Starting /dee2/code/volunteer_pipeline.sh SRR7170855 current disk space = 3087409537024 free memory = 1430736780 SRR7170855 SRAfilesize 774c7b61036b1284baaeef26449e8d91 SRR7170855.sra SRR7170855.sra file validated SRR7170855 is paired end SRR7170855 is conventional basespace SRR7170855 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170855_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83625 34.0 33.0 34.0 32.0 34.0 2 33.2745 34.0 33.0 34.0 33.0 34.0 3 33.21275 34.0 33.0 34.0 33.0 34.0 4 33.364 34.0 33.0 34.0 33.0 34.0 5 33.3355 34.0 33.0 34.0 33.0 34.0 6 36.6965 38.0 37.0 38.0 34.0 38.0 7 37.22325 38.0 38.0 38.0 36.0 38.0 8 37.2975 38.0 38.0 38.0 37.0 38.0 9 37.36975 38.0 38.0 38.0 37.0 38.0 10-14 37.3738 38.0 38.0 38.0 37.0 38.0 15-19 37.32925 38.0 38.0 38.0 37.0 38.0 20-24 37.24985 38.0 38.0 38.0 36.8 38.0 25-29 37.2414 38.0 38.0 38.0 36.8 38.0 30-34 37.11985 38.0 38.0 38.0 36.0 38.0 35-39 37.0939 38.0 38.0 38.0 36.0 38.0 40-44 36.9621 38.0 38.0 38.0 35.8 38.0 45-49 36.879200000000004 38.0 38.0 38.0 35.4 38.0 50-54 36.6714 38.0 38.0 38.0 34.4 38.0 55-59 36.56025 38.0 38.0 38.0 34.2 38.0 60-64 36.5701 38.0 38.0 38.0 34.2 38.0 65-69 36.48365 38.0 37.8 38.0 33.8 38.0 70-74 36.5082 38.0 37.8 38.0 34.2 38.0 75-79 36.224000000000004 38.0 37.0 38.0 33.6 38.0 80-84 36.074 38.0 37.0 38.0 33.2 38.0 85-89 35.8149 38.0 37.0 38.0 31.8 38.0 90-94 35.6151 38.0 36.6 38.0 30.2 38.0 95-99 35.509699999999995 38.0 36.2 38.0 29.4 38.0 100-104 34.948 38.0 35.4 38.0 27.6 38.0 105-109 34.664699999999996 38.0 34.8 38.0 25.8 38.0 110-114 34.35975 38.0 34.2 38.0 24.8 38.0 115-119 34.106849999999994 38.0 33.6 38.0 23.6 38.0 120-124 33.299600000000005 38.0 33.0 38.0 19.2 38.0 125-129 32.44154999999999 37.8 31.4 38.0 14.0 38.0 130-134 31.805500000000002 37.0 30.2 38.0 13.8 38.0 135-139 30.70555 36.0 28.0 38.0 13.0 38.0 140-144 30.5254 36.2 28.2 38.0 11.8 38.0 145-149 28.58385 35.0 24.2 38.0 2.0 38.0 150-151 21.616500000000002 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 4.0 14 2.0 15 3.0 16 5.0 17 4.0 18 10.0 19 11.0 20 8.0 21 1.0 22 13.0 23 22.0 24 19.0 25 36.0 26 42.0 27 40.0 28 47.0 29 58.0 30 76.0 31 105.0 32 146.0 33 207.0 34 344.0 35 576.0 36 1122.0 37 1094.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.65212981744422 14.401622718052739 10.344827586206897 37.60141987829614 2 20.825 18.875 36.75 23.549999999999997 3 18.98449224612306 26.863431715857928 26.738369184592298 27.41370685342671 4 20.25 34.875 22.55 22.325 5 20.974999999999998 37.675 23.525 17.825 6 17.275 36.8 26.224999999999998 19.7 7 14.399999999999999 24.775 42.925000000000004 17.9 8 16.775000000000002 24.45 30.925000000000004 27.85 9 17.175 24.975 33.45 24.4 10-14 19.57 30.175 25.924999999999997 24.33 15-19 19.634999999999998 29.080000000000002 27.54 23.745 20-24 19.375 29.099999999999998 27.589999999999996 23.935000000000002 25-29 18.884999999999998 29.24 27.925 23.95 30-34 19.225 29.25 27.98 23.544999999999998 35-39 20.03 29.07 27.6 23.3 40-44 19.665 29.885 27.200000000000003 23.25 45-49 19.655 28.915000000000003 27.82 23.61 50-54 19.805 28.715000000000003 28.15 23.330000000000002 55-59 19.955000000000002 28.93 27.575 23.54 60-64 20.19 28.54 27.665 23.605 65-69 19.965 29.575000000000003 26.39 24.07 70-74 20.225 28.444999999999997 27.875 23.455000000000002 75-79 20.055 29.265 27.495000000000005 23.185 80-84 20.345 28.33 27.389999999999997 23.935000000000002 85-89 20.125 