Starting /dee2/code/volunteer_pipeline.sh SRR7170856 current disk space = 3087594881024 free memory = 1497062776 SRR7170856 SRAfilesize 523950da46fbb6ce44e6340056d8ed7b SRR7170856.sra SRR7170856.sra file validated SRR7170856 is paired end SRR7170856 is conventional basespace SRR7170856 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170856_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81625 34.0 33.0 34.0 32.0 34.0 2 33.27525 34.0 33.0 34.0 32.0 34.0 3 33.25425 34.0 33.0 34.0 33.0 34.0 4 33.29825 34.0 33.0 34.0 33.0 34.0 5 33.2235 34.0 33.0 34.0 33.0 34.0 6 36.77275 38.0 37.0 38.0 35.0 38.0 7 37.2035 38.0 38.0 38.0 36.0 38.0 8 37.35325 38.0 38.0 38.0 37.0 38.0 9 37.3835 38.0 38.0 38.0 37.0 38.0 10-14 37.433749999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.348349999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.25725 38.0 38.0 38.0 37.0 38.0 25-29 37.201049999999995 38.0 38.0 38.0 36.8 38.0 30-34 37.16565 38.0 38.0 38.0 36.2 38.0 35-39 37.1658 38.0 38.0 38.0 36.2 38.0 40-44 37.107099999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.99415 38.0 38.0 38.0 35.8 38.0 50-54 36.89 38.0 38.0 38.0 35.4 38.0 55-59 36.879650000000005 38.0 38.0 38.0 35.4 38.0 60-64 36.759249999999994 38.0 38.0 38.0 35.2 38.0 65-69 36.713899999999995 38.0 38.0 38.0 35.0 38.0 70-74 36.68635 38.0 38.0 38.0 34.8 38.0 75-79 36.367200000000004 38.0 38.0 38.0 33.8 38.0 80-84 36.3101 38.0 37.8 38.0 33.8 38.0 85-89 36.28430000000001 38.0 37.8 38.0 34.0 38.0 90-94 36.156949999999995 38.0 37.4 38.0 33.6 38.0 95-99 36.0142 38.0 37.0 38.0 33.2 38.0 100-104 35.7464 38.0 37.0 38.0 32.0 38.0 105-109 35.550599999999996 38.0 36.8 38.0 30.6 38.0 110-114 35.40050000000001 38.0 36.4 38.0 29.6 38.0 115-119 35.08875 38.0 36.0 38.0 28.4 38.0 120-124 34.756299999999996 38.0 35.0 38.0 26.6 38.0 125-129 34.682500000000005 38.0 35.2 38.0 26.4 38.0 130-134 33.87945 38.0 33.8 38.0 22.6 38.0 135-139 33.856049999999996 38.0 33.6 38.0 22.8 38.0 140-144 33.2973 38.0 33.2 38.0 18.6 38.0 145-149 32.244350000000004 38.0 31.6 38.0 13.0 38.0 150-151 27.177625 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 1.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 2.0 13 3.0 14 1.0 15 4.0 16 2.0 17 4.0 18 3.0 19 9.0 20 8.0 21 5.0 22 13.0 23 11.0 24 15.0 25 17.0 26 16.0 27 25.0 28 37.0 29 38.0 30 61.0 31 65.0 32 98.0 33 140.0 34 219.0 35 362.0 36 860.0 37 1978.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.131097560975604 16.38719512195122 10.696138211382115 28.785569105691057 2 20.525 20.875 35.225 23.375 3 17.875 30.15 27.925 24.05 4 20.925 34.300000000000004 23.65 21.125 5 20.8 36.225 24.625 18.35 6 17.974999999999998 35.4 25.5 21.125 7 13.875000000000002 22.825 43.025000000000006 20.275000000000002 8 17.549999999999997 23.625 30.275000000000002 28.549999999999997 9 17.625 24.025 31.825 26.525 10-14 20.275000000000002 28.854999999999997 26.91 23.96 15-19 19.8 28.975 27.74 23.485 20-24 20.47 28.975 27.589999999999996 22.965 25-29 20.150000000000002 29.035 28.215 22.6 30-34 20.41 28.42 27.855 23.315 35-39 20.14 29.054999999999996 27.87 22.935 40-44 20.015 29.28 27.744999999999997 22.96 45-49 19.785 28.515 27.744999999999997 23.955000000000002 50-54 19.865 29.275000000000002 27.755000000000003 23.105 55-59 19.935 29.145 27.655 23.265 60-64 19.99 28.585 27.544999999999998 23.880000000000003 65-69 19.994999999999997 28.275 