Starting /dee2/code/volunteer_pipeline.sh SRR7170852 current disk space = 3087597359104 free memory = 1579886128 SRR7170852 SRAfilesize 04b1496e99c5b44a2ba2aa2822228848 SRR7170852.sra SRR7170852.sra file validated SRR7170852 is paired end SRR7170852 is conventional basespace SRR7170852 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170852_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.924 34.0 33.0 34.0 33.0 34.0 2 33.28525 34.0 33.0 34.0 33.0 34.0 3 33.226 34.0 33.0 34.0 33.0 34.0 4 33.362 34.0 33.0 34.0 33.0 34.0 5 33.33 34.0 33.0 34.0 33.0 34.0 6 36.6185 38.0 37.0 38.0 34.0 38.0 7 37.1645 38.0 38.0 38.0 36.0 38.0 8 37.25575 38.0 38.0 38.0 36.0 38.0 9 37.34075 38.0 38.0 38.0 37.0 38.0 10-14 37.3923 38.0 38.0 38.0 37.0 38.0 15-19 37.3529 38.0 38.0 38.0 37.0 38.0 20-24 37.2866 38.0 38.0 38.0 36.8 38.0 25-29 37.2347 38.0 38.0 38.0 36.2 38.0 30-34 37.2288 38.0 38.0 38.0 36.0 38.0 35-39 37.087050000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.987199999999994 38.0 38.0 38.0 35.8 38.0 45-49 36.93545 38.0 38.0 38.0 35.4 38.0 50-54 36.713499999999996 38.0 38.0 38.0 34.4 38.0 55-59 36.58365 38.0 38.0 38.0 34.2 38.0 60-64 36.55185 38.0 38.0 38.0 34.0 38.0 65-69 36.5081 38.0 37.8 38.0 33.8 38.0 70-74 36.44575 38.0 37.6 38.0 34.0 38.0 75-79 36.27034999999999 38.0 37.0 38.0 33.4 38.0 80-84 36.2154 38.0 37.0 38.0 33.2 38.0 85-89 35.907 38.0 37.0 38.0 32.2 38.0 90-94 35.62595 38.0 36.6 38.0 30.6 38.0 95-99 35.470600000000005 38.0 36.2 38.0 29.8 38.0 100-104 34.843849999999996 38.0 35.2 38.0 26.6 38.0 105-109 34.681700000000006 38.0 34.6 38.0 26.0 38.0 110-114 34.346000000000004 38.0 34.0 38.0 25.2 38.0 115-119 34.05305 38.0 33.6 38.0 23.0 38.0 120-124 33.09095 38.0 32.8 38.0 18.4 38.0 125-129 32.3491 37.8 31.4 38.0 14.0 38.0 130-134 31.5688 37.0 28.8 38.0 13.4 38.0 135-139 30.47705 36.0 28.0 38.0 12.6 38.0 140-144 30.370299999999997 36.0 28.0 38.0 10.2 38.0 145-149 28.44845 34.6 23.6 38.0 2.0 38.0 150-151 21.718249999999998 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 3.0 16 3.0 17 3.0 18 4.0 19 7.0 20 10.0 21 16.0 22 23.0 23 12.0 24 30.0 25 27.0 26 36.0 27 42.0 28 45.0 29 67.0 30 87.0 31 117.0 32 143.0 33 217.0 34 339.0 35 564.0 36 1130.0 37 1070.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.261089987325725 16.730038022813687 8.136882129277566 28.871989860583014 2 21.275 20.150000000000002 34.8 23.775 3 19.089316987740805 27.195396547410557 28.246184638478862 25.469101826369776 4 21.175 33.775 23.65 21.4 5 20.474999999999998 37.625 24.65 17.25 6 17.8 36.6 25.5 20.1 7 13.700000000000001 23.549999999999997 43.15 19.6 8 17.4 23.3 31.5 27.800000000000004 9 18.099999999999998 22.325 32.9 26.674999999999997 10-14 20.935000000000002 28.945 26.484999999999996 23.635 15-19 19.865 28.64 28.125 23.369999999999997 20-24 19.935 28.389999999999997 28.13 23.544999999999998 25-29 19.88 28.815 27.744999999999997 23.56 30-34 19.77 29.599999999999998 26.950000000000003 23.68 35-39 20.119999999999997 29.01 27.325 23.544999999999998 40-44 20.294999999999998 29.12 27.089999999999996 23.494999999999997 45-49 20.055 29.104999999999997 27.52 23.32 50-54 20.025000000000002 28.645 28.335 22.994999999999997 55-59 19.98 28.665000000000003 27.57 23.785 60-64 19.59 28.93 27.894999999999996 23.585 65-69 19.715 28.835 27.994999999999997 23.455000000000002 70-74 19.8 28.99 27.97 23.24 75-79 19.985 29.520000000000003 