Starting /dee2/code/volunteer_pipeline.sh SRR7170853 current disk space = 3087349567488 free memory = 1466773200 SRR7170853 SRAfilesize 9ae52c6e80c15bf5867c46c5e39f360b SRR7170853.sra SRR7170853.sra file validated SRR7170853 is paired end SRR7170853 is conventional basespace SRR7170853 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170853_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01425 34.0 33.0 34.0 33.0 34.0 2 33.39425 34.0 33.0 34.0 33.0 34.0 3 33.3575 34.0 33.0 34.0 33.0 34.0 4 33.43825 34.0 33.0 34.0 33.0 34.0 5 33.39325 34.0 33.0 34.0 33.0 34.0 6 36.977 38.0 37.0 38.0 35.0 38.0 7 37.29975 38.0 38.0 38.0 37.0 38.0 8 37.419 38.0 38.0 38.0 37.0 38.0 9 37.4915 38.0 38.0 38.0 37.0 38.0 10-14 37.53295000000001 38.0 38.0 38.0 37.6 38.0 15-19 37.439049999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.35695 38.0 38.0 38.0 37.0 38.0 25-29 37.3161 38.0 38.0 38.0 37.0 38.0 30-34 37.27975 38.0 38.0 38.0 37.0 38.0 35-39 37.21339999999999 38.0 38.0 38.0 36.4 38.0 40-44 37.185199999999995 38.0 38.0 38.0 36.0 38.0 45-49 37.0787 38.0 38.0 38.0 36.0 38.0 50-54 37.0002 38.0 38.0 38.0 36.0 38.0 55-59 36.98375 38.0 38.0 38.0 36.0 38.0 60-64 36.8967 38.0 38.0 38.0 35.6 38.0 65-69 36.85325 38.0 38.0 38.0 35.4 38.0 70-74 36.7742 38.0 38.0 38.0 35.0 38.0 75-79 36.584399999999995 38.0 38.0 38.0 34.2 38.0 80-84 36.4955 38.0 38.0 38.0 34.2 38.0 85-89 36.47615 38.0 38.0 38.0 34.0 38.0 90-94 36.3591 38.0 38.0 38.0 34.0 38.0 95-99 36.2489 38.0 37.2 38.0 34.0 38.0 100-104 35.995 38.0 37.0 38.0 32.8 38.0 105-109 35.749649999999995 38.0 37.0 38.0 31.4 38.0 110-114 35.65795 38.0 36.6 38.0 31.4 38.0 115-119 35.4004 38.0 36.0 38.0 30.2 38.0 120-124 35.12685 38.0 36.0 38.0 28.2 38.0 125-129 34.98695 38.0 35.6 38.0 28.0 38.0 130-134 34.207950000000004 38.0 34.2 38.0 23.8 38.0 135-139 34.139700000000005 38.0 33.8 38.0 24.0 38.0 140-144 33.79155 38.0 33.2 38.0 23.4 38.0 145-149 32.85625 38.0 33.0 38.0 19.4 38.0 150-151 27.52925 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 2.0 9 3.0 10 2.0 11 1.0 12 0.0 13 4.0 14 0.0 15 2.0 16 2.0 17 6.0 18 4.0 19 3.0 20 4.0 21 6.0 22 1.0 23 4.0 24 10.0 25 12.0 26 9.0 27 15.0 28 19.0 29 48.0 30 59.0 31 66.0 32 101.0 33 128.0 34 188.0 35 394.0 36 856.0 37 2050.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.457880091070074 16.696180116367316 18.163420187199595 34.68251960536301 2 20.724999999999998 20.599999999999998 35.199999999999996 23.474999999999998 3 17.599999999999998 28.499999999999996 31.374999999999996 22.525000000000002 4 20.349999999999998 33.575 25.85 20.225 5 20.3 37.025000000000006 25.224999999999998 17.45 6 18.875 36.7 26.075 18.35 7 12.950000000000001 23.974999999999998 43.925 19.15 8 17.25 25.724999999999998 29.4 27.625 9 17.025000000000002 26.125 31.874999999999996 24.975 10-14 18.805 31.075000000000003 26.615 23.505000000000003 15-19 18.715 29.875 27.939999999999998 23.47 20-24 18.775 29.525000000000002 28.749999999999996 22.95 25-29 19.259999999999998 30.009999999999998 27.860000000000003 22.869999999999997 30-34 19.005 30.4 27.495000000000005 23.1 35-39 18.905 30.075000000000003 27.3 23.72 40-44 18.834999999999997 30.385 27.634999999999998 23.145 45-49 19.415 28.955 27.92 23.71 50-54 19.24 29.785 27.54 23.435 55-59 19.685 30.56 26.895000000000003 22.86 60-64 19.15 29.985 27.525 23.34 65-69 19.325 30.044999999999998 27.495000000000005 23.135 70-74 19.6 29.57 27.584999999999997 23.244999999999997 75-79 19.295 29.835 27.775 23.095 80-84 18.915000000000003 28.525 28.26 24.3 85-89 19.625 28.884999999999998 27.755000000000003 23.735 90-94 