28.055000000000003 23.674999999999997 70-74 20.07 28.970000000000002 27.575 23.385 75-79 19.74 28.665000000000003 27.77 23.825 80-84 19.945 28.110000000000003 28.025 23.919999999999998 85-89 20.225 28.95 27.38 23.445 90-94 20.474999999999998 28.26 27.61 23.655 95-99 20.375 28.74 27.105 23.78 100-104 21.099999999999998 28.54 27.315 23.044999999999998 105-109 20.4 28.58 27.665 23.355 110-114 20.06 29.265 26.58 24.095 115-119 20.61 28.999999999999996 27.05 23.34 120-124 20.599999999999998 28.685 26.595000000000002 24.12 125-129 20.275000000000002 28.59 27.1 24.035 130-134 20.1 29.635 26.875 23.39 135-139 20.915 28.205000000000002 26.8 24.08 140-144 20.64 28.03 26.96 24.37 145-149 20.78 28.38 26.595000000000002 24.245 150-151 20.724999999999998 28.1 25.35 25.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 1.0 19 1.0 20 0.0 21 0.0 22 1.0 23 2.0 24 5.0 25 8.5 26 7.0 27 8.5 28 14.0 29 17.5 30 25.5 31 33.0 32 46.5 33 58.5 34 62.0 35 75.5 36 92.5 37 119.0 38 143.0 39 172.5 40 192.0 41 211.0 42 229.5 43 249.0 44 265.5 45 257.0 46 249.5 47 240.0 48 215.0 49 191.5 50 169.5 51 135.0 52 121.5 53 92.5 54 68.5 55 59.5 56 42.0 57 35.0 58 22.5 59 13.5 60 10.5 61 9.0 62 8.5 63 3.0 64 2.0 65 3.5 66 1.5 67 0.5 68 0.5 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57232704402516 98.95 2 0.3018867924528302 0.6 3 0.10062893081761005 0.3 4 0.0 0.0 5 0.0 0.0 6 0.025157232704402514 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 6 0.15 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1625 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 1.0750000000000002 0.0 0.0 0.0 0.0 94-95 1.2374999999999998 0.0 0.0 0.0 0.0 96-97 1.5375 0.0 0.0 0.0 0.0 98-99 1.95 0.0 0.0 0.0 0.0 100-101 2.2125 0.0 0.0 0.0 0.0 102-103 2.425 0.0 0.0 0.0 0.0 104-105 2.825 0.0 0.0 0.0 0.0 106-107 3.275 0.0 0.0 0.0 0.0 108-109 3.675 0.0 0.0 0.0 0.0 110-111 4.0875 0.0 0.0 0.0 0.0 112-113 4.512499999999999 0.0 0.0 0.0 0.0 114-115 4.9125 0.0 0.0 0.0 0.0 116-117 5.475 0.0 0.0 0.0 0.0 118-119 6.0375 0.0 0.0 0.0 0.0 120-121 6.762499999999999 0.0 0.0 0.0 0.0 122-123 7.2625 0.0 0.0 0.0 0.0 124-125 7.8375 0.0 0.0 0.0 0.0 126-127 8.375 0.0 0.0 0.0 0.0 128-129 9.0375 0.0 0.0 0.0 0.0 130-131 9.787500000000001 0.0 0.0 0.0 0.0 132-133 10.2875 0.0 0.0 0.0 0.0 134-135 11.100000000000001 0.0 0.0 0.0 0.0 136-137 11.662500000000001 0.0 0.0 0.0 0.0 138-139 12.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170856 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170856_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90925 33.0 33.0 34.0 32.0 34.0 2 32.97975 34.0 33.0 34.0 32.0 34.0 3 32.967 34.0 33.0 34.0 32.0 34.0 4 32.879 34.0 33.0 34.0 32.0 34.0 5 32.899 34.0 33.0 34.0 32.0 34.0 6 37.06625 38.0 38.0 38.0 37.0 38.0 7 37.01975 38.0 38.0 38.0 37.0 38.0 8 37.054 38.0 38.0 38.0 37.0 38.0 9 36.9695 38.0 38.0 38.0 37.0 38.0 10-14 36.9664 38.0 38.0 38.0 36.6 38.0 15-19 36.97165 38.0 38.0 38.0 36.8 38.0 20-24 36.86065 38.0 38.0 38.0 36.4 38.0 25-29 36.8475 38.0 38.0 38.0 36.4 38.0 30-34 36.8392 38.0 38.0 38.0 36.4 38.0 35-39 36.8343 38.0 38.0 38.0 36.4 38.0 40-44 36.855650000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.8091 38.0 38.0 38.0 36.0 38.0 50-54 36.82985 38.0 38.0 38.0 36.0 38.0 55-59 36.6792 38.0 38.0 38.0 35.8 38.0 60-64 36.581100000000006 38.0 38.0 38.0 35.6 38.0 65-69 36.571450000000006 38.0 38.0 38.0 35.2 38.0 70-74 36.52965 38.0 