.499999999999996 27.650000000000002 23.125 95-99 20.65 28.27 28.055000000000003 23.025000000000002 100-104 20.705000000000002 27.91 27.889999999999997 23.494999999999997 105-109 20.77 28.634999999999998 27.33 23.265 110-114 20.979999999999997 28.77 27.265 22.985 115-119 21.005 28.26 27.57 23.165 120-124 20.82 28.549999999999997 27.0 23.630000000000003 125-129 20.724999999999998 28.660000000000004 26.724999999999998 23.89 130-134 20.8 28.854999999999997 26.31 24.035 135-139 20.830000000000002 28.77 26.674999999999997 23.724999999999998 140-144 20.93 28.449999999999996 26.534999999999997 24.085 145-149 20.665 28.375 26.840000000000003 24.12 150-151 21.6875 27.5875 26.900000000000002 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 2.0 21 2.0 22 1.0 23 2.5 24 4.0 25 3.5 26 5.5 27 9.0 28 14.5 29 19.5 30 22.5 31 28.0 32 36.0 33 54.0 34 71.0 35 71.0 36 77.0 37 102.0 38 141.5 39 172.0 40 204.0 41 227.0 42 253.5 43 265.5 44 262.5 45 265.5 46 251.5 47 228.5 48 199.5 49 175.0 50 162.5 51 138.0 52 109.5 53 95.5 54 79.0 55 68.5 56 49.5 57 34.5 58 27.5 59 23.5 60 15.5 61 6.5 62 6.0 63 4.5 64 1.5 65 0.5 66 0.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3195564516129 98.52499999999999 2 0.5796370967741935 1.15 3 0.07560483870967742 0.22499999999999998 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5249999999999999 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.6375000000000002 0.0 0.0 0.0 0.0 106-107 1.975 0.0 0.0 0.0 0.0 108-109 2.175 0.0 0.0 0.0 0.0 110-111 2.375 0.0 0.0 0.0 0.0 112-113 2.7249999999999996 0.0 0.0 0.0 0.0 114-115 3.125 0.0 0.0 0.0 0.0 116-117 3.5625 0.0 0.0 0.0 0.0 118-119 4.0 0.0 0.0 0.0 0.0 120-121 4.3625 0.0 0.0 0.0 0.0 122-123 4.9 0.0 0.0 0.0 0.0 124-125 5.55 0.0 0.0 0.0 0.0 126-127 6.1625 0.0 0.0 0.0 0.0 128-129 6.7 0.0 0.0 0.0 0.0 130-131 7.225 0.0 0.0 0.0 0.0 132-133 7.75 0.0 0.0 0.0 0.0 134-135 8.2625 0.0 0.0 0.0 0.0 136-137 8.95 0.0 0.0 0.0 0.0 138-139 9.600000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACACT 10 0.006832588 144.9875 3 TTGATTT 10 0.006832588 144.9875 7 GCTCTCC 10 0.006832588 144.9875 5 >>END_MODULE SRR7170851 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170851_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9755 33.0 33.0 34.0 32.0 34.0 2 33.113 34.0 33.0 34.0 32.0 34.0 3 33.1435 34.0 33.0 34.0 33.0 34.0 4 33.137 34.0 33.0 34.0 33.0 34.0 5 33.1155 34.0 33.0 34.0 33.0 34.0 6 37.31575 38.0 38.0 38.0 37.0 38.0 7 37.37625 38.0 38.0 38.0 37.0 38.0 8 37.39875 38.0 38.0 38.0 37.0 38.0 9 37.37625 38.0 38.0 38.0 37.0 38.0 10-14 37.34805 38.0 38.0 38.0 37.0 38.0 15-19 37.31365 38.0 38.0 38.0 37.0 38.0 20-24 37.23975 38.0 38.0 38.0 37.0 38.0 25-29 37.237300000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.2278 38.0 38.0 38.0 37.0 38.0 35-39 37.17885 38.0 38.0 38.0 37.0 38.0 40-44 37.209649999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.2369 38.0 38.0 38.0 37.0 38.0 50-54 37.13555 38.0 38.0 38.0 36.8 38.0 55-59 37.074099999999994 38.0 38.0 38.0 36.6 38.0 60-64 37.0582 38.0 38.0 38.0 36.4 38.0 65-69 37.02524999999999 38.0 38.0 38.0 36.2 38.0 70-74 36.92955 38.0 38.0 38.0 36.0 38.0 75-79 36.76545 38.0 38.0 38.0 35.6 38.0 80-84 36.6881 38.0 