28.7 27.605 23.57 90-94 20.165 28.895 27.24 23.7 95-99 20.369999999999997 28.115000000000002 27.46 24.055 100-104 20.36 28.515 27.185 23.94 105-109 20.630000000000003 28.785 27.229999999999997 23.355 110-114 20.669999999999998 28.835 26.919999999999998 23.575 115-119 20.669999999999998 28.53 26.979999999999997 23.82 120-124 21.01 28.52 26.484999999999996 23.985 125-129 20.495 28.999999999999996 26.25 24.255 130-134 20.945 29.085 26.405 23.565 135-139 20.835 28.57 26.634999999999998 23.96 140-144 20.955 28.675 26.534999999999997 23.835 145-149 20.405 28.765 25.835 24.995 150-151 20.7625 28.462500000000002 26.487500000000004 24.2875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 2.0 22 2.5 23 1.5 24 2.5 25 5.0 26 7.0 27 10.0 28 13.0 29 21.0 30 32.5 31 33.0 32 35.5 33 46.5 34 67.5 35 94.5 36 110.0 37 130.0 38 138.5 39 157.5 40 202.0 41 215.0 42 218.5 43 235.5 44 250.0 45 263.5 46 267.0 47 244.5 48 205.5 49 172.0 50 158.0 51 139.5 52 105.0 53 89.5 54 81.0 55 66.5 56 58.5 57 42.5 58 20.0 59 14.5 60 13.5 61 6.5 62 3.5 63 3.5 64 2.5 65 1.0 66 1.5 67 1.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0599593495935 97.475 2 0.584349593495935 1.15 3 0.22865853658536583 0.675 4 0.025406504065040653 0.1 5 0.025406504065040653 0.125 6 0.05081300813008131 0.3 7 0.025406504065040653 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 7 0.17500000000000002 No Hit GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 6 0.15 TruSeq Adapter, Index 13 (97% over 38bp) GTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.725 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 1.0499999999999998 0.0 0.0 0.0 0.0 96-97 1.35 0.0 0.0 0.0 0.0 98-99 1.5125000000000002 0.0 0.0 0.0 0.0 100-101 1.675 0.0 0.0 0.0 0.0 102-103 1.95 0.0 0.0 0.0 0.0 104-105 2.2375 0.0 0.0 0.0 0.0 106-107 2.7125 0.0 0.0 0.0 0.0 108-109 3.35 0.0 0.0 0.0 0.0 110-111 3.8125 0.0 0.0 0.0 0.0 112-113 4.275 0.0 0.0 0.0 0.0 114-115 4.737500000000001 0.0 0.0 0.0 0.0 116-117 5.2625 0.0 0.0 0.0 0.0 118-119 5.925 0.0 0.0 0.0 0.0 120-121 6.4 0.0 0.0 0.0 0.0 122-123 6.8875 0.0 0.0 0.0 0.0 124-125 7.512499999999999 0.0 0.0 0.0 0.0 126-127 8.075 0.0 0.0 0.0 0.0 128-129 8.5625 0.0 0.0 0.0 0.0 130-131 9.15 0.0 0.0 0.0 0.0 132-133 9.9375 0.0 0.0 0.0 0.0 134-135 10.725 0.0 0.0 0.0 0.0 136-137 11.65 0.0 0.0 0.0 0.0 138-139 12.462499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGAAG 10 0.006832588 144.9875 5 >>END_MODULE SRR7170855 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170855_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91175 33.0 33.0 34.0 32.0 34.0 2 33.04925 33.0 33.0 34.0 32.0 34.0 3 33.04375 34.0 33.0 34.0 32.0 34.0 4 32.99075 34.0 33.0 34.0 32.0 34.0 5 33.04025 34.0 33.0 34.0 32.0 34.0 6 37.1235 38.0 38.0 38.0 37.0 38.0 7 37.18475 38.0 38.0 38.0 37.0 38.0 8 37.23625 38.0 38.0 38.0 37.0 38.0 9 37.253 38.0 38.0 38.0 37.0 38.0 10-14 37.2336 38.0 38.0 38.0 37.0 38.0 15-19 37.165200000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.12635 38.0 38.0 38.0 37.0 38.0 25-29 37.071600000000004 38.0 38.0 38.0 36.6 38.0 30-34 36.98145 38.0 38.0 38.0 36.0 38.0 35-39 36.982600000000005 38.0 38.0 38.0 36.0 38.0 40-44 37.0565 38.0 38.0 38.0 36.2 38.0 45-49 37.03425 38.0 38.0 38.0 36.0 38.0 50-54 36.9373 38.0 38.0 38.0 36.0 38.0 55-59 36.9091 38.0 38.0 38.0 36.0 38.0 60-64 36.79215 38.0 38.0 38.0 36.0 38.0 65-69 36.7227 38.0 38.0 38.0 35.2 38.0 70-74 36.708149999999996 38.0 38.0 