38.0 38.0 35.0 38.0 75-79 36.386250000000004 38.0 38.0 38.0 34.4 38.0 80-84 36.2264 38.0 38.0 38.0 34.0 38.0 85-89 36.175850000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.0245 38.0 38.0 38.0 33.6 38.0 95-99 35.9842 38.0 38.0 38.0 33.6 38.0 100-104 35.78425 38.0 37.8 38.0 32.8 38.0 105-109 35.65075 38.0 37.6 38.0 32.2 38.0 110-114 35.3028 38.0 36.8 38.0 30.0 38.0 115-119 35.096799999999995 38.0 36.8 38.0 28.8 38.0 120-124 34.68335 38.0 36.0 38.0 26.8 38.0 125-129 34.38095 38.0 35.4 38.0 24.6 38.0 130-134 34.0959 38.0 35.2 38.0 23.4 38.0 135-139 33.30055 38.0 33.6 38.0 16.2 38.0 140-144 32.815000000000005 38.0 33.0 38.0 13.8 38.0 145-149 31.827849999999994 38.0 32.4 38.0 8.2 38.0 150-151 26.6415 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 2.0 4 5.0 5 4.0 6 1.0 7 2.0 8 2.0 9 2.0 10 2.0 11 3.0 12 5.0 13 1.0 14 6.0 15 3.0 16 6.0 17 7.0 18 6.0 19 10.0 20 16.0 21 7.0 22 15.0 23 20.0 24 12.0 25 16.0 26 28.0 27 23.0 28 39.0 29 44.0 30 59.0 31 53.0 32 58.0 33 105.0 34 155.0 35 280.0 36 625.0 37 2362.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.075 19.2 13.65 21.075 2 26.400000000000002 23.5 31.1 19.0 3 21.2 27.05 33.35 18.4 4 23.95 35.525 21.75 18.775 5 23.775 37.225 21.45 17.549999999999997 6 19.70985492746373 35.74287143571786 24.61230615307654 19.93496748374187 7 19.70985492746373 20.01000500250125 40.54527263631816 19.734867433716857 8 20.555138784696176 25.206301575393848 28.307076769192296 25.93148287071768 9 21.11055527763882 25.062531265632813 29.289644822411205 24.537268634317158 10-14 23.446723361680842 28.16408204102051 27.04352176088044 21.34567283641821 15-19 22.976488244122063 27.773886943471737 28.919459729864933 20.33016508254127 20-24 23.001100770539377 28.05463824677274 28.389872911037727 20.554388071650155 25-29 23.26361088871097 28.49279423538831 28.1775420336269 20.06605284227382 30-34 22.251688766574933 27.800850637978485 29.046785088816613 20.900675506629973 35-39 22.71203402551914 28.521391043282463 28.056042031523642 20.710532899674757 40-44 23.047285464098074 28.35126344758569 28.03102326745059 20.57042782086565 45-49 22.651988991743806 28.43632724543407 28.33625218914186 20.575431573680262 50-54 23.367525644233176 27.47060295221416 28.701526144608458 20.46034525894421 55-59 23.312484363272453 27.190392794595947 28.2661996497373 21.230923192394297 60-64 22.50187640730548 28.61145859394546 28.471353515136354 20.41531148361271 65-69 23.34250688016012 27.78583937953465 28.231173380035024 20.640480360270203 70-74 23.108486789431545 27.747197758206564 28.29263410728583 20.851681345076063 75-79 23.153522818254604 28.01741393114491 27.862289831865496 20.966773418734988 80-84 23.457593194896173 27.805854390793094 27.78583937953465 20.950713034776083 85-89 23.70277708281211 27.400550412809604 27.88091068301226 21.015761821366024 90-94 22.883306645316253 27.75720576461169 28.7580064051241 20.60148118494796 95-99 23.766389750775698 27.62986688019217 28.270443399059154 20.333299969972977 100-104 23.865285492668768 28.213981884601914 27.678526747735578 20.242205874993743 105-109 24.08667801020919 27.519767791011912 28.555700130117106 19.837854068661795 110-114 24.276849164247825 28.25542988689821 27.52477229506556 19.94294865378841 115-119 24.724724724724727 27.982982982982985 27.71271271271271 19.57957957957958 120-124 25.203943746559233 27.651268705270006 27.67629247785396 