Starting /dee2/code/volunteer_pipeline.sh SRR7170854 current disk space = 3087321198592 free memory = 1471890400 SRR7170854 SRAfilesize 18e3b7e803923829c331bf667dc1016e SRR7170854.sra SRR7170854.sra file validated SRR7170854 is paired end SRR7170854 is conventional basespace SRR7170854 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170854_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.44125 34.0 33.0 34.0 32.0 34.0 2 33.0745 34.0 33.0 34.0 32.0 34.0 3 33.1715 34.0 33.0 34.0 32.0 34.0 4 33.201 34.0 33.0 34.0 32.0 34.0 5 33.14925 34.0 33.0 34.0 32.0 34.0 6 36.638 38.0 37.0 38.0 34.0 38.0 7 37.10675 38.0 38.0 38.0 36.0 38.0 8 37.2455 38.0 38.0 38.0 36.0 38.0 9 37.278 38.0 38.0 38.0 37.0 38.0 10-14 37.281749999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.205650000000006 38.0 38.0 38.0 36.2 38.0 20-24 37.227050000000006 38.0 38.0 38.0 36.0 38.0 25-29 37.1262 38.0 38.0 38.0 36.0 38.0 30-34 37.0348 38.0 38.0 38.0 35.8 38.0 35-39 36.98625 38.0 38.0 38.0 35.8 38.0 40-44 36.872949999999996 38.0 38.0 38.0 35.0 38.0 45-49 36.859950000000005 38.0 38.0 38.0 35.2 38.0 50-54 36.662150000000004 38.0 38.0 38.0 34.2 38.0 55-59 36.56905 38.0 38.0 38.0 34.0 38.0 60-64 36.6383 38.0 38.0 38.0 34.2 38.0 65-69 36.510949999999994 38.0 38.0 38.0 34.0 38.0 70-74 36.35105 38.0 37.6 38.0 34.0 38.0 75-79 35.99915 38.0 37.0 38.0 32.8 38.0 80-84 35.64475 38.0 37.0 38.0 31.2 38.0 85-89 35.69619999999999 38.0 37.0 38.0 31.6 38.0 90-94 35.4971 38.0 36.8 38.0 30.2 38.0 95-99 35.237350000000006 38.0 36.0 38.0 29.0 38.0 100-104 35.0093 38.0 36.0 38.0 28.2 38.0 105-109 34.756299999999996 38.0 35.6 38.0 27.2 38.0 110-114 34.5332 38.0 35.0 38.0 25.4 38.0 115-119 34.22365 38.0 34.2 38.0 24.0 38.0 120-124 33.795899999999996 38.0 33.0 38.0 21.6 38.0 125-129 33.110299999999995 38.0 32.8 38.0 17.0 38.0 130-134 32.5278 37.6 31.6 38.0 14.6 38.0 135-139 31.6935 37.0 30.0 38.0 13.4 38.0 140-144 30.813650000000003 36.4 28.4 38.0 12.2 38.0 145-149 29.1873 35.8 27.0 38.0 2.0 38.0 150-151 23.055374999999998 29.0 7.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 3.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 3.0 16 3.0 17 7.0 18 14.0 19 32.0 20 6.0 21 12.0 22 13.0 23 14.0 24 19.0 25 22.0 26 38.0 27 38.0 28 53.0 29 55.0 30 67.0 31 105.0 32 138.0 33 198.0 34 279.0 35 488.0 36 1116.0 37 1274.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.37605742117406 13.842604460394769 14.662906946936683 38.118431171494485 2 20.65 19.7 37.525 22.125 3 18.075 24.65 30.3 26.974999999999998 4 20.424999999999997 33.525 23.425 22.625 5 22.225 36.225 23.200000000000003 18.35 6 18.224999999999998 36.975 25.974999999999998 18.825 7 13.025 23.974999999999998 44.9 18.099999999999998 8 18.8 25.575 29.099999999999998 26.525 9 18.4 24.375 32.35 24.875 10-14 19.38 30.29 26.38 23.95 15-19 19.805 28.720000000000002 27.779999999999998 23.695 20-24 19.85 29.054999999999996 27.975 23.119999999999997 25-29 19.59 29.685 27.37 23.355 30-34 18.94 29.56 27.91 23.59 35-39 20.294999999999998 29.325000000000003 27.134999999999998 23.244999999999997 40-44 19.955000000000002 29.34 27.839999999999996 22.865 45-49 20.085 28.675 27.785 23.455000000000002 50-54 20.315 28.865000000000002 27.794999999999998 23.025000000000002 55-59 20.145 28.794999999999998 27.650000000000002 23.41 60-64 