19.45 29.615000000000002 27.275 23.66 95-99 19.195 29.195 27.855 23.755000000000003 100-104 19.885 29.225 27.37 23.52 105-109 19.650000000000002 28.95 27.425 23.974999999999998 110-114 19.79 28.315 28.01 23.885 115-119 20.77 28.335 27.860000000000003 23.035 120-124 20.0 29.435 27.315 23.25 125-129 19.615 28.775000000000002 27.644999999999996 23.965 130-134 20.34 28.884999999999998 27.295 23.48 135-139 20.18 28.915000000000003 27.025 23.880000000000003 140-144 19.99 29.025000000000002 27.355 23.630000000000003 145-149 20.61 27.900000000000002 27.505000000000003 23.985 150-151 20.525 28.375 27.3125 23.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 1.0 4 0.5 5 1.0 6 1.0 7 0.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 2.0 17 1.5 18 0.5 19 1.0 20 1.0 21 2.0 22 5.0 23 5.0 24 2.5 25 6.0 26 12.0 27 16.0 28 22.0 29 30.0 30 36.5 31 38.0 32 54.5 33 75.5 34 96.0 35 125.5 36 138.0 37 148.5 38 161.5 39 162.0 40 185.0 41 226.0 42 225.0 43 230.5 44 245.5 45 237.0 46 223.5 47 218.0 48 209.0 49 175.0 50 148.0 51 121.0 52 94.5 53 84.5 54 62.5 55 43.5 56 37.5 57 27.0 58 16.5 59 11.0 60 8.5 61 5.0 62 5.5 63 3.0 64 2.5 65 2.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29310780106034 98.32499999999999 2 0.5049229992426155 1.0 3 0.15147689977278464 0.44999999999999996 4 0.025246149962130777 0.1 5 0.025246149962130777 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.6625000000000001 0.0 0.0 0.0 0.0 120-121 0.75 0.0 0.0 0.0 0.0 122-123 0.875 0.0 0.0 0.0 0.0 124-125 0.975 0.0 0.0 0.0 0.0 126-127 1.0875 0.0 0.0 0.0 0.0 128-129 1.1625 0.0 0.0 0.0 0.0 130-131 1.325 0.0 0.0 0.0 0.0 132-133 1.5 0.0 0.0 0.0 0.0 134-135 1.6875 0.0 0.0 0.0 0.0 136-137 1.8875 0.0 0.0 0.0 0.0 138-139 2.0374999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTCAT 10 0.006832588 144.9875 5 >>END_MODULE SRR7170853 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170853_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86325 33.0 33.0 34.0 32.0 34.0 2 32.93075 34.0 33.0 34.0 32.0 34.0 3 32.87725 34.0 33.0 34.0 32.0 34.0 4 32.82525 34.0 33.0 34.0 32.0 34.0 5 32.8185 34.0 33.0 34.0 32.0 34.0 6 36.9375 38.0 38.0 38.0 36.0 38.0 7 36.882 38.0 38.0 38.0 36.0 38.0 8 36.91475 38.0 38.0 38.0 36.0 38.0 9 36.934 38.0 38.0 38.0 36.0 38.0 10-14 36.8972 38.0 38.0 38.0 36.2 38.0 15-19 36.90050000000001 38.0 38.0 38.0 36.2 38.0 20-24 36.90110000000001 38.0 38.0 38.0 36.2 38.0 25-29 36.836600000000004 38.0 38.0 38.0 36.0 38.0 30-34 36.8517 38.0 38.0 38.0 36.0 38.0 35-39 36.81935 38.0 38.0 38.0 36.0 38.0 40-44 36.82855000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.79755 38.0 38.0 38.0 36.0 38.0 50-54 36.760450000000006 38.0 38.0 38.0 36.0 38.0 55-59 36.70825 38.0 38.0 38.0 35.8 38.0 60-64 36.674 38.0 38.0 38.0 35.4 38.0 65-69 36.66375 38.0 38.0 38.0 35.6 38.0 70-74 36.566900000000004 38.0 38.0 38.0 35.2 38.0 75-79 36.49275 38.0 38.0 38.0 35.0 38.0 80-84 36.370400000000004 38.0 38.0 38.0 34.4 38.0 85-89 36.261700000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.200149999999994 38.0 38.0 38.0 34.0 38.0 95-99 36.14215 38.0 38.0 38.0 33.8 38.0 100-104 35.946 38.0 38.0 38.0 33.2 38.0 105-109 35.91975 38.0 37.8 38.0 33.0 38.0 110-114 35.5538 38.0 37.0 38.0 31.2 38.0 115-119 35.44895 38.0 37.0 38.0 31.0 38.0 120-124 35.0668 38.0 36.2 38.0 28.8 38.0 125-129 34.86255 38.0 36.0 38.0 27.8 38.0 130-134 34.55720000000001 38.0 35.2 38.0 26.0 38.0 135-139 33.9185 38.0 34.2 38.0 22.4 38.0 140-144 33.5747 38.0 33.0 38.0 21.8 38.0 145-149 32.83675000000001 38.0 33.0 38.0 14.4 38.0 150-151 27.48975 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 2.0 4 3.0 5 1.0 6 1.0 7 1.0 8 5.0 9 1.0 10 2.0 11 3.0 12 1.0 13 4.0 14 2.0 15 4.0 16 5.0 17 5.0 18 8.0 19 9.0 20 8.0 21 11.0 22 11.0 23 8.0 24 15.0 25 14.0 26 15.0 27 28.0 28 29.0 29 33.0 30 43.0 31 72.0 32 66.0 33 97.0 34 145.0 35 255.0 36 681.0 37 2394.