38.0 38.0 35.0 38.0 85-89 36.65875 38.0 38.0 38.0 35.2 38.0 90-94 36.41525 38.0 38.0 38.0 34.0 38.0 95-99 36.435500000000005 38.0 38.0 38.0 34.0 38.0 100-104 36.2358 38.0 38.0 38.0 33.6 38.0 105-109 36.038650000000004 38.0 37.6 38.0 33.4 38.0 110-114 35.92585 38.0 37.0 38.0 33.0 38.0 115-119 35.73635 38.0 37.0 38.0 31.6 38.0 120-124 35.43825 38.0 36.4 38.0 30.2 38.0 125-129 35.10615 38.0 36.0 38.0 28.2 38.0 130-134 34.521699999999996 38.0 34.8 38.0 26.4 38.0 135-139 33.9414 38.0 33.2 38.0 22.8 38.0 140-144 33.133500000000005 38.0 33.0 38.0 17.2 38.0 145-149 32.11345 38.0 33.0 38.0 10.6 38.0 150-151 26.57475 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 3.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 4.0 13 3.0 14 3.0 15 4.0 16 5.0 17 5.0 18 4.0 19 5.0 20 5.0 21 8.0 22 5.0 23 10.0 24 12.0 25 14.0 26 20.0 27 21.0 28 29.0 29 39.0 30 60.0 31 59.0 32 70.0 33 116.0 34 156.0 35 274.0 36 638.0 37 2422.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.325 19.425 9.725 22.525000000000002 2 26.206551637909474 23.055763940985248 31.707926981745437 19.02975743935984 3 21.8304576144036 26.6816704176044 31.58289572393098 19.904976244061015 4 23.93098274568642 34.2335583895974 23.030757689422355 18.804701175293822 5 24.056014003500874 38.05951487871968 20.80520130032508 17.079269817454364 6 20.349999999999998 37.475 22.7 19.475 7 18.875 19.5 41.0 20.625 8 19.35 24.125 29.575000000000003 26.950000000000003 9 23.125 23.674999999999997 29.25 23.95 10-14 23.51 28.48 26.6 21.41 15-19 23.765 27.384999999999998 28.29 20.560000000000002 20-24 22.63113155657783 27.68638431921596 28.131406570328515 21.551077553877693 25-29 23.07769273100205 28.58572214718095 27.755265395967783 20.581319725849216 30-34 22.813422013301995 27.844176626493972 28.514277141571238 20.828124218632794 35-39 22.481124056202813 28.57142857142857 27.906395319765988 21.04105205260263 40-44 23.083462519377907 28.114217132569884 28.164224633695056 20.638095714357156 45-49 22.518377756663497 27.6741511226684 28.55428314247137 21.25318797819673 50-54 22.846142307115354 28.23641182059103 28.191409570478527 20.72603630181509 55-59 23.131156557827893 27.631381569078457 28.186409320466023 21.05105255262763 60-64 22.72113605680284 27.961398069903492 28.531426571328566 20.786039301965097 65-69 23.276163808190407 27.74638731936597 27.791389569478476 21.18605930296515 70-74 23.45617280864043 27.68638431921596 27.431371568578427 21.426071303565177 75-79 23.076153807690382 27.231361568078405 28.401420071003553 21.291064553227663 80-84 23.087308730873087 27.927792779277926 27.807780778077806 21.177117711771174 85-89 23.53 27.51 27.794999999999998 21.165 90-94 23.111155557777888 27.901395069753487 28.24641232061603 20.741037051852594 95-99 23.59 27.950000000000003 27.565 20.895 100-104 23.58617930896545 28.15640782039102 27.59637981899095 20.661033051652584 105-109 23.781189059452974 28.23641182059103 27.496374818740936 20.48602430121506 110-114 23.965 28.08 27.915 20.04 115-119 24.001200060003 27.85139256962848 27.521376068803438 20.626031301565078 120-124 24.345 28.050000000000004 27.375 20.23 125-129 24.426221311065554 27.751387569378466 27.2063603180159 20.616030801540077 130-134 24.545 28.26 27.405 19.79 135-139 24.87624381219061 27.66638331916596 27.42137106855343 20.036001800090006 140-144 25.09125456272814 27.75638781939097 27.38136906845342 19.77098854942747 145-149 25.36126806340317 27.996399819990998 27.161358067903397 19.480974048702436 150-151 26.150000000000002 27.187499999999996 27.2625 19.