Starting /dee2/code/volunteer_pipeline.sh SRR7170858 current disk space = 3087581028352 free memory = 1535704840 SRR7170858 SRAfilesize b92e196b1b5f2b6aee20b2ae5309b8c7 SRR7170858.sra SRR7170858.sra file validated SRR7170858 is paired end SRR7170858 is conventional basespace SRR7170858 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170858_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.688 34.0 33.0 34.0 32.0 34.0 2 33.28625 34.0 33.0 34.0 32.0 34.0 3 33.2415 34.0 33.0 34.0 31.0 34.0 4 33.34125 34.0 33.0 34.0 33.0 34.0 5 33.3865 34.0 33.0 34.0 33.0 34.0 6 36.75825 38.0 37.0 38.0 34.0 38.0 7 37.10875 38.0 38.0 38.0 36.0 38.0 8 37.2685 38.0 38.0 38.0 36.0 38.0 9 37.36 38.0 38.0 38.0 37.0 38.0 10-14 37.3461 38.0 38.0 38.0 36.8 38.0 15-19 37.2882 38.0 38.0 38.0 37.0 38.0 20-24 37.268299999999996 38.0 38.0 38.0 36.4 38.0 25-29 37.196299999999994 38.0 38.0 38.0 36.0 38.0 30-34 37.11155000000001 38.0 38.0 38.0 36.0 38.0 35-39 37.02374999999999 38.0 38.0 38.0 36.0 38.0 40-44 36.99235 38.0 38.0 38.0 36.0 38.0 45-49 36.8903 38.0 38.0 38.0 35.2 38.0 50-54 36.8375 38.0 38.0 38.0 35.0 38.0 55-59 36.64254999999999 38.0 38.0 38.0 34.2 38.0 60-64 36.5461 38.0 38.0 38.0 34.0 38.0 65-69 36.54090000000001 38.0 38.0 38.0 34.0 38.0 70-74 36.42665 38.0 37.8 38.0 34.0 38.0 75-79 36.17595 38.0 37.0 38.0 33.6 38.0 80-84 35.973 38.0 37.0 38.0 32.6 38.0 85-89 35.92415 38.0 37.0 38.0 32.6 38.0 90-94 35.71155 38.0 36.6 38.0 31.0 38.0 95-99 35.72709999999999 38.0 36.8 38.0 31.6 38.0 100-104 35.3064 38.0 36.0 38.0 29.4 38.0 105-109 35.1542 38.0 36.0 38.0 28.6 38.0 110-114 34.674800000000005 38.0 35.0 38.0 26.2 38.0 115-119 34.34085 38.0 34.4 38.0 24.4 38.0 120-124 33.96015 38.0 33.8 38.0 22.4 38.0 125-129 33.34655 38.0 32.6 38.0 18.8 38.0 130-134 32.89525 37.8 32.0 38.0 16.2 38.0 135-139 31.934749999999998 37.0 30.8 38.0 13.8 38.0 140-144 30.761100000000006 36.0 28.0 38.0 12.4 38.0 145-149 29.19505 36.0 26.8 38.0 2.0 38.0 150-151 23.01625 28.5 7.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 2.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 0.0 14 6.0 15 1.0 16 0.0 17 3.0 18 10.0 19 8.0 20 4.0 21 8.0 22 10.0 23 18.0 24 18.0 25 29.0 26 32.0 27 42.0 28 40.0 29 55.0 30 67.0 31 102.0 32 146.0 33 207.0 34 289.0 35 499.0 36 1138.0 37 1262.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.89527458492976 18.51851851851852 16.526181353767562 31.060025542784164 2 21.6 20.25 34.75 23.400000000000002 3 19.075 29.225 29.95 21.75 4 20.525 35.225 24.175 20.075000000000003 5 20.974999999999998 36.449999999999996 23.849999999999998 18.725 6 18.875 36.025 25.4 19.7 7 14.499999999999998 21.45 43.725 20.325 8 17.974999999999998 24.099999999999998 29.2 28.725 9 17.4 24.45 31.974999999999998 26.174999999999997 10-14 19.5 29.580000000000002 26.810000000000002 24.11 15-19 19.35 28.610000000000003 28.365000000000002 23.674999999999997 20-24 19.355 29.285 27.71 23.65 25-29 19.46 29.07 27.694999999999997 23.775 30-34 19.475 29.125 27.395000000000003 24.005000000000003 35-39 19.45 28.999999999999996 28.025 23.525 40-44 19.56 28.62 28.375 