19.73 28.68 27.66 23.93 65-69 20.24 29.585 26.895000000000003 23.28 70-74 20.025000000000002 29.705 26.924999999999997 23.345 75-79 19.759999999999998 29.475 26.974999999999998 23.79 80-84 20.535 28.999999999999996 27.01 23.455000000000002 85-89 19.91 28.810000000000002 27.365000000000002 23.915 90-94 20.369999999999997 28.785 27.235 23.61 95-99 20.79 28.38 26.974999999999998 23.855 100-104 20.36 29.220000000000002 26.715 23.705000000000002 105-109 20.419999999999998 29.32 26.58 23.68 110-114 20.605 28.835 26.355 24.205 115-119 20.79 28.87 26.784999999999997 23.555 120-124 20.715 28.645 26.82 23.82 125-129 20.94 28.925 26.365 23.77 130-134 21.310000000000002 28.21 26.284999999999997 24.195 135-139 21.195 28.57 26.155 24.08 140-144 20.94 28.294999999999998 26.41 24.355 145-149 21.044999999999998 28.51 25.8 24.645 150-151 20.9875 28.1 25.7375 25.174999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 1.5 22 1.5 23 1.0 24 2.5 25 6.0 26 6.5 27 10.5 28 19.0 29 25.0 30 31.0 31 38.5 32 47.0 33 61.0 34 87.5 35 96.0 36 96.5 37 118.0 38 144.0 39 162.5 40 184.0 41 201.5 42 222.5 43 231.5 44 233.5 45 249.5 46 247.5 47 237.5 48 208.0 49 186.0 50 179.0 51 153.0 52 118.5 53 100.5 54 80.5 55 55.5 56 42.5 57 31.0 58 24.0 59 16.5 60 11.0 61 6.5 62 5.0 63 5.0 64 2.5 65 1.0 66 1.0 67 1.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.97881031401583 96.925 2 0.8680112330865458 1.7000000000000002 3 0.051059484299208584 0.15 4 0.07658922644881287 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025529742149604292 0.9249999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTAT 37 0.9249999999999999 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.1875 0.0 0.0 0.0 0.0 68-69 0.21250000000000002 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.32499999999999996 0.0 0.0 0.0 0.0 76-77 0.45 0.0 0.0 0.0 0.0 78-79 0.525 0.0 0.0 0.0 0.0 80-81 0.6125 0.0 0.0 0.0 0.0 82-83 0.7375 0.0 0.0 0.0 0.0 84-85 0.925 0.0 0.0 0.0 0.0 86-87 1.125 0.0 0.0 0.0 0.0 88-89 1.3375 0.0 0.0 0.0 0.0 90-91 1.5125000000000002 0.0 0.0 0.0 0.0 92-93 1.7125 0.0 0.0 0.0 0.0 94-95 2.025 0.0 0.0 0.0 0.0 96-97 2.3875 0.0 0.0 0.0 0.0 98-99 2.7 0.0 0.0 0.0 0.0 100-101 3.0 0.0 0.0 0.0 0.0 102-103 3.3 0.0 0.0 0.0 0.0 104-105 3.6500000000000004 0.0 0.0 0.0 0.0 106-107 4.0625 0.0 0.0 0.0 0.0 108-109 4.4875 0.0 0.0 0.0 0.0 110-111 4.9125 0.0 0.0 0.0 0.0 112-113 5.525 0.0 0.0 0.0 0.0 114-115 6.0375 0.0 0.0 0.0 0.0 116-117 6.55 0.0 0.0 0.0 0.0 118-119 7.175 0.0 0.0 0.0 0.0 120-121 7.55 0.0 0.0 0.0 0.0 122-123 7.9624999999999995 0.0 0.0 0.0 0.0 124-125 8.6 0.0 0.0 0.0 0.0 126-127 9.3875 0.0 0.0 0.0 0.0 128-129 9.9875 0.0 0.0 0.0 0.0 130-131 10.575 0.0 0.0 0.0 0.0 132-133 11.3625 0.0 0.0 0.0 0.0 134-135 12.1125 0.0 0.0 0.0 0.0 136-137 12.8375 0.0 0.0 0.0 0.0 138-139 13.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTGAC 10 0.006830828 145.0 5 GGAAGGT 10 0.006830828 145.0 1 GTGGATC 10 0.006830828 145.0 145 AAGTCCT 10 0.006830828 145.0 6 GAAGGTA 10 0.006830828 145.0 2 >>END_MODULE SRR7170854 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170854_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6195 33.0 33.0 34.0 32.0 34.0 2 32.739 33.0 33.0 34.0 32.0 34.0 3 32.78425 33.0 33.0 34.0 32.0 34.0 4 32.8175 33.0 33.0 34.0 32.0 34.0 5 32.85625 33.0 33.0 34.0 32.0 