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.2 19.650000000000002 21.275 24.875 2 29.4 23.075000000000003 30.95 16.575 3 22.45 27.425 32.425 17.7 4 22.975 35.199999999999996 22.525000000000002 19.3 5 23.549999999999997 36.7 21.65 18.099999999999998 6 20.95 36.85 23.849999999999998 18.35 7 20.825 19.625 38.824999999999996 20.724999999999998 8 22.55 24.55 26.575 26.325 9 21.575 25.900000000000002 28.725 23.799999999999997 10-14 23.65 28.395 26.56 21.395 15-19 22.935 27.735 28.595 20.735 20-24 23.7 28.655 27.36 20.285 25-29 23.26 28.16 27.834999999999997 20.745 30-34 22.955000000000002 27.99 28.375 20.68 35-39 23.715 28.065 27.534999999999997 20.685000000000002 40-44 23.21 27.950000000000003 27.93 20.91 45-49 22.985 27.755000000000003 28.65 20.61 50-54 22.97 28.005000000000003 28.044999999999998 20.979999999999997 55-59 23.29 28.105000000000004 27.700000000000003 20.905 60-64 22.775000000000002 28.53 27.68 21.015 65-69 23.73 27.54 27.88 20.849999999999998 70-74 23.494999999999997 28.060000000000002 27.37 21.075 75-79 23.54 28.139999999999997 27.1 21.22 80-84 23.655 28.505000000000003 26.87 20.97 85-89 23.82 28.050000000000004 27.095000000000002 21.035 90-94 23.265 27.665 28.475 20.595 95-99 23.49 28.255000000000003 28.000000000000004 20.255000000000003 100-104 23.7 28.065 27.750000000000004 20.485 105-109 24.145 26.995 28.17 20.69 110-114 24.185000000000002 27.655 27.79 20.369999999999997 115-119 24.04 28.244999999999997 28.16 19.555 120-124 23.635 27.275 28.46 20.630000000000003 125-129 23.585 28.155 27.755000000000003 20.505000000000003 130-134 23.810000000000002 27.839999999999996 28.08 20.27 135-139 24.099999999999998 27.169999999999998 28.595 20.135 140-144 24.345 28.055000000000003 27.61 19.99 145-149 24.465 27.18 28.315 20.04 150-151 24.05 27.9125 28.075 19.9625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 1.5 25 2.0 26 3.5 27 5.5 28 5.0 29 9.5 30 14.0 31 23.5 32 32.5 33 34.5 34 47.0 35 65.5 36 87.0 37 104.5 38 133.0 39 171.0 40 199.5 41 208.5 42 235.0 43 262.5 44 268.5 45 284.0 46 271.0 47 240.0 48 239.0 49 218.5 50 173.0 51 144.0 52 119.5 53 95.0 54 73.5 55 61.0 56 41.5 57 33.5 58 28.0 59 14.0 60 8.5 61 8.0 62 8.0 63 4.5 64 3.5 65 3.0 66 2.5 67 2.0 68 1.5 69 1.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.46848899012907 98.25 2 0.2531004808909137 0.5 3 0.15186028853454822 0.44999999999999996 4 0.05062009617818274 0.2 5 0.02531004808909137 0.125 6 0.02531004808909137 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02531004808909137 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 13 0.325 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.32499999999999996 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.6375 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.85 0.0 0.0 0.0 0.0 124-125 0.95 0.0 0.0 0.0 0.0 126-127 1.0125 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.425 0.0 0.0 0.0 0.0 134-135 1.6125 0.0 0.0 0.0 0.0 136-137 1.8125 0.0 0.0 0.0 0.0 138-139 1.