23.445 45-49 19.35 28.744999999999997 28.634999999999998 23.27 50-54 19.64 28.535 28.015 23.810000000000002 55-59 19.86 28.375 28.249999999999996 23.515 60-64 19.950000000000003 28.455000000000002 28.315 23.28 65-69 19.695 29.520000000000003 27.200000000000003 23.585 70-74 19.555 28.93 27.779999999999998 23.735 75-79 19.55 29.065 27.77 23.615 80-84 19.72 28.955 27.224999999999998 24.099999999999998 85-89 19.5 29.520000000000003 27.18 23.799999999999997 90-94 20.13 28.439999999999998 27.73 23.7 95-99 19.32 28.665000000000003 28.01 24.005000000000003 100-104 19.919999999999998 28.405 27.839999999999996 23.835 105-109 19.525000000000002 29.32 27.37 23.785 110-114 19.869999999999997 28.549999999999997 27.725 23.855 115-119 19.345000000000002 28.634999999999998 28.134999999999998 23.885 120-124 19.919999999999998 28.63 27.98 23.47 125-129 20.26 28.16 27.800000000000004 23.78 130-134 20.365 28.505000000000003 27.744999999999997 23.385 135-139 20.24 28.77 27.235 23.755000000000003 140-144 20.165 28.060000000000002 28.025 23.75 145-149 19.525000000000002 28.83 27.900000000000002 23.745 150-151 19.6875 27.6 28.15 24.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 1.5 19 2.0 20 1.0 21 3.0 22 3.0 23 1.5 24 2.5 25 3.5 26 8.5 27 13.0 28 12.5 29 19.0 30 27.5 31 32.0 32 40.0 33 55.5 34 68.0 35 82.0 36 100.5 37 128.0 38 152.5 39 168.0 40 199.5 41 229.5 42 236.0 43 252.0 44 255.0 45 270.0 46 275.5 47 237.0 48 212.5 49 186.0 50 164.0 51 137.5 52 100.0 53 80.0 54 61.0 55 42.0 56 36.5 57 26.5 58 19.0 59 16.0 60 11.5 61 6.0 62 4.0 63 4.0 64 4.0 65 2.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.444724886421 98.5 2 0.4543160020191822 0.8999999999999999 3 0.05047955577990913 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025239777889954566 0.2 9 0.0 0.0 >10 0.025239777889954566 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 10 0.25 TruSeq Adapter, Index 2 (97% over 37bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTATG 8 0.2 TruSeq Adapter, Index 2 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.11249999999999999 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.7625 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 0.8875 0.0 0.0 0.0 0.0 132-133 0.925 0.0 0.0 0.0 0.0 134-135 1.0 0.0 0.0 0.0 0.0 136-137 1.025 0.0 0.0 0.0 0.0 138-139 1.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCCAGC 10 0.0068378756 144.95 6 TGAGGCC 10 0.0068378756 144.95 3 AGATCAC 10 0.0068378756 144.95 6 AAAAAAA 25 4.9877126E-4 28.99 70-74 >>END_MODULE SRR7170858 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170858_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62775 33.0 33.0 34.0 32.0 34.0 2 32.6745 33.0 33.0 34.0 32.0 34.0 3 32.727 34.0 33.0 34.0 32.0 34.0 4 32.68425 34.0 33.0 34.0 32.0 34.0 5 32.65625 34.0 33.0 34.0 32.0 34.0 6 36.817 38.0 38.0 38.0 36.0 38.0 7 36.88125 38.0 38.0 38.0 36.0 38.0 8 36.84 38.0 38.0 38.0 36.0 38.0 9 36.7795 38.0 38.0 38.0 36.0 38.0 10-14 36.782799999999995 38.0 38.0 38.0 36.0 38.0 15-19 36.7197 38.0 38.0 38.0 36.0 38.0 20-24 36.6511 38.0 38.0 38.0 35.8 38.0 