34.0 6 37.05775 38.0 38.0 38.0 36.0 38.0 7 37.14775 38.0 38.0 38.0 37.0 38.0 8 36.857 38.0 38.0 38.0 36.0 38.0 9 36.89025 38.0 38.0 38.0 36.0 38.0 10-14 36.9778 38.0 38.0 38.0 36.0 38.0 15-19 36.97695 38.0 38.0 38.0 36.0 38.0 20-24 36.91655 38.0 38.0 38.0 36.0 38.0 25-29 36.827949999999994 38.0 38.0 38.0 35.8 38.0 30-34 36.8346 38.0 38.0 38.0 35.8 38.0 35-39 36.80675 38.0 38.0 38.0 35.6 38.0 40-44 36.8121 38.0 38.0 38.0 36.0 38.0 45-49 36.754000000000005 38.0 38.0 38.0 35.2 38.0 50-54 36.7667 38.0 38.0 38.0 35.2 38.0 55-59 36.6827 38.0 38.0 38.0 35.0 38.0 60-64 36.64955 38.0 38.0 38.0 35.0 38.0 65-69 36.56175 38.0 38.0 38.0 34.2 38.0 70-74 36.51205 38.0 38.0 38.0 34.0 38.0 75-79 36.41700000000001 38.0 38.0 38.0 34.0 38.0 80-84 35.9842 38.0 38.0 38.0 33.4 38.0 85-89 35.868849999999995 38.0 37.8 38.0 33.0 38.0 90-94 35.727850000000004 38.0 37.2 38.0 32.6 38.0 95-99 35.5564 38.0 37.0 38.0 31.0 38.0 100-104 35.33630000000001 38.0 37.0 38.0 30.2 38.0 105-109 35.191050000000004 38.0 36.8 38.0 29.4 38.0 110-114 34.873549999999994 38.0 36.2 38.0 28.0 38.0 115-119 34.456900000000005 38.0 35.6 38.0 24.8 38.0 120-124 34.30785 38.0 35.0 38.0 24.6 38.0 125-129 33.9056 38.0 34.6 38.0 22.8 38.0 130-134 33.40535 38.0 33.8 38.0 19.8 38.0 135-139 33.09275000000001 38.0 33.0 38.0 18.6 38.0 140-144 32.017199999999995 38.0 32.0 38.0 12.8 38.0 145-149 30.38395 36.6 29.0 38.0 4.2 38.0 150-151 24.545875 31.5 14.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 1.0 5 0.0 6 1.0 7 0.0 8 1.0 9 1.0 10 2.0 11 1.0 12 5.0 13 4.0 14 8.0 15 8.0 16 4.0 17 7.0 18 12.0 19 20.0 20 25.0 21 4.0 22 14.0 23 16.0 24 22.0 25 29.0 26 24.0 27 30.0 28 43.0 29 47.0 30 55.0 31 69.0 32 99.0 33 141.0 34 203.0 35 311.0 36 839.0 37 1945.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.7 19.35 18.3 25.650000000000002 2 28.65 25.1 30.3 15.950000000000001 3 22.775000000000002 27.925 30.65 18.65 4 23.05 34.55 23.925 18.475 5 25.724999999999998 35.275 21.525 17.474999999999998 6 21.575 36.075 24.425 17.925 7 18.375 20.7 40.875 20.05 8 23.3 25.0 25.825 25.874999999999996 9 22.775000000000002 24.725 28.1 24.4 10-14 23.415 28.33 26.57 21.685 15-19 23.7 27.83 28.17 20.3 20-24 23.74 28.804999999999996 27.16 20.294999999999998 25-29 23.185 28.63 27.455000000000002 20.73 30-34 22.865 27.839999999999996 28.605000000000004 20.69 35-39 22.805 27.875 28.134999999999998 21.185000000000002 40-44 23.415 28.68 27.655 20.25 45-49 23.62 28.12 27.575 20.685000000000002 50-54 23.26 28.325 27.900000000000002 20.515 55-59 24.19 27.339999999999996 27.98 20.49 60-64 23.41 27.755000000000003 28.125 20.71 65-69 23.385 27.51 28.515 20.59 70-74 22.63 28.595 27.735 21.04 75-79 23.169999999999998 29.28 27.025 20.525 80-84 23.32 28.46 27.72 20.5 85-89 23.94 27.915 27.96 20.185 90-94 24.115000000000002 28.144999999999996 27.500000000000004 20.24 95-99 23.544999999999998 28.325 27.775 20.355 100-104 23.955000000000002 27.85 27.855 20.34 105-109 24.025 27.694999999999997 28.215 20.064999999999998 110-114 24.005000000000003 27.855 27.92 20.22 115-119 24.685000000000002 27.555000000000003 27.560000000000002 20.200000000000003 120-124 24.8 28.565 27.389999999999997 19.245 125-129 25.495 28.1 26.97 19.435 130-134 25.230000000000004 28.13 27.705000000000002 18.935 135-139 25.6 27.810000000000002 27.375 19.215 140-144 26.025 27.800000000000004 27.04 19.134999999999998 145-149 26.669999999999998 28.444999999999997 26.169999999999998 18.715 150-151 26.737499999999997 28.287499999999998 26.5625 18.