19.468495070316802 125-129 24.86986986986987 27.772772772772775 27.7027027027027 19.654654654654653 130-134 25.264000800760723 28.016615784995746 27.115759971973375 19.603623442270155 135-139 25.165165165165167 28.138138138138135 27.802802802802802 18.893893893893893 140-144 25.92963315149392 28.607176817977077 26.600270256743908 18.862919773785094 145-149 26.15854268841958 27.935141627464716 26.719047142428188 19.18726854168752 150-151 27.264764764764767 27.127127127127125 26.351351351351347 19.256756756756758 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.5 23 1.5 24 1.0 25 3.0 26 4.0 27 7.5 28 10.5 29 13.5 30 19.0 31 22.0 32 31.0 33 39.5 34 52.0 35 81.5 36 102.0 37 111.5 38 126.5 39 158.5 40 200.5 41 224.5 42 250.5 43 268.5 44 278.0 45 277.5 46 259.0 47 244.0 48 216.0 49 191.5 50 174.5 51 134.5 52 99.5 53 82.5 54 74.0 55 60.0 56 44.0 57 37.5 58 28.5 59 19.5 60 11.0 61 8.0 62 7.0 63 5.0 64 3.5 65 2.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.05 8 0.025 9 0.05 10-14 0.05 15-19 0.05 20-24 0.06999999999999999 25-29 0.08 30-34 0.075 35-39 0.075 40-44 0.075 45-49 0.075 50-54 0.075 55-59 0.075 60-64 0.075 65-69 0.075 70-74 0.08 75-79 0.08 80-84 0.075 85-89 0.075 90-94 0.08 95-99 0.09 100-104 0.08499999999999999 105-109 0.09 110-114 0.09 115-119 0.1 120-124 0.095 125-129 0.1 130-134 0.095 135-139 0.1 140-144 0.095 145-149 0.09 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21638018200201 98.125 2 0.6319514661274014 1.25 3 0.10111223458038424 0.3 4 0.0 0.0 5 0.0 0.0 6 0.02527805864509606 0.15 7 0.02527805864509606 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 7 0.17500000000000002 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCT 6 0.15 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1625 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.5375 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.8375 0.0 0.0 0.0 0.0 92-93 1.0499999999999998 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.475 0.0 0.0 0.0 0.0 98-99 1.85 0.0 0.0 0.0 0.0 100-101 2.1125 0.0 0.0 0.0 0.0 102-103 2.325 0.0 0.0 0.0 0.0 104-105 2.6875 0.0 0.0 0.0 0.0 106-107 3.15 0.0 0.0 0.0 0.0 108-109 3.5250000000000004 0.0 0.0 0.0 0.0 110-111 3.95 0.0 0.0 0.0 0.0 112-113 4.4 0.0 0.0 0.0 0.0 114-115 4.8 0.0 0.0 0.0 0.0 116-117 5.4 0.0 0.0 0.0 0.0 118-119 6.0 0.0 0.0 0.0 0.0 120-121 6.7125 0.0 0.0 0.0 0.0 122-123 7.199999999999999 0.0 0.0 0.0 0.0 124-125 7.8375 0.0 0.0 0.0 0.0 126-127 8.375 0.0 0.0 0.0 0.0 128-129 9.024999999999999 0.0 0.0 0.0 0.0 130-131 9.75 0.0 0.0 0.0 0.0 132-133 10.3 0.0 0.0 0.0 0.0 134-135 11.125 0.0 0.0 0.0 0.0 136-137 11.712499999999999 0.0 0.0 0.0 0.0 138-139 12.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 579612 spots for SRR7170856.sra Written 579612 spots for SRR7170856.sra Read 579612 spots for SRR7170856.sra Written 579612 spots for SRR7170856.sra Read 579612 spots for SRR7170856.sra Written 579612 spots for SRR7170856.sra Read 579612 spots for SRR7170856.sra Written 579612 spots for SRR7170856.sra Read 579612 spots for SRR7170856.sra Written 579612 spots for SRR7170856.sra Read 579612 spots for SRR7170856.sra Written 579612 spots for SRR7170856.sra Read 579612 spots for SRR7170856.sra Written 579612 spots for SRR7170856.sra Read 579612 spots for SRR7170856.sra Written 579612 spots for SRR7170856.sra Read 579612 spots for SRR7170856.sra Written 579612 