Starting /dee2/code/volunteer_pipeline.sh SRR7170857 current disk space = 3087402659840 free memory = 1412995132 SRR7170857 SRAfilesize 9f4759ea1529711f758634c2ccbb97af SRR7170857.sra SRR7170857.sra file validated SRR7170857 is paired end SRR7170857 is conventional basespace SRR7170857 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170857_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8565 34.0 33.0 34.0 32.0 34.0 2 33.29075 34.0 33.0 34.0 33.0 34.0 3 33.243 34.0 33.0 34.0 33.0 34.0 4 33.36225 34.0 33.0 34.0 33.0 34.0 5 33.32825 34.0 33.0 34.0 33.0 34.0 6 36.7735 38.0 37.0 38.0 34.0 38.0 7 37.228 38.0 38.0 38.0 36.0 38.0 8 37.31725 38.0 38.0 38.0 37.0 38.0 9 37.4025 38.0 38.0 38.0 37.0 38.0 10-14 37.4423 38.0 38.0 38.0 37.0 38.0 15-19 37.30155 38.0 38.0 38.0 37.0 38.0 20-24 37.280649999999994 38.0 38.0 38.0 36.6 38.0 25-29 37.27685 38.0 38.0 38.0 36.8 38.0 30-34 37.16575 38.0 38.0 38.0 36.0 38.0 35-39 37.06955 38.0 38.0 38.0 36.0 38.0 40-44 36.9838 38.0 38.0 38.0 36.0 38.0 45-49 36.97265 38.0 38.0 38.0 35.4 38.0 50-54 36.64425 38.0 38.0 38.0 34.4 38.0 55-59 36.6061 38.0 38.0 38.0 34.4 38.0 60-64 36.59995 38.0 38.0 38.0 34.0 38.0 65-69 36.4729 38.0 37.8 38.0 34.0 38.0 70-74 36.486850000000004 38.0 37.6 38.0 34.0 38.0 75-79 36.192049999999995 38.0 37.0 38.0 33.6 38.0 80-84 36.1475 38.0 37.0 38.0 33.4 38.0 85-89 35.854499999999994 38.0 37.0 38.0 32.0 38.0 90-94 35.6836 38.0 36.8 38.0 31.0 38.0 95-99 35.50255 38.0 36.4 38.0 30.2 38.0 100-104 34.793150000000004 38.0 35.2 38.0 27.2 38.0 105-109 34.74265 38.0 35.0 38.0 27.0 38.0 110-114 34.43585 38.0 34.4 38.0 25.4 38.0 115-119 34.0836 38.0 33.6 38.0 23.4 38.0 120-124 33.24425 38.0 33.0 38.0 19.0 38.0 125-129 32.34335 37.8 31.0 38.0 14.0 38.0 130-134 31.65385 37.0 29.4 38.0 13.2 38.0 135-139 30.665099999999995 36.0 28.0 38.0 12.6 38.0 140-144 30.4677 36.0 28.2 38.0 9.8 38.0 145-149 28.662699999999994 35.4 24.4 38.0 2.0 38.0 150-151 21.984375 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 1.0 11 1.0 12 0.0 13 3.0 14 2.0 15 2.0 16 7.0 17 2.0 18 10.0 19 17.0 20 7.0 21 18.0 22 10.0 23 19.0 24 24.0 25 33.0 26 42.0 27 32.0 28 36.0 29 68.0 30 70.0 31 107.0 32 133.0 33 211.0 34 312.0 35 573.0 36 1129.0 37 1129.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.41507996953541 14.927646610814927 10.992637725310992 38.66463569433867 2 19.6 20.7 37.7 22.0 3 17.4881160870653 26.945208906680012 28.646484863647736 26.920190142606952 4 22.15 33.2 23.225 21.425 5 21.8 36.8 23.825 17.575 6 15.4 38.9 25.55 20.150000000000002 7 13.900000000000002 24.125 44.275 17.7 8 18.2 23.35 30.4 28.050000000000004 9 17.224999999999998 24.0 33.375 25.4 10-14 19.27 29.87 26.995 23.865 15-19 19.84 29.065 27.650000000000002 23.445 20-24 19.52 29.315 28.144999999999996 23.02 25-29 19.59 28.994999999999997 27.875 23.54 30-34 20.095 28.38 28.46 23.064999999999998 35-39 20.055 29.220000000000002 27.325 23.400000000000002 40-44 19.744999999999997 29.404999999999998 27.810000000000002 23.04 45-49 19.900000000000002 29.189999999999998 27.500000000000004 23.41 50-54 20.085 29.020000000000003 27.375 23.52 55-59 20.335 28.58 28.1 22.985 60-64 20.005 28.565 27.750000000000004 23.68 65-69 20.225 28.83 27.73 23.215 70-74 20.055 28.810000000000002 27.905 23.23 75-79 19.895 29.24 27.775 23.09 80-84 20.175 28.84 27.875 23.11 85-89 20.39 28.175 27.91 23.525 90-94 20.265 28.01 27.779999999999998 23.945 95-99 21.224999999999998 