38.0 35.2 38.0 75-79 36.648700000000005 38.0 38.0 38.0 35.0 38.0 80-84 36.39915 38.0 38.0 38.0 34.2 38.0 85-89 36.3016 38.0 38.0 38.0 34.0 38.0 90-94 36.144549999999995 38.0 38.0 38.0 33.8 38.0 95-99 36.1057 38.0 37.8 38.0 33.4 38.0 100-104 35.93695 38.0 37.2 38.0 33.2 38.0 105-109 35.7821 38.0 37.0 38.0 32.0 38.0 110-114 35.57215 38.0 37.0 38.0 31.0 38.0 115-119 35.30310000000001 38.0 36.4 38.0 30.2 38.0 120-124 34.7111 38.0 35.6 38.0 26.6 38.0 125-129 34.237 38.0 34.4 38.0 24.6 38.0 130-134 33.65855 38.0 33.4 38.0 22.2 38.0 135-139 32.9995 38.0 33.0 38.0 17.2 38.0 140-144 31.88205 38.0 31.2 38.0 13.0 38.0 145-149 30.4977 36.0 28.8 38.0 5.8 38.0 150-151 24.402 31.0 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 2.0 4 0.0 5 0.0 6 3.0 7 0.0 8 1.0 9 3.0 10 2.0 11 2.0 12 2.0 13 0.0 14 2.0 15 4.0 16 4.0 17 4.0 18 2.0 19 10.0 20 18.0 21 4.0 22 12.0 23 18.0 24 12.0 25 26.0 26 24.0 27 23.0 28 33.0 29 34.0 30 47.0 31 60.0 32 84.0 33 119.0 34 221.0 35 355.0 36 946.0 37 1913.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.0 20.575 13.350000000000001 27.075 2 26.700000000000003 25.474999999999998 31.35 16.475 3 21.43035758939735 27.056764191047762 31.43285821455364 20.080020005001252 4 24.60615153788447 35.0587646911728 22.030507626906726 18.30457614403601 5 24.306076519129782 37.13428357089272 21.45536384096024 17.104276069017253 6 19.459729864932466 38.169084542271136 23.23661830915458 19.13456728364182 7 18.434217108554275 20.135067533766886 39.94497248624312 21.48574287143572 8 19.93496748374187 24.7623811905953 28.73936968484242 26.563281640820406 9 22.655663915978995 23.730932733183295 30.15753938484621 23.455863965991497 10-14 23.830723825721574 28.38277224751138 26.221799809914458 21.564704116852585 15-19 23.091545772886445 28.119059529764883 27.85892946473237 20.930465232616307 20-24 23.156578289144573 27.72886443221611 28.46423211605803 20.65032516258129 25-29 23.336668334167083 28.109054527263634 27.878939469734863 20.675337668834416 30-34 22.531265632816407 27.79889944972486 28.7943971985993 20.87543771885943 35-39 23.11655827913957 27.843921960980488 27.953976988494244 21.085542771385693 40-44 23.036518259129565 27.85392696348174 28.47423711855928 20.635317658829415 45-49 22.79639819909955 27.85392696348174 28.67933966983492 20.670335167583794 50-54 23.366683341670836 28.499249624812407 27.723861930965484 20.410205102551277 55-59 23.536768384192097 27.55877938969485 27.85392696348174 21.050525262631314 60-64 22.96648324162081 27.593796898449224 28.109054527263634 21.33066533266633 65-69 23.23661830915458 27.958979489744873 27.66383191595798 21.14057028514257 70-74 23.89194597298649 27.80390195097549 27.548774387193596 20.755377688844423 75-79 24.07703851925963 27.573786893446723 27.723861930965484 20.625312656328166 80-84 24.012006003001503 27.138569284642323 27.6288144072036 21.220610305152576 85-89 23.921960980490244 27.85892946473237 27.75887943971986 20.460230115057527 90-94 24.372186093046526 27.66383191595798 27.40370185092546 20.560280140070038 95-99 24.147073536768385 27.498749374687343 27.943971985993 20.410205102551277 100-104 24.10705352676338 27.55377688844422 27.908954477238616 20.430215107553774 105-109 24.682341170585293 27.423711855927962 27.903951975987994 19.98999499749875 110-114 24.477238619309656 27.70385192596298 28.154077038519258 19.664832416208103 115-119 24.682341170585293 28.4392196098049 26.753376688344172 