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.0 19 0.0 20 0.5 21 1.5 22 2.5 23 3.5 24 4.0 25 5.5 26 6.5 27 4.0 28 7.0 29 14.0 30 18.5 31 25.5 32 36.5 33 41.5 34 49.0 35 70.5 36 90.5 37 108.0 38 127.5 39 156.5 40 203.5 41 223.5 42 232.5 43 259.0 44 265.5 45 249.0 46 248.0 47 234.0 48 214.5 49 204.0 50 180.5 51 148.5 52 115.5 53 101.0 54 95.0 55 76.0 56 50.0 57 36.0 58 25.5 59 19.0 60 11.5 61 8.5 62 6.0 63 4.0 64 3.5 65 1.0 66 0.5 67 1.5 68 1.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.18575063613233 97.45 2 0.6106870229007634 1.2 3 0.178117048346056 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02544529262086514 0.8250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCT 33 0.8250000000000001 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.1875 0.0 0.0 0.0 0.0 68-69 0.21250000000000002 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.30000000000000004 0.0 0.0 0.0 0.0 76-77 0.425 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.5875 0.0 0.0 0.0 0.0 82-83 0.7125 0.0 0.0 0.0 0.0 84-85 0.8875 0.0 0.0 0.0 0.0 86-87 1.075 0.0 0.0 0.0 0.0 88-89 1.2875 0.0 0.0 0.0 0.0 90-91 1.4874999999999998 0.0 0.0 0.0 0.0 92-93 1.6875 0.0 0.0 0.0 0.0 94-95 2.0 0.0 0.0 0.0 0.0 96-97 2.3499999999999996 0.0 0.0 0.0 0.0 98-99 2.6500000000000004 0.0 0.0 0.0 0.0 100-101 2.9625 0.0 0.0 0.0 0.0 102-103 3.2750000000000004 0.0 0.0 0.0 0.0 104-105 3.5999999999999996 0.0 0.0 0.0 0.0 106-107 4.025 0.0 0.0 0.0 0.0 108-109 4.475 0.0 0.0 0.0 0.0 110-111 4.8625 0.0 0.0 0.0 0.0 112-113 5.4875 0.0 0.0 0.0 0.0 114-115 5.9875 0.0 0.0 0.0 0.0 116-117 6.525 0.0 0.0 0.0 0.0 118-119 7.15 0.0 0.0 0.0 0.0 120-121 7.55 0.0 0.0 0.0 0.0 122-123 7.9875 0.0 0.0 0.0 0.0 124-125 8.6375 0.0 0.0 0.0 0.0 126-127 9.425 0.0 0.0 0.0 0.0 128-129 10.024999999999999 0.0 0.0 0.0 0.0 130-131 10.6125 0.0 0.0 0.0 0.0 132-133 11.3875 0.0 0.0 0.0 0.0 134-135 12.162500000000001 0.0 0.0 0.0 0.0 136-137 12.8625 0.0 0.0 0.0 0.0 138-139 13.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAATTG 10 0.006830828 145.0 2 >>END_MODULE Read 891379 spots for SRR7170854.sra Written 891379 spots for SRR7170854.sra Read 891379 spots for SRR7170854.sra Written 891379 spots for SRR7170854.sra Read 891379 spots for SRR7170854.sra Written 891379 spots for SRR7170854.sra Read 891379 spots for SRR7170854.sra Written 891379 spots for SRR7170854.sra Read 891379 spots for SRR7170854.sra Written 891379 spots for SRR7170854.sra Read 891379 spots for SRR7170854.sra Written 891379 spots for SRR7170854.sra Read 891379 spots for SRR7170854.sra Written 891379 spots for SRR7170854.sra Read 891379 spots for SRR7170854.sra Written 891379 spots for SRR7170854.sra Read 891379 spots for SRR7170854.sra Written 891379 spots for SRR7170854.sra Read 891379 spots for SRR7170854.sra Written 891379 spots for SRR7170854.sra Read 891379 spots for SRR7170854.sra Written 891379 spots for SRR7170854.sra Read 891379 spots for SRR7170854.sra Written 891379 spots for SRR7170854.sra Read 891379 spots for SRR7170854.sra Written 891379 spots for SRR7170854.sra Read 891379 spots for SRR7170854.sra Written 891379 