28.87 26.795 23.11 100-104 20.335 29.18 27.025 23.46 105-109 20.855 28.355000000000004 27.625 23.165 110-114 20.74 28.13 27.405 23.724999999999998 115-119 20.669999999999998 28.835 27.04 23.455000000000002 120-124 20.77 28.22 27.339999999999996 23.669999999999998 125-129 21.255 28.845 26.25 23.65 130-134 21.185000000000002 28.83 26.895000000000003 23.09 135-139 21.4 28.46 26.415 23.724999999999998 140-144 21.39 28.515 26.85 23.244999999999997 145-149 20.945 28.565 26.525 23.965 150-151 20.549999999999997 28.487499999999997 26.987499999999997 23.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 1.5 22 2.5 23 2.5 24 3.0 25 5.5 26 8.5 27 10.0 28 15.5 29 17.5 30 24.0 31 34.5 32 44.0 33 54.5 34 64.5 35 89.0 36 116.5 37 134.5 38 152.5 39 167.5 40 191.5 41 225.0 42 229.5 43 231.5 44 251.5 45 252.0 46 235.5 47 233.0 48 235.5 49 200.5 50 159.5 51 129.5 52 108.0 53 87.5 54 64.5 55 63.5 56 57.5 57 33.0 58 18.0 59 15.0 60 9.5 61 5.5 62 3.0 63 1.5 64 1.0 65 2.5 66 2.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 0.0 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4452849218356 98.6 2 0.45385779122541603 0.8999999999999999 3 0.05042864346949068 0.15 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02521432173474534 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 10 0.25 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2125 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.6499999999999999 0.0 0.0 0.0 0.0 86-87 0.8125 0.0 0.0 0.0 0.0 88-89 1.0375 0.0 0.0 0.0 0.0 90-91 1.4 0.0 0.0 0.0 0.0 92-93 1.6375 0.0 0.0 0.0 0.0 94-95 1.9 0.0 0.0 0.0 0.0 96-97 2.275 0.0 0.0 0.0 0.0 98-99 2.5875 0.0 0.0 0.0 0.0 100-101 2.9125 0.0 0.0 0.0 0.0 102-103 3.3875 0.0 0.0 0.0 0.0 104-105 3.95 0.0 0.0 0.0 0.0 106-107 4.4 0.0 0.0 0.0 0.0 108-109 4.8 0.0 0.0 0.0 0.0 110-111 5.2875 0.0 0.0 0.0 0.0 112-113 5.574999999999999 0.0 0.0 0.0 0.0 114-115 6.15 0.0 0.0 0.0 0.0 116-117 6.675 0.0 0.0 0.0 0.0 118-119 7.3125 0.0 0.0 0.0 0.0 120-121 8.15 0.0 0.0 0.0 0.0 122-123 8.75 0.0 0.0 0.0 0.0 124-125 9.425 0.0 0.0 0.0 0.0 126-127 10.1625 0.0 0.0 0.0 0.0 128-129 10.7625 0.0 0.0 0.0 0.0 130-131 11.5375 0.0 0.0 0.0 0.0 132-133 11.925 0.0 0.0 0.0 0.0 134-135 12.6 0.0 0.0 0.0 0.0 136-137 13.375 0.0 0.0 0.0 0.0 138-139 14.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAGGT 10 0.006832588 144.9875 3 >>END_MODULE SRR7170857 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170857_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9325 33.0 33.0 34.0 32.0 34.0 2 33.0305 33.0 33.0 34.0 32.0 34.0 3 33.1035 34.0 33.0 34.0 33.0 34.0 4 33.051 34.0 33.0 34.0 33.0 34.0 5 33.03975 34.0 33.0 34.0 33.0 34.0 6 37.2015 38.0 38.0 38.0 37.0 38.0 7 37.31225 38.0 38.0 38.0 37.0 38.0 8 37.28425 38.0 38.0 38.0 37.0 38.0 9 37.26 38.0 38.0 38.0 37.0 38.0 10-14 37.283249999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.26605 38.0 38.0 38.0 37.0 38.0 20-24 37.21685 38.0 38.0 38.0 37.0 38.0 25-29 37.15175000000001 38.0 38.0 38.0 36.8 38.0 30-34 37.141450000000006 38.0 38.0 38.0 36.8 38.0 35-39 37.0638 38.0 38.0 38.0 36.6 38.0 40-44 37.11045 38.0 38.0 38.0 36.6 38.0 45-49 37.0487 38.0 38.0 38.0 36.6 38.0 50-54 37.008750000000006 38.0 38.0 38.0 36.0 38.0 55-59 36.9166 38.0 38.0 38.0 36.0 38.0 60-64 36.904399999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.7652 38.0 38.0 38.0 35.4 38.0 70-74 36.73805 38.0 38.0 38.0 35.4 38.0 75-79 36.65465 38.0 38.0 38.0 35.0 38.0 