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 509300 spots for SRR7170853.sra Written 509300 spots for SRR7170853.sra Read 509300 spots for SRR7170853.sra Written 509300 spots for SRR7170853.sra Read 509300 spots for SRR7170853.sra Written 509300 spots for SRR7170853.sra Read 509300 spots for SRR7170853.sra Written 509300 spots for SRR7170853.sra Read 509300 spots for SRR7170853.sra Written 509300 spots for SRR7170853.sra Read 509300 spots for SRR7170853.sra Written 509300 spots for SRR7170853.sra Read 509300 spots for SRR7170853.sra Written 509300 spots for SRR7170853.sra Read 509300 spots for SRR7170853.sra Written 509300 spots for SRR7170853.sra Read 509300 spots for SRR7170853.sra Written 509300 spots for SRR7170853.sra Read 509300 spots for SRR7170853.sra Written 509300 spots for SRR7170853.sra Read 509300 spots for SRR7170853.sra Written 509300 spots for SRR7170853.sra Read 509300 spots for SRR7170853.sra Written 509300 spots for SRR7170853.sra Read 509300 spots for SRR7170853.sra Written 509300 spots for SRR7170853.sra Read 509300 spots for SRR7170853.sra Written 509300 spots for SRR7170853.sra Read 509300 spots for SRR7170853.sra Written 509300 spots for SRR7170853.sra Read 509300 spots for SRR7170853.sra Written 509300 spots for SRR7170853.sra Read 509300 spots for SRR7170853.sra Written 509300 spots for SRR7170853.sra Read 509300 spots for SRR7170853.sra Written 509300 spots for SRR7170853.sra Read 509300 spots for SRR7170853.sra Written 509300 spots for SRR7170853.sra Read 509310 spots for SRR7170853.sra Written 509310 spots for SRR7170853.sra SRR ids: ['SRR7170853.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i1ri4m92 SRR7170853.sra spots: 10186010 blocks: [[1, 509300], [509301, 1018600], [1018601, 1527900], [1527901, 2037200], [2037201, 2546500], [2546501, 3055800], [3055801, 3565100], [3565101, 4074400], [4074401, 4583700], [4583701, 5093000], [5093001, 5602300], [5602301, 6111600], [6111601, 6620900], [6620901, 7130200], [7130201, 7639500], [7639501, 8148800], [8148801, 8658100], [8658101, 9167400], [9167401, 9676700], [9676701, 10186010]] SRR7170853 file size 3430004 SRR7170853 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170853 SRR7170853_1.fastq SRR7170853_2.fastq Input file: SRR7170853_1.fastq Paired file: SRR7170853_2.fastq trimmed: SRR7170853-trimmed-pair1.fastq, SRR7170853-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:17:54 2025 >> started Thu Feb 13 19:18:07 2025 >> done (12.933s) 10186010 read pairs processed; of these: 20799 ( 0.20%) short read pairs filtered out after trimming by size control 36665 ( 0.36%) empty read pairs filtered out after trimming by size control 10128546 (99.44%) read pairs available; of these: 6121481 (60.44%) trimmed read pairs available after processing 4007065 (39.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 8 0.00% 21 8 0.00% 22 24 0.00% 23 11 0.00% 24 22 0.00% 25 16 0.00% 26 17 0.00% 27 20 0.00% 28 17 0.00% 29 17 0.00% 30 14 0.00% 31 17 0.00% 32 5 0.00% 33 16 0.00% 34 25 0.00% 35 13 0.00% 36 23 0.00% 37 24 0.00% 38 33 0.00% 39 30 0.00% 40 29 0.00% 41 40 0.00% 42 26 0.00% 43 26 0.00% 44 31 0.00% 45 55 0.00% 46 51 0.00% 47 99 0.00% 48 35 0.00% 49 46 0.00% 50 47 0.00% 51 52 0.00% 52 62 0.00% 53 61 0.00% 54 70 0.00% 55 89 0.00% 56 81 0.00% 57 88 0.00% 58 87 0.00% 59 118 0.00% 60 153 0.00% 61 177 0.00% 62 152 0.00% 63 180 0.00% 64 205 0.00% 65 190 0.00% 66 206 0.00% 67 239 0.00% 68 283 0.00% 69 270 0.00% 70 316 0.00% 71 419 0.00% 72 487 0.00% 73 610 0.01% 74 716 0.01% 75 943 0.01% 76 2983 0.03% 77 2458 0.02% 78 1106 0.01% 79 1055 0.01% 80 1152 0.01% 81 1277 0.01% 82 1474 0.01% 83 1827 0.02% 84 2850 0.03% 85 3044 0.03% 86 2935 0.03% 87 3129 0.03% 88 3282 0.03% 89 3494 0.03% 90 3583 0.04% 91 3706 0.04% 92 3799 0.04% 93 4007 0.04% 94 4012 0.04% 95 3959 0.04% 96 4188 0.04% 97 4227 0.04% 98 4291 0.04% 