spots for SRR7170856.sra Read 579612 spots for SRR7170856.sra Written 579612 spots for SRR7170856.sra Read 579612 spots for SRR7170856.sra Written 579612 spots for SRR7170856.sra Read 579612 spots for SRR7170856.sra Written 579612 spots for SRR7170856.sra Read 579612 spots for SRR7170856.sra Written 579612 spots for SRR7170856.sra Read 579612 spots for SRR7170856.sra Written 579612 spots for SRR7170856.sra Read 579612 spots for SRR7170856.sra Written 579612 spots for SRR7170856.sra Read 579612 spots for SRR7170856.sra Written 579612 spots for SRR7170856.sra Read 579612 spots for SRR7170856.sra Written 579612 spots for SRR7170856.sra Read 579615 spots for SRR7170856.sra Written 579615 spots for SRR7170856.sra Read 579612 spots for SRR7170856.sra Written 579612 spots for SRR7170856.sra Read 579612 spots for SRR7170856.sra Written 579612 spots for SRR7170856.sra SRR ids: ['SRR7170856.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ycmd5gjm SRR7170856.sra spots: 11592243 blocks: [[1, 579612], [579613, 1159224], [1159225, 1738836], [1738837, 2318448], [2318449, 2898060], [2898061, 3477672], [3477673, 4057284], [4057285, 4636896], [4636897, 5216508], [5216509, 5796120], [5796121, 6375732], [6375733, 6955344], [6955345, 7534956], [7534957, 8114568], [8114569, 8694180], [8694181, 9273792], [9273793, 9853404], [9853405, 10433016], [10433017, 11012628], [11012629, 11592243]] SRR7170856 file size 3906530 SRR7170856 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170856 SRR7170856_1.fastq SRR7170856_2.fastq Input file: SRR7170856_1.fastq Paired file: SRR7170856_2.fastq trimmed: SRR7170856-trimmed-pair1.fastq, SRR7170856-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:02:35 2025 >> started Thu Feb 13 20:02:48 2025 >> done (13.310s) 11592243 read pairs processed; of these: 25358 ( 0.22%) short read pairs filtered out after trimming by size control 50874 ( 0.44%) empty read pairs filtered out after trimming by size control 11516011 (99.34%) read pairs available; of these: 7762066 (67.40%) trimmed read pairs available after processing 3753945 (32.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 15 0.00% 20 17 0.00% 21 11 0.00% 22 14 0.00% 23 18 0.00% 24 20 0.00% 25 23 0.00% 26 11 0.00% 27 20 0.00% 28 30 0.00% 29 22 0.00% 30 18 0.00% 31 29 0.00% 32 22 0.00% 33 26 0.00% 34 28 0.00% 35 22 0.00% 36 30 0.00% 37 42 0.00% 38 33 0.00% 39 47 0.00% 40 54 0.00% 41 62 0.00% 42 71 0.00% 43 57 0.00% 44 67 0.00% 45 80 0.00% 46 86 0.00% 47 98 0.00% 48 135 0.00% 49 164 0.00% 50 171 0.00% 51 210 0.00% 52 228 0.00% 53 252 0.00% 54 298 0.00% 55 284 0.00% 56 319 0.00% 57 368 0.00% 58 405 0.00% 59 464 0.00% 60 564 0.00% 61 682 0.01% 62 778 0.01% 63 902 0.01% 64 946 0.01% 65 993 0.01% 66 1148 0.01% 67 1199 0.01% 68 1353 0.01% 69 1533 0.01% 70 1867 0.02% 71 2307 0.02% 72 2731 0.02% 73 3014 0.03% 74 3263 0.03% 75 3834 0.03% 76 5658 0.05% 77 5965 0.05% 78 4744 0.04% 79 4902 0.04% 80 5510 0.05% 81 6357 0.06% 82 7380 0.06% 83 8269 0.07% 84 10294 0.09% 85 10738 0.09% 86 10395 0.09% 87 10771 0.09% 88 11070 0.10% 89 12011 0.10% 90 12945 0.11% 91 14156 0.12% 92 15929 0.14% 93 17282 0.15% 94 18138 0.16% 95 19093 0.17% 96 19296 0.17% 97 19272 0.17% 98 19746 0.17% 99 20044 0.17% 100 21454 0.19% 101 23327 0.20% 102 25441 0.22% 103 26985 0.23% 104 28546 0.25% 105 29993 0.26% 106 30109 0.26% 107 29972 0.26% 108 29977 0.26% 109 30150 0.26% 