27.250000000000004 23.244999999999997 80-84 20.14 28.565 28.299999999999997 22.994999999999997 85-89 20.51 28.910000000000004 27.42 23.16 90-94 20.69 28.54 27.439999999999998 23.330000000000002 95-99 20.380000000000003 28.660000000000004 27.73 23.23 100-104 20.080000000000002 28.655 27.955000000000002 23.31 105-109 20.265 29.435 27.32 22.98 110-114 20.119999999999997 29.035 27.765 23.080000000000002 115-119 20.59 29.18 27.345000000000002 22.884999999999998 120-124 21.035 28.815 27.034999999999997 23.115 125-129 20.945 29.12 27.029999999999998 22.905 130-134 20.985 28.749999999999996 27.16 23.105 135-139 20.875 28.925 26.76 23.44 140-144 20.79 28.810000000000002 26.965 23.435 145-149 20.255000000000003 29.505 26.665 23.575 150-151 21.0375 29.049999999999997 26.637499999999996 23.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 1.0 22 2.0 23 2.5 24 4.0 25 4.5 26 8.5 27 9.5 28 9.5 29 14.0 30 17.5 31 26.0 32 42.0 33 60.0 34 68.5 35 86.0 36 93.5 37 109.5 38 148.0 39 179.5 40 213.5 41 222.0 42 242.0 43 276.5 44 273.5 45 250.0 46 221.5 47 217.0 48 215.0 49 191.0 50 165.5 51 131.5 52 112.0 53 86.5 54 61.0 55 57.0 56 49.5 57 37.5 58 27.0 59 20.0 60 12.0 61 9.0 62 7.0 63 3.5 64 2.0 65 2.5 66 1.5 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 0.0 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31869795609387 98.4 2 0.58036840777189 1.15 3 0.05046681806712087 0.15 4 0.025233409033560434 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025233409033560434 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 8 0.2 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1625 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.725 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.3499999999999996 0.0 0.0 0.0 0.0 110-111 2.7875 0.0 0.0 0.0 0.0 112-113 3.1500000000000004 0.0 0.0 0.0 0.0 114-115 3.6625 0.0 0.0 0.0 0.0 116-117 4.2875 0.0 0.0 0.0 0.0 118-119 4.85 0.0 0.0 0.0 0.0 120-121 5.35 0.0 0.0 0.0 0.0 122-123 5.8625 0.0 0.0 0.0 0.0 124-125 6.300000000000001 0.0 0.0 0.0 0.0 126-127 6.775 0.0 0.0 0.0 0.0 128-129 7.137499999999999 0.0 0.0 0.0 0.0 130-131 7.5375 0.0 0.0 0.0 0.0 132-133 8.2 0.0 0.0 0.0 0.0 134-135 8.7 0.0 0.0 0.0 0.0 136-137 9.325 0.0 0.0 0.0 0.0 138-139 10.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCAATG 10 0.006582306 146.7848 2 AGACTTG 10 0.0068378756 144.95 8 GTAATAA 10 0.0068378756 144.95 4 >>END_MODULE SRR7170852 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170852_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03875 33.0 33.0 34.0 32.0 34.0 2 33.1285 34.0 33.0 34.0 33.0 34.0 3 33.085 34.0 33.0 34.0 33.0 34.0 4 33.09675 34.0 33.0 34.0 32.0 34.0 5 33.0365 34.0 33.0 34.0 33.0 34.0 6 37.23575 38.0 38.0 38.0 37.0 38.0 7 37.238 38.0 38.0 38.0 37.0 38.0 8 37.299 38.0 38.0 38.0 37.0 38.0 9 37.32075 38.0 38.0 38.0 37.0 38.0 10-14 37.269400000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.25515 38.0 38.0 38.0 37.0 38.0 20-24 37.22885000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.189049999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.15175 38.0 38.0 38.0 37.0 38.0 35-39 37.1255 38.0 38.0 38.0 36.8 38.0 40-44 37.15165 38.0 38.0 38.0 37.0 38.0 45-49 37.0638 38.0 38.0 38.0 36.8 38.0 50-54 36.997949999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.910250000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.85965 38.0 38.0 38.0 36.0 38.0 65-69 