99 4378 0.04% 100 4792 0.05% 101 4774 0.05% 102 5314 0.05% 103 5705 0.06% 104 5991 0.06% 105 6332 0.06% 106 6628 0.07% 107 6753 0.07% 108 6767 0.07% 109 7274 0.07% 110 7551 0.07% 111 8141 0.08% 112 8716 0.09% 113 9286 0.09% 114 9836 0.10% 115 10429 0.10% 116 10889 0.11% 117 11277 0.11% 118 11615 0.11% 119 12064 0.12% 120 13028 0.13% 121 13551 0.13% 122 14625 0.14% 123 15893 0.16% 124 16976 0.17% 125 18269 0.18% 126 19420 0.19% 127 20523 0.20% 128 21764 0.21% 129 23023 0.23% 130 25001 0.25% 131 27007 0.27% 132 29113 0.29% 133 32075 0.32% 134 35279 0.35% 135 38726 0.38% 136 42676 0.42% 137 47000 0.46% 138 52341 0.52% 139 58710 0.58% 140 66362 0.66% 141 76554 0.76% 142 88375 0.87% 143 105664 1.04% 144 128304 1.27% 145 161372 1.59% 146 214141 2.11% 147 297617 2.94% 148 453497 4.48% 149 848425 8.38% 150 2876716 28.40% 151 4007065 39.56% 10128546 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=32 prefix-density=0.30 prefix-fanout=2.3 sequence=ATCATTTTACATATTGATAAAGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=39.96 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.9 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=30 prefix-density=0.37 prefix-fanout=2.7 sequence=TGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=61.74 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.2 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7170853 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:19:03 Started mapping on | Feb 13 19:19:03 Finished on | Feb 13 19:20:10 Mapping speed, Million of reads per hour | 544.22 Number of input reads | 10128546 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 9623850 Uniquely mapped reads % | 95.02% Average mapped length | 294.44 Number of splices: Total | 9061686 Number of splices: Annotated (sjdb) | 8859871 Number of splices: GT/AG | 8895889 Number of splices: GC/AG | 129984 Number of splices: AT/AC | 6430 Number of splices: Non-canonical | 29383 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.04% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 253812 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 19253 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.21% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 272854 272854 272854 N_multimapping 253812 253812 253812 N_noFeature 285240 9356302 337201 N_ambiguous 291891 771 76064 UnstrandedReadsAssigned:9046719 PositiveStrandReadsAssigned:266777 NegativeStrandReadsAssigned:9210585 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170853 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170853-trimmed-pair1.fastq SRR7170853-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,128,546 reads, 9,086,700 reads pseudoaligned [quant] estimated average fragment length: 284.541 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52401 SRR7170853.ke.tsv 34699 SRR7170853.se.tsv 87100 total ==> SRR7170853.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1734.46 691 28.9565 Potri.005G024800.1.v4.1 1035 751.459 241 23.3101 Potri.004G059700.1.v4.1 961 677.491 10 1.07282 Potri.007G009000.2.v4.1 1416 1132.46 0 0 Potri.003G141000.2.v4.1 2943 2659.46 355 9.70213 Potri.016G087400.1.v4.1 270 63.8817 549 624.637 Potri.015G069301.1.v4.1 564 287.437 0 0 Potri.010G195200.1.v4.1 1773 1489.46 137 6.68535 Potri.012G127500.1.v4.1 977 693.478 97 10.1665 ==> SRR7170853.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 176 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 273 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170853 completed mapping pipeline successfully