110 30697 0.27% 111 32813 0.28% 112 34780 0.30% 113 37429 0.33% 114 39155 0.34% 115 40662 0.35% 116 41257 0.36% 117 41997 0.36% 118 40885 0.36% 119 41261 0.36% 120 42189 0.37% 121 43993 0.38% 122 45537 0.40% 123 48707 0.42% 124 51682 0.45% 125 53851 0.47% 126 55744 0.48% 127 56342 0.49% 128 56746 0.49% 129 57503 0.50% 130 58804 0.51% 131 60593 0.53% 132 64004 0.56% 133 68223 0.59% 134 73426 0.64% 135 78091 0.68% 136 81915 0.71% 137 86585 0.75% 138 91186 0.79% 139 96806 0.84% 140 103296 0.90% 141 112635 0.98% 142 125246 1.09% 143 143875 1.25% 144 166297 1.44% 145 199280 1.73% 146 249438 2.17% 147 326858 2.84% 148 472264 4.10% 149 843648 7.33% 150 2768958 24.04% 151 3753945 32.60% 11516011 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=21 prefix-density=0.45 prefix-fanout=2.1 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=29.71 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.3 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=28 prefix-density=0.63 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=52.96 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.4 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR7170856 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:03:31 Started mapping on | Feb 13 20:03:31 Finished on | Feb 13 20:04:43 Mapping speed, Million of reads per hour | 575.80 Number of input reads | 11516011 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 10874122 Uniquely mapped reads % | 94.43% Average mapped length | 286.10 Number of splices: Total | 10145638 Number of splices: Annotated (sjdb) | 9877855 Number of splices: GT/AG | 9945915 Number of splices: GC/AG | 151457 Number of splices: AT/AC | 6466 Number of splices: Non-canonical | 41800 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305682 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 41366 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.47% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 356098 356098 356098 N_multimapping 305682 305682 305682 N_noFeature 480171 10644883 600556 N_ambiguous 196341 1182 86633 UnstrandedReadsAssigned:10197610 PositiveStrandReadsAssigned:228057 NegativeStrandReadsAssigned:10186933 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=142 echo kmer=137 SRR7170856 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170856-trimmed-pair1.fastq SRR7170856-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,516,011 reads, 10,176,882 reads pseudoaligned [quant] estimated average fragment length: 224.247 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR7170856.ke.tsv 34699 SRR7170856.se.tsv 87100 total ==> SRR7170856.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.75 676 34.6289 Potri.005G024800.1.v4.1 1035 811.753 139 15.743 Potri.004G059700.1.v4.1 961 737.796 8 0.996897 Potri.007G009000.2.v4.1 1416 1192.75 0 0 Potri.003G141000.2.v4.1 2943 2719.75 471.342 15.9332 Potri.016G087400.1.v4.1 270 96.165 702 671.145 Potri.015G069301.1.v4.1 564 348.1 0 0 Potri.010G195200.1.v4.1 1773 1549.75 96 5.69515 Potri.012G127500.1.v4.1 977 753.775 130 15.8562 ==> SRR7170856.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 271 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 226 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 64 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 2 SRR7170856 completed mapping pipeline successfully