36.82135000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.73575 38.0 38.0 38.0 35.2 38.0 75-79 36.6976 38.0 38.0 38.0 35.4 38.0 80-84 36.4753 38.0 38.0 38.0 34.4 38.0 85-89 36.423449999999995 38.0 38.0 38.0 34.2 38.0 90-94 36.2524 38.0 38.0 38.0 33.8 38.0 95-99 36.18765 38.0 38.0 38.0 34.0 38.0 100-104 36.0273 38.0 37.8 38.0 33.2 38.0 105-109 35.9263 38.0 37.4 38.0 32.6 38.0 110-114 35.696000000000005 38.0 37.0 38.0 31.4 38.0 115-119 35.33925000000001 38.0 36.4 38.0 29.8 38.0 120-124 34.9483 38.0 36.2 38.0 28.0 38.0 125-129 34.46485 38.0 35.2 38.0 25.2 38.0 130-134 33.97705 38.0 33.6 38.0 23.2 38.0 135-139 33.34305 38.0 33.0 38.0 19.2 38.0 140-144 32.364799999999995 38.0 33.0 38.0 13.2 38.0 145-149 30.99785 37.8 31.0 38.0 7.8 38.0 150-151 25.13025 33.0 16.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 1.0 5 1.0 6 1.0 7 2.0 8 1.0 9 0.0 10 1.0 11 2.0 12 4.0 13 3.0 14 2.0 15 2.0 16 3.0 17 5.0 18 4.0 19 9.0 20 11.0 21 5.0 22 15.0 23 12.0 24 18.0 25 14.0 26 22.0 27 28.0 28 37.0 29 32.0 30 50.0 31 74.0 32 84.0 33 115.0 34 195.0 35 283.0 36 765.0 37 2190.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.45 20.25 10.625 22.675 2 25.525 25.5 32.125 16.85 3 21.50537634408602 25.881470367591895 33.80845211302826 18.804701175293822 4 23.78094523630908 36.134033508377094 21.980495123780948 18.104526131532882 5 23.080770192548137 39.05976494123531 21.380345086271568 16.479119779944988 6 18.529632408102024 38.084521130282575 23.680920230057513 19.70492623155789 7 18.479619904976243 19.779944986246562 41.88547136784196 19.854963740935233 8 19.454863715928983 23.50587646911728 29.882470617654416 27.156789197299325 9 21.580395098774694 23.730932733183295 29.507376844211052 25.18129532383096 10-14 22.815703925981495 28.712178044511127 27.106776694173547 21.365341335333834 15-19 22.4256064016004 28.057014253563388 28.907226806701676 20.610152538134532 20-24 22.37559389847462 28.48712178044511 28.27706926731683 20.86021505376344 25-29 22.66019708868991 28.70791856335351 28.242709219148615 20.389175128807963 30-34 22.272795478417446 28.294903216125643 28.52498374431051 20.907317561146403 35-39 22.262791977192016 28.534987245535937 28.39993997899265 20.802280798279398 40-44 22.440610152538135 28.217054263565895 28.477119279819956 20.86521630407602 45-49 22.730228602871293 28.252713721174526 28.197688960032014 20.819368715922167 50-54 22.193877551020407 27.806122448979593 29.901960784313726 20.098039215686274 55-59 23.065766441610403 27.85696424106027 28.18704676169042 20.89022255563891 60-64 22.153861544617847 28.056222488995598 29.111644657863145 20.67827130852341 65-69 22.308923569427773 28.08623449379752 28.441376550620245 21.163465386154463 70-74 22.714085634253703 27.44597839135654 28.431372549019606 21.408563425370147 75-79 22.74523535591016 28.107648441798812 27.932569656345358 21.214546545945677 80-84 23.627088126437933 28.09842952885866 27.62328698609583 20.651195358607584 85-89 22.721816544963488 28.04341302390717 28.48854656396919 20.74622386716015 90-94 23.16310708748062 27.824738658530485 27.854749162206772 21.157405091782124 95-99 22.771385692846422 27.63381690845423 28.66433216608304 20.930465232616307 100-104 23.04306507277547 27.81973690791777 28.40494172960536 20.732256289701397 105-109 23.131565782891446 27.978989494747374 28.644322161080538 20.245122561280642 110-114 23.41670835417709 28.224112056028016 