20.125062531265634 120-124 24.61230615307654 28.22911455727864 26.973486743371687 20.185092546273136 125-129 25.477738869434717 27.288644322161083 27.813906953476735 19.419709854927465 130-134 25.62281140570285 28.08904452226113 26.803401700850426 19.484742371185593 135-139 25.63781890945473 27.168584292146075 27.51375687843922 19.679839919959978 140-144 25.79418680274151 28.59072489869428 26.18940417229476 19.42568412626945 145-149 26.078039019509752 27.503751875937972 26.923461730865434 19.494747373686845 150-151 26.338169084542272 26.625812906453227 28.05152576288144 18.98449224612306 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 2.0 22 1.0 23 0.0 24 0.5 25 2.5 26 3.5 27 4.5 28 6.5 29 10.0 30 15.0 31 20.0 32 25.5 33 28.5 34 39.0 35 64.0 36 78.0 37 101.5 38 135.0 39 153.0 40 187.0 41 234.5 42 267.5 43 274.0 44 278.5 45 279.0 46 256.5 47 241.5 48 224.0 49 197.0 50 166.0 51 143.5 52 125.5 53 100.5 54 83.5 55 62.0 56 49.0 57 41.5 58 29.0 59 21.0 60 14.0 61 9.0 62 9.0 63 6.5 64 2.0 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.025 5 0.025 6 0.05 7 0.05 8 0.05 9 0.025 10-14 0.045 15-19 0.05 20-24 0.05 25-29 0.05 30-34 0.05 35-39 0.05 40-44 0.05 45-49 0.05 50-54 0.05 55-59 0.05 60-64 0.05 65-69 0.05 70-74 0.05 75-79 0.05 80-84 0.05 85-89 0.05 90-94 0.05 95-99 0.05 100-104 0.05 105-109 0.05 110-114 0.05 115-119 0.05 120-124 0.05 125-129 0.05 130-134 0.05 135-139 0.05 140-144 0.055 145-149 0.05 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.69398207426376 96.35000000000001 2 0.9218950064020487 1.7999999999999998 3 0.10243277848911651 0.3 4 0.12804097311139565 0.5 5 0.02560819462227913 0.125 6 0.02560819462227913 0.15 7 0.07682458386683738 0.525 8 0.0 0.0 9 0.0 0.0 >10 0.02560819462227913 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 10 0.25 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 7 0.17500000000000002 Illumina Single End PCR Primer 1 (96% over 32bp) AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 7 0.17500000000000002 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit TCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.3 0.0 0.0 0.0 0.0 98-99 1.4625 0.0 0.0 0.0 0.0 100-101 1.6625 0.0 0.0 0.0 0.0 102-103 1.95 0.0 0.0 0.0 0.0 104-105 2.2375 0.0 0.0 0.0 0.0 106-107 2.6875 0.0 0.0 0.0 0.0 108-109 3.3 0.0 0.0 0.0 0.0 110-111 3.7750000000000004 0.0 0.0 0.0 0.0 112-113 4.25 0.0 0.0 0.0 0.0 114-115 4.7125 0.0 0.0 0.0 0.0 116-117 5.2375 0.0 0.0 0.0 0.0 118-119 5.925 0.0 0.0 0.0 0.0 120-121 6.425000000000001 0.0 0.0 0.0 0.0 122-123 6.9125 0.0 0.0 0.0 0.0 124-125 7.5 0.0 0.0 0.0 0.0 126-127 8.05 0.0 0.0 0.0 0.0 128-129 8.537500000000001 0.0 0.0 0.0 0.0 130-131 9.087499999999999 0.0 0.0 0.0 0.0 132-133 9.875 0.0 0.0 0.0 0.0 134-135 10.6125 0.0 0.0 0.0 0.0 136-137 11.525 0.0 0.0 0.0 0.0 138-139 12.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTACTCC 10 0.006830828 145.0 145 >>END_MODULE Read 681193 spots for SRR7170855.sra Written 681193 spots for SRR7170855.sra Read 681193 spots for SRR7170855.sra Written 681193 spots for SRR7170855.sra Read 681193 spots for SRR7170855.sra Written 681193 spots for SRR7170855.sra Read 681193 spots for SRR7170855.sra Written 681193 spots for SRR7170855.sra Read 681193 spots for SRR7170855.sra Written 681193 spots for SRR7170855.sra Read 681193 spots for SRR7170855.sra Written 681193 spots for SRR7170855.sra Read 681193 spots for SRR7170855.sra Written 