spots for SRR7170854.sra Read 891379 spots for SRR7170854.sra Written 891379 spots for SRR7170854.sra Read 891379 spots for SRR7170854.sra Written 891379 spots for SRR7170854.sra Read 891379 spots for SRR7170854.sra Written 891379 spots for SRR7170854.sra Read 891379 spots for SRR7170854.sra Written 891379 spots for SRR7170854.sra Read 891379 spots for SRR7170854.sra Written 891379 spots for SRR7170854.sra Read 891396 spots for SRR7170854.sra Written 891396 spots for SRR7170854.sra SRR ids: ['SRR7170854.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9fuepf4o SRR7170854.sra spots: 17827597 blocks: [[1, 891379], [891380, 1782758], [1782759, 2674137], [2674138, 3565516], [3565517, 4456895], [4456896, 5348274], [5348275, 6239653], [6239654, 7131032], [7131033, 8022411], [8022412, 8913790], [8913791, 9805169], [9805170, 10696548], [10696549, 11587927], [11587928, 12479306], [12479307, 13370685], [13370686, 14262064], [14262065, 15153443], [15153444, 16044822], [16044823, 16936201], [16936202, 17827597]] SRR7170854 file size 6019487 SRR7170854 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170854 SRR7170854_1.fastq SRR7170854_2.fastq Input file: SRR7170854_1.fastq Paired file: SRR7170854_2.fastq trimmed: SRR7170854-trimmed-pair1.fastq, SRR7170854-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:31:25 2025 >> started Thu Feb 13 19:31:56 2025 >> done (31.384s) 17827597 read pairs processed; of these: 24006 ( 0.13%) short read pairs filtered out after trimming by size control 173826 ( 0.98%) empty read pairs filtered out after trimming by size control 17629765 (98.89%) read pairs available; of these: 12584058 (71.38%) trimmed read pairs available after processing 5045707 (28.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 23 0.00% 20 13 0.00% 21 21 0.00% 22 19 0.00% 23 15 0.00% 24 20 0.00% 25 13 0.00% 26 24 0.00% 27 23 0.00% 28 24 0.00% 29 22 0.00% 30 20 0.00% 31 33 0.00% 32 29 0.00% 33 30 0.00% 34 44 0.00% 35 45 0.00% 36 46 0.00% 37 63 0.00% 38 81 0.00% 39 106 0.00% 40 116 0.00% 41 148 0.00% 42 129 0.00% 43 119 0.00% 44 143 0.00% 45 184 0.00% 46 237 0.00% 47 276 0.00% 48 328 0.00% 49 331 0.00% 50 395 0.00% 51 514 0.00% 52 555 0.00% 53 607 0.00% 54 587 0.00% 55 572 0.00% 56 693 0.00% 57 774 0.00% 58 918 0.01% 59 1028 0.01% 60 1194 0.01% 61 1411 0.01% 62 1563 0.01% 63 1734 0.01% 64 1899 0.01% 65 1908 0.01% 66 2028 0.01% 67 2267 0.01% 68 2405 0.01% 69 2860 0.02% 70 3391 0.02% 71 3957 0.02% 72 4569 0.03% 73 5326 0.03% 74 6233 0.04% 75 7779 0.04% 76 15923 0.09% 77 15221 0.09% 78 9504 0.05% 79 8719 0.05% 80 9336 0.05% 81 10405 0.06% 82 11713 0.07% 83 13263 0.08% 84 15101 0.09% 85 15422 0.09% 86 16267 0.09% 87 17010 0.10% 88 17900 0.10% 89 18975 0.11% 90 20354 0.12% 91 22461 0.13% 92 24419 0.14% 93 26445 0.15% 94 28279 0.16% 95 29934 0.17% 96 30489 0.17% 97 30987 0.18% 98 31752 0.18% 99 33347 0.19% 100 35269 0.20% 101 37214 0.21% 102 39838 0.23% 103 42187 0.24% 104 44067 0.25% 105 46345 0.26% 106 47488 0.27% 107 47886 0.27% 108 49068 0.28% 109 50062 0.28% 110 51419 0.29% 111 53577 0.30% 112 56175 0.32% 113 58918 0.33% 114 61780 0.35% 115 64084 0.36% 116 65191 0.37% 117 66012 0.37% 118 67563 0.38% 119 67907 0.39% 120 70123 0.40% 121 72891 0.41% 122 75381 0.43% 123 79120 0.45% 124 82548 0.47% 125 85322 0.48% 126 88416 