28.114057028514257 20.245122561280642 115-119 23.980791356110252 28.282727227252263 28.027612425591514 19.70886899104597 120-124 24.177088544272134 28.319159579789893 27.548774387193596 19.954977488744372 125-129 23.871935967983994 27.78389194597299 28.274137068534266 20.070035017508754 130-134 24.677338669334667 28.149074537268636 27.383691845922964 19.789894947473737 135-139 24.89120104046821 28.252713721174526 27.287279275674052 19.568805962683207 140-144 24.667333666833414 28.169084542271133 27.70385192596298 19.459729864932466 145-149 24.60484193677471 28.55642256902761 27.305922368947577 19.5328131252501 150-151 25.012506253126567 28.55177588794397 27.363681840920464 19.072036018009005 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.5 17 1.0 18 1.0 19 2.5 20 3.0 21 2.0 22 1.5 23 2.0 24 3.0 25 3.5 26 3.5 27 10.0 28 12.5 29 12.0 30 19.5 31 29.5 32 46.0 33 52.0 34 56.5 35 69.5 36 87.5 37 119.0 38 145.0 39 164.5 40 198.5 41 218.0 42 241.5 43 275.5 44 286.0 45 273.0 46 248.0 47 239.0 48 232.5 49 206.0 50 158.0 51 122.5 52 104.5 53 85.0 54 66.0 55 52.0 56 46.0 57 34.5 58 19.5 59 14.0 60 10.5 61 7.5 62 4.5 63 1.5 64 2.0 65 1.5 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.025 15-19 0.025 20-24 0.025 25-29 0.045 30-34 0.034999999999999996 35-39 0.034999999999999996 40-44 0.025 45-49 0.045 50-54 0.04 55-59 0.025 60-64 0.04 65-69 0.04 70-74 0.04 75-79 0.045 80-84 0.03 85-89 0.03 90-94 0.034999999999999996 95-99 0.05 100-104 0.034999999999999996 105-109 0.05 110-114 0.05 115-119 0.045 120-124 0.05 125-129 0.05 130-134 0.05 135-139 0.045 140-144 0.05 145-149 0.04 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.475 #Duplication Level Percentage of deduplicated Percentage of total 1 99.00990099009901 97.5 2 0.7362274689007363 1.4500000000000002 3 0.07616146230007616 0.22499999999999998 4 0.07616146230007616 0.3 5 0.07616146230007616 0.375 6 0.02538715410002539 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (96% over 32bp) GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 5 0.125 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1625 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.5125000000000002 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.95 0.0 0.0 0.0 0.0 108-109 2.325 0.0 0.0 0.0 0.0 110-111 2.7625 0.0 0.0 0.0 0.0 112-113 3.1625 0.0 0.0 0.0 0.0 114-115 3.675 0.0 0.0 0.0 0.0 116-117 4.275 0.0 0.0 0.0 0.0 118-119 4.887499999999999 0.0 0.0 0.0 0.0 120-121 5.425000000000001 0.0 0.0 0.0 0.0 122-123 5.95 0.0 0.0 0.0 0.0 124-125 6.4375 0.0 0.0 0.0 0.0 126-127 6.9 0.0 0.0 0.0 0.0 128-129 7.2875 0.0 0.0 0.0 0.0 130-131 7.7375 0.0 0.0 0.0 0.0 132-133 8.462499999999999 0.0 0.0 0.0 0.0 134-135 8.9875 0.0 0.0 0.0 0.0 136-137 9.6875 0.0 0.0 0.0 0.0 138-139 10.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 651168 spots for SRR7170852.sra Written 651168 spots for SRR7170852.sra Read 651168 spots for SRR7170852.sra Written 651168 spots for SRR7170852.sra Read 651168 spots for SRR7170852.sra Written 651168 spots for SRR7170852.sra Read 651168 spots for SRR7170852.sra Written 651168 spots for SRR7170852.sra Read 651168 spots for SRR7170852.sra Written 651168 spots for SRR7170852.sra Read 651168 spots for SRR7170852.sra Written 651168 spots for SRR7170852.sra Read 651168 spots for SRR7170852.sra Written 651168 spots for SRR7170852.sra Read 651168 spots for SRR7170852.sra Written 651168 spots