80-84 36.35445 38.0 38.0 38.0 34.2 38.0 85-89 36.315250000000006 38.0 38.0 38.0 34.0 38.0 90-94 36.09665 38.0 38.0 38.0 33.4 38.0 95-99 36.083999999999996 38.0 37.8 38.0 33.4 38.0 100-104 35.9341 38.0 37.0 38.0 33.0 38.0 105-109 35.81455 38.0 37.0 38.0 32.2 38.0 110-114 35.564550000000004 38.0 37.0 38.0 31.0 38.0 115-119 35.203500000000005 38.0 36.2 38.0 29.2 38.0 120-124 34.724900000000005 38.0 35.6 38.0 27.0 38.0 125-129 34.17975 38.0 34.2 38.0 23.8 38.0 130-134 33.612049999999996 38.0 33.2 38.0 21.8 38.0 135-139 32.96805 38.0 33.0 38.0 17.6 38.0 140-144 31.944200000000002 38.0 31.8 38.0 13.0 38.0 145-149 30.5545 36.4 29.4 38.0 5.8 38.0 150-151 24.55425 31.0 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 0.0 5 0.0 6 0.0 7 2.0 8 0.0 9 3.0 10 2.0 11 2.0 12 1.0 13 0.0 14 6.0 15 3.0 16 4.0 17 4.0 18 7.0 19 4.0 20 13.0 21 7.0 22 16.0 23 14.0 24 23.0 25 22.0 26 17.0 27 29.0 28 38.0 29 37.0 30 47.0 31 72.0 32 84.0 33 137.0 34 186.0 35 354.0 36 900.0 37 1959.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.075 18.025 15.0 29.9 2 26.474999999999998 23.65 33.650000000000006 16.225 3 20.474999999999998 26.85 32.525 20.150000000000002 4 22.475 35.9 22.475 19.15 5 24.375 37.7 21.975 15.950000000000001 6 18.00450112528132 39.28482120530133 24.131032758189548 18.579644911227806 7 18.079519879969993 18.704676169042262 43.31082770692673 19.904976244061015 8 20.505126281570394 23.605901475368842 28.40710177544386 27.481870467616904 9 22.475 24.275 29.25 24.0 10-14 23.119623924784957 28.380676135227045 26.6753350670134 21.824364872974595 15-19 22.850712678169543 28.122030507626906 28.307076769192296 20.72018004501125 20-24 23.39584896224056 28.327081770442607 27.776944236059016 20.500125031257816 25-29 22.865716429107277 28.252063015753937 28.37209302325581 20.510127531882972 30-34 22.705676419104776 28.127031757939484 28.012003000750184 21.155288822205552 35-39 22.515628907226805 28.73718429607402 28.012003000750184 20.735183795948984 40-44 22.48062015503876 28.02200550137534 28.772193048262068 20.72518129532383 45-49 22.80570142535634 28.177044261065266 28.732183045761438 20.285071267816953 50-54 22.660665166291576 28.192048012003003 28.177044261065266 20.97024256064016 55-59 23.440860215053764 27.216804201050266 28.722180545136283 20.62015503875969 60-64 23.145786446611652 27.9869967491873 27.97199299824956 20.89522380595149 65-69 22.815703925981495 27.47186796699175 28.95723930982746 20.7551887971993 70-74 22.845711427856966 28.052013003250813 28.422105526381596 20.68017004251063 75-79 23.380845211302827 27.851962990747687 27.79194798699675 20.975243810952737 80-84 22.85571392848212 28.327081770442607 27.79194798699675 21.02525631407852 85-89 23.43085771442861 28.162040510127532 28.047011752938232 20.360090022505624 90-94 23.455863965991497 28.272068017004255 27.68192048012003 20.59014753688422 95-99 23.617085125537663 28.553566069820945 27.493247974392315 20.336100830249073 100-104 23.760940235058765 27.95198799699925 27.741935483870968 20.545136284071017 105-109 23.82595648912228 27.731932983245812 28.077019254813703 20.365091272818205 110-114 24.547364209262778 28.593578073422027 27.01810543162949 19.840952285685706 115-119 24.896224056014006 27.671917979494875 27.371842960740185 20.060015003750937 120-124 24.571142785696424 28.312078019504877 27.406851712928233 19.70992748187047 125-129 24.726181545386346 28.13703425856464 27.541885471367845 