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.5 21 2.0 22 1.5 23 0.5 24 1.5 25 2.5 26 4.5 27 6.5 28 8.0 29 8.0 30 11.0 31 20.0 32 24.0 33 32.5 34 54.0 35 71.5 36 90.0 37 109.0 38 120.5 39 155.0 40 184.5 41 214.5 42 265.0 43 275.5 44 270.5 45 280.0 46 266.5 47 243.0 48 224.5 49 212.5 50 177.5 51 140.0 52 122.0 53 92.0 54 70.0 55 55.5 56 45.0 57 37.0 58 25.0 59 17.5 60 17.0 61 14.0 62 10.0 63 7.0 64 3.5 65 0.5 66 0.0 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.055 30-34 0.015 35-39 0.005 40-44 0.015 45-49 0.015 50-54 0.005 55-59 0.005 60-64 0.005 65-69 0.005 70-74 0.005 75-79 0.005 80-84 0.01 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.005 105-109 0.005 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.005 140-144 0.005 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19069296914516 98.05 2 0.6322711178553364 1.25 3 0.10116337885685382 0.3 4 0.0 0.0 5 0.05058168942842691 0.25 6 0.025290844714213456 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5249999999999999 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.4249999999999998 0.0 0.0 0.0 0.0 104-105 1.7374999999999998 0.0 0.0 0.0 0.0 106-107 2.0250000000000004 0.0 0.0 0.0 0.0 108-109 2.2249999999999996 0.0 0.0 0.0 0.0 110-111 2.45 0.0 0.0 0.0 0.0 112-113 2.8 0.0 0.0 0.0 0.0 114-115 3.2 0.0 0.0 0.0 0.0 116-117 3.625 0.0 0.0 0.0 0.0 118-119 4.075 0.0 0.0 0.0 0.0 120-121 4.449999999999999 0.0 0.0 0.0 0.0 122-123 4.9375 0.0 0.0 0.0 0.0 124-125 5.5875 0.0 0.0 0.0 0.0 126-127 6.125 0.0 0.0 0.0 0.0 128-129 6.6625 0.0 0.0 0.0 0.0 130-131 7.2 0.0 0.0 0.0 0.0 132-133 7.8 0.0 0.0 0.0 0.0 134-135 8.3625 0.0 0.0 0.0 0.0 136-137 9.05 0.0 0.0 0.0 0.0 138-139 9.649999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGAAT 10 0.006843168 144.91249 4 AAGAATG 10 0.006843168 144.91249 5 >>END_MODULE Read 720607 spots for SRR7170851.sra Written 720607 spots for SRR7170851.sra Read 720607 spots for SRR7170851.sra Written 720607 spots for SRR7170851.sra Read 720607 spots for SRR7170851.sra Written 720607 spots for SRR7170851.sra Read 720607 spots for SRR7170851.sra Written 720607 spots for SRR7170851.sra Read 720607 spots for SRR7170851.sra Written 720607 spots for SRR7170851.sra Read 720607 spots for SRR7170851.sra Written 720607 spots for SRR7170851.sra Read 720607 spots for SRR7170851.sra Written 720607 spots for SRR7170851.sra Read 720607 spots for SRR7170851.sra Written 720607 spots for SRR7170851.sra Read 720607 spots for SRR7170851.sra Written 720607 spots for SRR7170851.sra Read 720607 spots for SRR7170851.sra Written 720607 spots for SRR7170851.sra Read 720607 spots for SRR7170851.sra Written 720607 spots for SRR7170851.sra Read 720607 spots for SRR7170851.sra Written 720607 spots for SRR7170851.sra Read 720607 spots for SRR7170851.sra Written 720607 spots for SRR7170851.sra Read 720607 spots for