for SRR7170852.sra Read 651168 spots for SRR7170852.sra Written 651168 spots for SRR7170852.sra Read 651168 spots for SRR7170852.sra Written 651168 spots for SRR7170852.sra Read 651168 spots for SRR7170852.sra Written 651168 spots for SRR7170852.sra Read 651168 spots for SRR7170852.sra Written 651168 spots for SRR7170852.sra Read 651168 spots for SRR7170852.sra Written 651168 spots for SRR7170852.sra Read 651168 spots for SRR7170852.sra Written 651168 spots for SRR7170852.sra Read 651168 spots for SRR7170852.sra Written 651168 spots for SRR7170852.sra Read 651168 spots for SRR7170852.sra Written 651168 spots for SRR7170852.sra Read 651178 spots for SRR7170852.sra Written 651178 spots for SRR7170852.sra Read 651168 spots for SRR7170852.sra Written 651168 spots for SRR7170852.sra Read 651168 spots for SRR7170852.sra Written 651168 spots for SRR7170852.sra Read 651168 spots for SRR7170852.sra Written 651168 spots for SRR7170852.sra SRR ids: ['SRR7170852.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nnk7f6kr SRR7170852.sra spots: 13023370 blocks: [[1, 651168], [651169, 1302336], [1302337, 1953504], [1953505, 2604672], [2604673, 3255840], [3255841, 3907008], [3907009, 4558176], [4558177, 5209344], [5209345, 5860512], [5860513, 6511680], [6511681, 7162848], [7162849, 7814016], [7814017, 8465184], [8465185, 9116352], [9116353, 9767520], [9767521, 10418688], [10418689, 11069856], [11069857, 11721024], [11721025, 12372192], [12372193, 13023370]] SRR7170852 file size 4391492 SRR7170852 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170852 SRR7170852_1.fastq SRR7170852_2.fastq Input file: SRR7170852_1.fastq Paired file: SRR7170852_2.fastq trimmed: SRR7170852-trimmed-pair1.fastq, SRR7170852-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:00:13 2025 >> started Thu Feb 13 20:00:29 2025 >> done (15.155s) 13023370 read pairs processed; of these: 14733 ( 0.11%) short read pairs filtered out after trimming by size control 22365 ( 0.17%) empty read pairs filtered out after trimming by size control 12986272 (99.72%) read pairs available; of these: 9154528 (70.49%) trimmed read pairs available after processing 3831744 (29.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 13 0.00% 20 18 0.00% 21 14 0.00% 22 15 0.00% 23 20 0.00% 24 12 0.00% 25 13 0.00% 26 14 0.00% 27 13 0.00% 28 24 0.00% 29 20 0.00% 30 22 0.00% 31 47 0.00% 32 16 0.00% 33 23 0.00% 34 19 0.00% 35 16 0.00% 36 23 0.00% 37 32 0.00% 38 38 0.00% 39 26 0.00% 40 31 0.00% 41 39 0.00% 42 43 0.00% 43 55 0.00% 44 42 0.00% 45 51 0.00% 46 70 0.00% 47 74 0.00% 48 73 0.00% 49 117 0.00% 50 97 0.00% 51 146 0.00% 52 136 0.00% 53 136 0.00% 54 177 0.00% 55 195 0.00% 56 207 0.00% 57 253 0.00% 58 270 0.00% 59 296 0.00% 60 352 0.00% 61 431 0.00% 62 475 0.00% 63 552 0.00% 64 602 0.00% 65 662 0.01% 66 748 0.01% 67 827 0.01% 68 954 0.01% 69 1087 0.01% 70 1273 0.01% 71 1431 0.01% 72 1666 0.01% 73 1857 0.01% 74 2113 0.02% 75 2256 0.02% 76 2990 0.02% 77 3158 0.02% 78 3078 0.02% 79 3240 0.02% 80 3667 0.03% 81 4272 0.03% 82 4814 0.04% 83 5697 0.04% 84 7019 0.05% 85 6991 0.05% 86 7566 0.06% 87 7979 0.06% 88 8435 0.06% 89 8869 0.07% 90 9685 0.07% 91 10677 0.08% 92 11417 0.09% 93 12771 0.10% 94 13441 0.10% 95 14985 0.12% 96 15134 0.12% 97 15798 0.12% 98 16300 0.13% 99 17243 0.13% 100 18807 0.14% 101 19678 0.15% 102 21231 0.16% 103 22953 0.18% 104 24434 0.19% 105 25172 0.19% 106 26496 