0.50% 127 90215 0.51% 128 92897 0.53% 129 96300 0.55% 130 99433 0.56% 131 103036 0.58% 132 108648 0.62% 133 115170 0.65% 134 122388 0.69% 135 129385 0.73% 136 137778 0.78% 137 147388 0.84% 138 157040 0.89% 139 168452 0.96% 140 181652 1.03% 141 198085 1.12% 142 220783 1.25% 143 249757 1.42% 144 287336 1.63% 145 338842 1.92% 146 424445 2.41% 147 559317 3.17% 148 809231 4.59% 149 1397361 7.93% 150 4210132 23.88% 151 5045707 28.62% 17629765 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=38 prefix-density=0.31 prefix-fanout=2.0 sequence=TGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=69.37 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.0 sequence=GATCTTCAAAAAACCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAAC criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=34 prefix-density=1.01 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=34.75 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=1.4 sequence=TTACTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGT SRR7170854 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:32:40 Started mapping on | Feb 13 19:32:41 Finished on | Feb 13 19:37:00 Mapping speed, Million of reads per hour | 245.05 Number of input reads | 17629765 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 16468034 Uniquely mapped reads % | 93.41% Average mapped length | 285.31 Number of splices: Total | 14226011 Number of splices: Annotated (sjdb) | 13886999 Number of splices: GT/AG | 13940072 Number of splices: GC/AG | 224649 Number of splices: AT/AC | 12034 Number of splices: Non-canonical | 49256 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 440322 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 71537 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.60% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 736616 736616 736616 N_multimapping 440322 440322 440322 N_noFeature 670357 16086453 813751 N_ambiguous 356490 1364 117476 UnstrandedReadsAssigned:15441187 PositiveStrandReadsAssigned:380217 NegativeStrandReadsAssigned:15536807 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=138 echo kmer=133 SRR7170854 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170854-trimmed-pair1.fastq SRR7170854-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,629,765 reads, 15,457,379 reads pseudoaligned [quant] estimated average fragment length: 218.533 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,186 rounds 52401 SRR7170854.ke.tsv 34699 SRR7170854.se.tsv 87100 total ==> SRR7170854.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.47 472 13.8158 Potri.005G024800.1.v4.1 1035 817.467 505 32.5567 Potri.004G059700.1.v4.1 961 743.481 5 0.354421 Potri.007G009000.2.v4.1 1416 1198.47 2 0.0879474 Potri.003G141000.2.v4.1 2943 2725.47 574.65 11.1117 Potri.016G087400.1.v4.1 270 95.9124 770 423.092 Potri.015G069301.1.v4.1 564 349.64 0 0 Potri.010G195200.1.v4.1 1773 1555.47 76 2.57497 Potri.012G127500.1.v4.1 977 759.481 329 22.8296 ==> SRR7170854.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 325 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 462 Potri.001G212900.v4.1 19 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 46 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 19 SRR7170854 completed mapping pipeline successfully