SRR7170851.sra Written 720607 spots for SRR7170851.sra Read 720607 spots for SRR7170851.sra Written 720607 spots for SRR7170851.sra Read 720607 spots for SRR7170851.sra Written 720607 spots for SRR7170851.sra Read 720607 spots for SRR7170851.sra Written 720607 spots for SRR7170851.sra Read 720607 spots for SRR7170851.sra Written 720607 spots for SRR7170851.sra Read 720607 spots for SRR7170851.sra Written 720607 spots for SRR7170851.sra Read 720615 spots for SRR7170851.sra Written 720615 spots for SRR7170851.sra SRR ids: ['SRR7170851.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u1up_mv5 SRR7170851.sra spots: 14412148 blocks: [[1, 720607], [720608, 1441214], [1441215, 2161821], [2161822, 2882428], [2882429, 3603035], [3603036, 4323642], [4323643, 5044249], [5044250, 5764856], [5764857, 6485463], [6485464, 7206070], [7206071, 7926677], [7926678, 8647284], [8647285, 9367891], [9367892, 10088498], [10088499, 10809105], [10809106, 11529712], [11529713, 12250319], [12250320, 12970926], [12970927, 13691533], [13691534, 14412148]] SRR7170851 file size 4862103 SRR7170851 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170851 SRR7170851_1.fastq SRR7170851_2.fastq Input file: SRR7170851_1.fastq Paired file: SRR7170851_2.fastq trimmed: SRR7170851-trimmed-pair1.fastq, SRR7170851-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:14:25 2025 >> started Thu Feb 13 19:14:49 2025 >> done (23.823s) 14412148 read pairs processed; of these: 21551 ( 0.15%) short read pairs filtered out after trimming by size control 26091 ( 0.18%) empty read pairs filtered out after trimming by size control 14364506 (99.67%) read pairs available; of these: 9824497 (68.39%) trimmed read pairs available after processing 4540009 (31.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 12 0.00% 20 18 0.00% 21 17 0.00% 22 12 0.00% 23 18 0.00% 24 20 0.00% 25 24 0.00% 26 21 0.00% 27 14 0.00% 28 24 0.00% 29 23 0.00% 30 23 0.00% 31 17 0.00% 32 28 0.00% 33 25 0.00% 34 17 0.00% 35 28 0.00% 36 43 0.00% 37 34 0.00% 38 35 0.00% 39 41 0.00% 40 27 0.00% 41 50 0.00% 42 46 0.00% 43 53 0.00% 44 52 0.00% 45 59 0.00% 46 64 0.00% 47 73 0.00% 48 77 0.00% 49 112 0.00% 50 118 0.00% 51 107 0.00% 52 145 0.00% 53 168 0.00% 54 170 0.00% 55 230 0.00% 56 232 0.00% 57 248 0.00% 58 320 0.00% 59 371 0.00% 60 406 0.00% 61 484 0.00% 62 502 0.00% 63 563 0.00% 64 621 0.00% 65 699 0.00% 66 773 0.01% 67 901 0.01% 68 972 0.01% 69 1143 0.01% 70 1326 0.01% 71 1556 0.01% 72 1710 0.01% 73 1865 0.01% 74 2137 0.01% 75 2333 0.02% 76 2805 0.02% 77 3348 0.02% 78 3326 0.02% 79 3354 0.02% 80 3907 0.03% 81 4435 0.03% 82 4937 0.03% 83 6134 0.04% 84 7650 0.05% 85 7179 0.05% 86 7540 0.05% 87 7969 0.06% 88 8470 0.06% 89 9162 0.06% 90 10009 0.07% 91 10640 0.07% 92 11355 0.08% 93 12479 0.09% 94 13453 0.09% 95 14311 0.10% 96 14969 0.10% 97 15328 0.11% 98 16394 0.11% 99 17417 0.12% 100 18553 0.13% 101 19769 0.14% 102 21251 0.15% 103 22783 0.16% 104 23753 0.17% 105 25410 0.18% 106 26326 0.18% 107 27262 0.19% 108 28140 0.20% 109 29550 0.21% 110 30729 0.21% 111 32579 0.23% 112 34465 0.24% 113 36015 0.25% 114 37838 0.26% 115 39708 0.28% 116 41017 0.29% 117 42876 0.30% 118 43884 0.31% 119 45473 0.32% 120 