19.59489872468117 130-134 24.967490247074124 27.70831249374812 27.368210463138944 19.95598679603881 135-139 25.831457864466117 27.4368592148037 27.22180545136284 19.509877469367343 140-144 25.520208083233292 27.62605042016807 27.380952380952383 19.472789115646258 145-149 25.621405351337835 28.122030507626906 27.136784196049014 19.119779944986245 150-151 26.569142285571395 26.71917979494874 27.46936734183546 19.24231057764441 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 1.5 22 1.5 23 3.5 24 5.0 25 6.0 26 6.5 27 5.5 28 8.5 29 14.0 30 15.5 31 21.0 32 31.5 33 38.0 34 49.5 35 63.5 36 92.0 37 124.0 38 149.5 39 172.0 40 194.5 41 215.0 42 247.5 43 271.0 44 279.5 45 286.0 46 272.5 47 252.0 48 215.5 49 194.0 50 174.0 51 128.0 52 98.0 53 88.0 54 73.5 55 54.5 56 44.0 57 33.5 58 19.0 59 14.0 60 9.5 61 4.5 62 5.0 63 3.5 64 3.0 65 3.5 66 1.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.025 9 0.0 10-14 0.02 15-19 0.025 20-24 0.025 25-29 0.025 30-34 0.025 35-39 0.025 40-44 0.025 45-49 0.025 50-54 0.025 55-59 0.025 60-64 0.025 65-69 0.025 70-74 0.025 75-79 0.025 80-84 0.025 85-89 0.025 90-94 0.025 95-99 0.03 100-104 0.025 105-109 0.025 110-114 0.03 115-119 0.025 120-124 0.025 125-129 0.025 130-134 0.03 135-139 0.025 140-144 0.04 145-149 0.025 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31506849315068 97.875 2 0.4058853373921867 0.8 3 0.12683916793505834 0.375 4 0.0 0.0 5 0.076103500761035 0.375 6 0.050735667174023336 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025367833587011668 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 11 0.27499999999999997 Illumina Single End PCR Primer 1 (96% over 32bp) TCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 6 0.15 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2125 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.48750000000000004 0.0 0.0 0.0 0.0 84-85 0.675 0.0 0.0 0.0 0.0 86-87 0.8125 0.0 0.0 0.0 0.0 88-89 1.0125000000000002 0.0 0.0 0.0 0.0 90-91 1.375 0.0 0.0 0.0 0.0 92-93 1.6125 0.0 0.0 0.0 0.0 94-95 1.875 0.0 0.0 0.0 0.0 96-97 2.2125 0.0 0.0 0.0 0.0 98-99 2.5125 0.0 0.0 0.0 0.0 100-101 2.875 0.0 0.0 0.0 0.0 102-103 3.3625 0.0 0.0 0.0 0.0 104-105 3.95 0.0 0.0 0.0 0.0 106-107 4.4 0.0 0.0 0.0 0.0 108-109 4.775 0.0 0.0 0.0 0.0 110-111 5.2875 0.0 0.0 0.0 0.0 112-113 5.6 0.0 0.0 0.0 0.0 114-115 6.1375 0.0 0.0 0.0 0.0 116-117 6.65 0.0 0.0 0.0 0.0 118-119 7.2875 0.0 0.0 0.0 0.0 120-121 8.0375 0.0 0.0 0.0 0.0 122-123 8.625 0.0 0.0 0.0 0.0 124-125 9.3 0.0 0.0 0.0 0.0 126-127 10.05 0.0 0.0 0.0 0.0 128-129 10.675 0.0 0.0 0.0 0.0 130-131 11.3875 0.0 0.0 0.0 0.0 132-133 11.775 0.0 0.0 0.0 0.0 134-135 12.45 0.0 0.0 0.0 0.0 136-137 13.225000000000001 0.0 0.0 0.0 0.0 138-139 14.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 662132 spots for SRR7170857.sra Written 662132 spots for SRR7170857.sra Read 662132 spots for SRR7170857.sra Written 662132 spots for SRR7170857.sra Read 662132 spots for SRR7170857.sra Written 662132 spots for SRR7170857.sra Read 662132 spots for SRR7170857.sra Written 662132 spots for SRR7170857.sra Read 662132 spots for SRR7170857.sra Written 662132 spots for SRR7170857.sra Read 662132 spots for SRR7170857.sra Written 662132 spots for SRR7170857.sra Read 662132 spots for SRR7170857.sra Written 662132 spots for SRR7170857.sra Read 662132 spots for SRR7170857.sra Written 662132 spots for SRR7170857.sra Read 662132 spots for SRR7170857.sra