681193 spots for SRR7170855.sra Read 681193 spots for SRR7170855.sra Written 681193 spots for SRR7170855.sra Read 681193 spots for SRR7170855.sra Written 681193 spots for SRR7170855.sra Read 681193 spots for SRR7170855.sra Written 681193 spots for SRR7170855.sra Read 681193 spots for SRR7170855.sra Written 681193 spots for SRR7170855.sra Read 681193 spots for SRR7170855.sra Written 681193 spots for SRR7170855.sra Read 681193 spots for SRR7170855.sra Written 681193 spots for SRR7170855.sra Read 681193 spots for SRR7170855.sra Written 681193 spots for SRR7170855.sra Read 681193 spots for SRR7170855.sra Written 681193 spots for SRR7170855.sra Read 681193 spots for SRR7170855.sra Written 681193 spots for SRR7170855.sra Read 681193 spots for SRR7170855.sra Written 681193 spots for SRR7170855.sra Read 681193 spots for SRR7170855.sra Written 681193 spots for SRR7170855.sra Read 681193 spots for SRR7170855.sra Written 681193 spots for SRR7170855.sra Read 681194 spots for SRR7170855.sra Written 681194 spots for SRR7170855.sra SRR ids: ['SRR7170855.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_02tre9uw SRR7170855.sra spots: 13623861 blocks: [[1, 681193], [681194, 1362386], [1362387, 2043579], [2043580, 2724772], [2724773, 3405965], [3405966, 4087158], [4087159, 4768351], [4768352, 5449544], [5449545, 6130737], [6130738, 6811930], [6811931, 7493123], [7493124, 8174316], [8174317, 8855509], [8855510, 9536702], [9536703, 10217895], [10217896, 10899088], [10899089, 11580281], [11580282, 12261474], [12261475, 12942667], [12942668, 13623861]] SRR7170855 file size 4594979 SRR7170855 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170855 SRR7170855_1.fastq SRR7170855_2.fastq Input file: SRR7170855_1.fastq Paired file: SRR7170855_2.fastq trimmed: SRR7170855-trimmed-pair1.fastq, SRR7170855-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:45:06 2025 >> started Thu Feb 13 19:45:21 2025 >> done (14.900s) 13623861 read pairs processed; of these: 14929 ( 0.11%) short read pairs filtered out after trimming by size control 30098 ( 0.22%) empty read pairs filtered out after trimming by size control 13578834 (99.67%) read pairs available; of these: 9623699 (70.87%) trimmed read pairs available after processing 3955135 (29.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 10 0.00% 20 11 0.00% 21 8 0.00% 22 7 0.00% 23 12 0.00% 24 12 0.00% 25 6 0.00% 26 13 0.00% 27 17 0.00% 28 12 0.00% 29 16 0.00% 30 17 0.00% 31 66 0.00% 32 12 0.00% 33 18 0.00% 34 22 0.00% 35 19 0.00% 36 20 0.00% 37 41 0.00% 38 28 0.00% 39 41 0.00% 40 35 0.00% 41 54 0.00% 42 60 0.00% 43 54 0.00% 44 64 0.00% 45 77 0.00% 46 88 0.00% 47 94 0.00% 48 96 0.00% 49 122 0.00% 50 137 0.00% 51 180 0.00% 52 165 0.00% 53 190 0.00% 54 215 0.00% 55 263 0.00% 56 279 0.00% 57 294 0.00% 58 331 0.00% 59 430 0.00% 60 495 0.00% 61 564 0.00% 62 668 0.00% 63 724 0.01% 64 791 0.01% 65 833 0.01% 66 952 0.01% 67 1064 0.01% 68 1207 0.01% 69 1357 0.01% 70 1577 0.01% 71 1878 0.01% 72 2166 0.02% 73 2468 0.02% 74 2679 0.02% 75 2994 0.02% 76 4225 0.03% 77 4292 0.03% 78 3924 0.03% 79 4352 0.03% 80 4751 0.03% 81 5547 0.04% 82 6293 0.05% 83 7360 0.05% 84 8698 0.06% 85 8886 0.07% 86 9577 0.07% 87 9868 0.07% 88 10565 0.08% 89 11229 0.08% 90 12098 0.09% 91 13263 0.10% 92 14467 0.11% 93 16221 0.12% 94 17175 0.13% 95 18392 0.14% 96 19294 0.14% 97 19982 0.15% 98 21065 0.16% 99 21720 0.16% 100 23417 0.17% 101 24457 0.18% 102 