46966 0.33% 121 49097 0.34% 122 51437 0.36% 123 54887 0.38% 124 57144 0.40% 125 60437 0.42% 126 63123 0.44% 127 65232 0.45% 128 67281 0.47% 129 70251 0.49% 130 73350 0.51% 131 76666 0.53% 132 81357 0.57% 133 86528 0.60% 134 92332 0.64% 135 99012 0.69% 136 104648 0.73% 137 112391 0.78% 138 120361 0.84% 139 129868 0.90% 140 139832 0.97% 141 154225 1.07% 142 171175 1.19% 143 195565 1.36% 144 225533 1.57% 145 267470 1.86% 146 332413 2.31% 147 437868 3.05% 148 645792 4.50% 149 1177157 8.19% 150 3649923 25.41% 151 4540009 31.61% 14364506 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=0.43 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.17 sequence-density-rank=18 fanout-score=8.04 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=2.0 sequence=CCAGCAGTGTCCCA criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=25 prefix-density=0.62 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=14.41 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.7 sequence=CACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7170851 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:15:35 Started mapping on | Feb 13 19:15:35 Finished on | Feb 13 19:17:05 Mapping speed, Million of reads per hour | 574.58 Number of input reads | 14364506 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 13559056 Uniquely mapped reads % | 94.39% Average mapped length | 288.53 Number of splices: Total | 12776378 Number of splices: Annotated (sjdb) | 12444564 Number of splices: GT/AG | 12527689 Number of splices: GC/AG | 187699 Number of splices: AT/AC | 7568 Number of splices: Non-canonical | 53422 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 379398 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 68086 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.40% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 443392 443392 443392 N_multimapping 379398 379398 379398 N_noFeature 566179 13300279 697885 N_ambiguous 234777 1563 106616 UnstrandedReadsAssigned:12758100 PositiveStrandReadsAssigned:257214 NegativeStrandReadsAssigned:12754555 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR7170851 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170851-trimmed-pair1.fastq SRR7170851-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,364,506 reads, 12,710,553 reads pseudoaligned [quant] estimated average fragment length: 233.585 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR7170851.ke.tsv 34699 SRR7170851.se.tsv 87100 total ==> SRR7170851.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.41 739 30.5966 Potri.005G024800.1.v4.1 1035 802.415 220 20.2671 Potri.004G059700.1.v4.1 961 728.503 14 1.42057 Potri.007G009000.2.v4.1 1416 1183.41 0 0 Potri.003G141000.2.v4.1 2943 2710.41 876.412 23.9023 Potri.016G087400.1.v4.1 270 90.6099 856.246 698.538 Potri.015G069301.1.v4.1 564 339.423 0 0 Potri.010G195200.1.v4.1 1773 1540.41 78 3.74304 Potri.012G127500.1.v4.1 977 744.472 165 16.3834 ==> SRR7170851.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 592 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 254 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR7170851 completed mapping pipeline successfully