0.20% 107 27390 0.21% 108 27937 0.22% 109 29036 0.22% 110 29223 0.23% 111 31328 0.24% 112 33149 0.26% 113 34688 0.27% 114 36613 0.28% 115 38520 0.30% 116 39960 0.31% 117 41050 0.32% 118 41804 0.32% 119 42998 0.33% 120 44616 0.34% 121 46298 0.36% 122 48415 0.37% 123 51486 0.40% 124 54114 0.42% 125 56656 0.44% 126 59277 0.46% 127 60951 0.47% 128 63791 0.49% 129 65900 0.51% 130 68771 0.53% 131 71793 0.55% 132 76718 0.59% 133 81163 0.62% 134 86928 0.67% 135 93785 0.72% 136 98957 0.76% 137 106269 0.82% 138 113765 0.88% 139 121638 0.94% 140 131097 1.01% 141 143308 1.10% 142 159417 1.23% 143 181370 1.40% 144 211117 1.63% 145 252414 1.94% 146 313894 2.42% 147 417719 3.22% 148 610326 4.70% 149 1103583 8.50% 150 3311061 25.50% 151 3831744 29.51% 12986272 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=12 prefix-density=0.50 prefix-fanout=2.3 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=39.88 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.0 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=11 prefix-density=0.85 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=101.81 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.7 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT SRR7170852 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:01:11 Started mapping on | Feb 13 20:01:11 Finished on | Feb 13 20:02:29 Mapping speed, Million of reads per hour | 599.37 Number of input reads | 12986272 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 12366418 Uniquely mapped reads % | 95.23% Average mapped length | 287.94 Number of splices: Total | 11529559 Number of splices: Annotated (sjdb) | 11241313 Number of splices: GT/AG | 11301205 Number of splices: GC/AG | 179985 Number of splices: AT/AC | 7326 Number of splices: Non-canonical | 41043 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 326390 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 44432 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.83% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 305610 305610 305610 N_multimapping 326390 326390 326390 N_noFeature 565808 12131237 677991 N_ambiguous 214629 934 90997 UnstrandedReadsAssigned:11585981 PositiveStrandReadsAssigned:234247 NegativeStrandReadsAssigned:11597430 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=141 echo kmer=137 SRR7170852 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170852-trimmed-pair1.fastq SRR7170852-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,986,272 reads, 11,601,676 reads pseudoaligned [quant] estimated average fragment length: 234.113 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52401 SRR7170852.ke.tsv 34699 SRR7170852.se.tsv 87100 total ==> SRR7170852.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.89 451 20.7669 Potri.005G024800.1.v4.1 1035 801.887 190 19.4736 Potri.004G059700.1.v4.1 961 727.918 4 0.451631 Potri.007G009000.2.v4.1 1416 1182.89 0 0 Potri.003G141000.2.v4.1 2943 2709.89 458.3 13.8997 Potri.016G087400.1.v4.1 270 91.2127 492.347 443.632 Potri.015G069301.1.v4.1 564 338.218 0 0 Potri.010G195200.1.v4.1 1773 1539.89 54 2.88212 Potri.012G127500.1.v4.1 977 743.908 31 3.42491 ==> SRR7170852.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 622 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 244 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170852 completed mapping pipeline successfully