26432 0.19% 103 27599 0.20% 104 29730 0.22% 105 30928 0.23% 106 32314 0.24% 107 32708 0.24% 108 33781 0.25% 109 34909 0.26% 110 35940 0.26% 111 37619 0.28% 112 39653 0.29% 113 41462 0.31% 114 43402 0.32% 115 45243 0.33% 116 46480 0.34% 117 47928 0.35% 118 49043 0.36% 119 50416 0.37% 120 51923 0.38% 121 53988 0.40% 122 55644 0.41% 123 58110 0.43% 124 60758 0.45% 125 62872 0.46% 126 65481 0.48% 127 67898 0.50% 128 70178 0.52% 129 73266 0.54% 130 75987 0.56% 131 77732 0.57% 132 82024 0.60% 133 86607 0.64% 134 91807 0.68% 135 98715 0.73% 136 104250 0.77% 137 111119 0.82% 138 118300 0.87% 139 125915 0.93% 140 135309 1.00% 141 147086 1.08% 142 163200 1.20% 143 184333 1.36% 144 214238 1.58% 145 255694 1.88% 146 318083 2.34% 147 422355 3.11% 148 621735 4.58% 149 1131427 8.33% 150 3404895 25.08% 151 3955135 29.13% 13578834 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=6 prefix-density=0.58 prefix-fanout=2.6 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=97.49 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=23 prefix-density=0.51 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=18 fanout-score=8.50 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=5.3 sequence=CAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGG SRR7170855 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:46:04 Started mapping on | Feb 13 19:46:04 Finished on | Feb 13 19:47:30 Mapping speed, Million of reads per hour | 568.42 Number of input reads | 13578834 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 12902400 Uniquely mapped reads % | 95.02% Average mapped length | 286.86 Number of splices: Total | 12053631 Number of splices: Annotated (sjdb) | 11784880 Number of splices: GT/AG | 11828731 Number of splices: GC/AG | 171468 Number of splices: AT/AC | 8376 Number of splices: Non-canonical | 45056 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 355838 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 16742 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.87% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 330627 330627 330627 N_multimapping 355838 355838 355838 N_noFeature 458453 12549561 585973 N_ambiguous 313815 1041 87940 UnstrandedReadsAssigned:12130132 PositiveStrandReadsAssigned:351798 NegativeStrandReadsAssigned:12228487 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=139 echo kmer=135 SRR7170855 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170855-trimmed-pair1.fastq SRR7170855-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,578,834 reads, 12,128,231 reads pseudoaligned [quant] estimated average fragment length: 219.378 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR7170855.ke.tsv 34699 SRR7170855.se.tsv 87100 total ==> SRR7170855.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.62 601 18.5859 Potri.005G024800.1.v4.1 1035 816.622 463 31.5538 Potri.004G059700.1.v4.1 961 742.641 14 1.04916 Potri.007G009000.2.v4.1 1416 1197.62 0 0 Potri.003G141000.2.v4.1 2943 2724.62 647.437 13.2246 Potri.016G087400.1.v4.1 270 93.2708 1086 648 Potri.015G069301.1.v4.1 564 349.078 0 0 Potri.010G195200.1.v4.1 1773 1554.62 255 9.12865 Potri.012G127500.1.v4.1 977 758.631 157 11.5176 ==> SRR7170855.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 487 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 341 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170855 completed mapping pipeline successfully