Written 662132 spots for SRR7170857.sra Read 662132 spots for SRR7170857.sra Written 662132 spots for SRR7170857.sra Read 662132 spots for SRR7170857.sra Written 662132 spots for SRR7170857.sra Read 662132 spots for SRR7170857.sra Written 662132 spots for SRR7170857.sra Read 662132 spots for SRR7170857.sra Written 662132 spots for SRR7170857.sra Read 662132 spots for SRR7170857.sra Written 662132 spots for SRR7170857.sra Read 662132 spots for SRR7170857.sra Written 662132 spots for SRR7170857.sra Read 662132 spots for SRR7170857.sra Written 662132 spots for SRR7170857.sra Read 662132 spots for SRR7170857.sra Written 662132 spots for SRR7170857.sra Read 662132 spots for SRR7170857.sra Written 662132 spots for SRR7170857.sra Read 662132 spots for SRR7170857.sra Written 662132 spots for SRR7170857.sra Read 662132 spots for SRR7170857.sra Written 662132 spots for SRR7170857.sra SRR ids: ['SRR7170857.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xrpqq_xu SRR7170857.sra spots: 13242640 blocks: [[1, 662132], [662133, 1324264], [1324265, 1986396], [1986397, 2648528], [2648529, 3310660], [3310661, 3972792], [3972793, 4634924], [4634925, 5297056], [5297057, 5959188], [5959189, 6621320], [6621321, 7283452], [7283453, 7945584], [7945585, 8607716], [8607717, 9269848], [9269849, 9931980], [9931981, 10594112], [10594113, 11256244], [11256245, 11918376], [11918377, 12580508], [12580509, 13242640]] SRR7170857 file size 4465795 SRR7170857 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170857 SRR7170857_1.fastq SRR7170857_2.fastq Input file: SRR7170857_1.fastq Paired file: SRR7170857_2.fastq trimmed: SRR7170857-trimmed-pair1.fastq, SRR7170857-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:40:01 2025 >> started Thu Feb 13 19:40:18 2025 >> done (16.944s) 13242640 read pairs processed; of these: 13041 ( 0.10%) short read pairs filtered out after trimming by size control 48278 ( 0.36%) empty read pairs filtered out after trimming by size control 13181321 (99.54%) read pairs available; of these: 9424862 (71.50%) trimmed read pairs available after processing 3756459 (28.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 10 0.00% 20 17 0.00% 21 9 0.00% 22 18 0.00% 23 9 0.00% 24 16 0.00% 25 11 0.00% 26 13 0.00% 27 22 0.00% 28 24 0.00% 29 16 0.00% 30 28 0.00% 31 25 0.00% 32 29 0.00% 33 28 0.00% 34 30 0.00% 35 43 0.00% 36 47 0.00% 37 62 0.00% 38 56 0.00% 39 85 0.00% 40 111 0.00% 41 110 0.00% 42 117 0.00% 43 124 0.00% 44 119 0.00% 45 151 0.00% 46 190 0.00% 47 175 0.00% 48 254 0.00% 49 273 0.00% 50 375 0.00% 51 386 0.00% 52 429 0.00% 53 471 0.00% 54 459 0.00% 55 531 0.00% 56 510 0.00% 57 629 0.00% 58 804 0.01% 59 865 0.01% 60 1127 0.01% 61 1136 0.01% 62 1247 0.01% 63 1362 0.01% 64 1511 0.01% 65 1600 0.01% 66 1752 0.01% 67 1850 0.01% 68 2194 0.02% 69 2466 0.02% 70 2918 0.02% 71 3101 0.02% 72 3807 0.03% 73 4277 0.03% 74 4704 0.04% 75 5322 0.04% 76 8745 0.07% 77 8156 0.06% 78 6456 0.05% 79 6867 0.05% 80 7455 0.06% 81 8515 0.06% 82 9474 0.07% 83 10475 0.08% 84 12116 0.09% 85 12382 0.09% 86 13090 0.10% 87 13600 0.10% 88 14310 0.11% 89 15162 0.12% 90 16138 0.12% 91 17413 0.13% 92 18669 0.14% 93 20294 0.15% 94 21705 0.16% 95 22799 0.17% 96 23557 0.18% 97 24440 0.19% 98 25236 0.19% 99 25761 0.20% 100 26834 0.20% 101 28202 0.21% 102 30018 0.23% 103 31473 0.24% 104 32863 0.25% 105 34397 0.26% 106 35125 0.27% 107 35982 0.27% 108 36631 0.28% 109 37384 0.28% 110 37877 0.29% 111 39675 0.30% 112 41047 0.31% 113 42941 0.33% 114 44204 0.34% 115 46696 0.35% 116 47473 0.36% 117 48006 0.36% 118 49089 0.37% 119 50174 0.38% 120 51693 0.39% 121 53002 0.40% 122 54893 0.42% 123 57699 0.44% 124 59581 0.45% 125 61942 0.47% 126 64394 0.49% 127 65934 0.50% 128 67580 0.51% 129 70837 0.54% 130 73813 0.56% 131 75369 0.57% 132 80103 0.61% 133 84484 0.64% 134 89415 0.68% 135 94823 0.72% 136 100098 0.76% 137 106195 0.81% 138 113462 0.86% 139 120938 0.92% 140 130089 0.99% 141 140686 1.07% 142 156810 1.19% 143 177593 1.35% 144 204622 1.55% 145 244897 1.86% 146 304295 2.31% 147 404662 3.07% 148 594686 4.51% 149 1079755 8.19% 150 3253538 24.68% 151 3756459 28.50% 13181321 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.87 fanout-score-rank=9 prefix-density=0.59 prefix-fanout=3.0 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=101.50 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=24 prefix-density=0.39 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=55.55 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.7 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATA SRR7170857 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:41:03 Started mapping on | Feb 13 19:41:04 Finished on | Feb 13 19:43:00 Mapping speed, Million of reads per hour | 409.08 Number of input reads | 13181321 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 12401249 Uniquely mapped reads % | 94.08% Average mapped length | 285.16 Number of splices: Total | 11416124 Number of splices: Annotated (sjdb) | 11116918 Number of splices: GT/AG | 11192372 Number of splices: GC/AG | 168540 Number of splices: AT/AC | 8084 Number of splices: Non-canonical | 47128 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 411606 % of reads mapped to multiple loci | 3.12% Number of reads mapped to too many loci | 17270 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.60% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 377347 377347 377347 N_multimapping 411606 411606 411606 N_noFeature 542527 12110468 681147 N_ambiguous 254380 1172 101386 UnstrandedReadsAssigned:11604342 PositiveStrandReadsAssigned:289609 NegativeStrandReadsAssigned:11618716 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=138 echo kmer=133 SRR7170857 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170857-trimmed-pair1.fastq SRR7170857-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,181,321 reads, 11,589,644 reads pseudoaligned [quant] estimated average fragment length: 220.343 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,243 rounds 52401 SRR7170857.ke.tsv 34699 SRR7170857.se.tsv 87100 total ==> SRR7170857.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798.66 510 20.0186 Potri.005G024800.1.v4.1 1035 815.657 254 21.9856 Potri.004G059700.1.v4.1 961 741.695 22 2.09416 Potri.007G009000.2.v4.1 1416 1196.66 0 0 Potri.003G141000.2.v4.1 2943 2723.66 578.762 15.0024 Potri.016G087400.1.v4.1 270 96.0946 1178.74 866.025 Potri.015G069301.1.v4.1 564 349.403 0 0 Potri.010G195200.1.v4.1 1773 1553.66 102.97 4.67916 Potri.012G127500.1.v4.1 977 757.676 44 4.09998 ==> SRR7170857.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 601 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 319 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 43 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 5 SRR7170857 completed mapping pipeline successfully