25-29 36.495400000000004 38.0 38.0 38.0 35.0 38.0 30-34 36.530800000000006 38.0 38.0 38.0 35.2 38.0 35-39 36.53574999999999 38.0 38.0 38.0 35.0 38.0 40-44 36.53665 38.0 38.0 38.0 35.4 38.0 45-49 36.504 38.0 38.0 38.0 34.8 38.0 50-54 36.3651 38.0 38.0 38.0 34.4 38.0 55-59 36.342099999999995 38.0 38.0 38.0 34.2 38.0 60-64 36.27395 38.0 38.0 38.0 34.2 38.0 65-69 36.2907 38.0 38.0 38.0 34.0 38.0 70-74 36.168949999999995 38.0 38.0 38.0 33.6 38.0 75-79 35.97825 38.0 38.0 38.0 33.2 38.0 80-84 35.82445 38.0 38.0 38.0 33.0 38.0 85-89 35.70055000000001 38.0 37.6 38.0 32.6 38.0 90-94 35.50035 38.0 37.0 38.0 31.0 38.0 95-99 35.4235 38.0 37.0 38.0 31.0 38.0 100-104 35.2242 38.0 37.0 38.0 29.6 38.0 105-109 34.97775 38.0 36.4 38.0 28.2 38.0 110-114 34.811099999999996 38.0 36.0 38.0 27.6 38.0 115-119 34.592200000000005 38.0 36.0 38.0 27.0 38.0 120-124 34.21155 38.0 35.2 38.0 23.8 38.0 125-129 33.851150000000004 38.0 34.6 38.0 21.4 38.0 130-134 33.07415 38.0 33.2 38.0 15.0 38.0 135-139 32.4671 38.0 33.0 38.0 13.8 38.0 140-144 31.71855 38.0 31.6 38.0 12.6 38.0 145-149 30.43945 37.6 29.4 38.0 3.8 38.0 150-151 25.286375 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 11.0 4 9.0 5 2.0 6 1.0 7 3.0 8 4.0 9 0.0 10 4.0 11 1.0 12 2.0 13 5.0 14 7.0 15 8.0 16 5.0 17 5.0 18 11.0 19 10.0 20 20.0 21 11.0 22 14.0 23 19.0 24 19.0 25 24.0 26 24.0 27 32.0 28 38.0 29 44.0 30 60.0 31 87.0 32 104.0 33 121.0 34 189.0 35 323.0 36 778.0 37 1986.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.525 18.45 20.474999999999998 23.549999999999997 2 27.334167709637047 23.704630788485606 31.53942428035044 17.421777221526906 3 22.97872340425532 28.1351689612015 30.813516896120152 18.072590738423028 4 24.380475594493117 34.81852315394243 22.62828535669587 18.172715894868585 5 23.053817271589487 37.09637046307885 22.728410513141426 17.121401752190238 6 20.474999999999998 35.65 24.4 19.475 7 19.400000000000002 20.45 39.925 20.225 8 22.375 25.8 26.150000000000002 25.674999999999997 9 21.175 28.025 26.400000000000002 24.4 10-14 22.831141557077853 28.30641532076604 27.10635531776589 21.75608780439022 15-19 22.744548909781955 28.375675135027006 28.355671134226846 20.524104820964194 20-24 23.187027676292477 27.851458885941643 28.36694860117111 20.594564836594763 25-29 23.25290348418102 28.514217060472568 28.083700440528638 20.14917901481778 30-34 21.90471424281854 28.981082974677207 28.495646081473325 20.618556701030926 35-39 22.477982385908728 27.90232185748599 28.73799039231385 20.881705364291435 40-44 22.831255944335986 27.361465685538366 29.13350352905842 20.673774841067228 45-49 22.673138510808645 28.25760608486789 28.207566052842274 20.861689351481186 50-54 23.14467297202622 28.16393934844618 28.00380323274784 20.687584446779763 55-59 22.940323145415437 27.537391826321844 28.582862288029613 20.939422740233105 60-64 22.715901130791554 28.064645251676172 28.32983088161713 20.88962273591514 65-69 22.82826261008807 27.642113690952762 28.3226581265012 21.206965572457968 70-74 22.66199649737303 28.261195896922693 28.236177132849637 20.84063047285464 75-79 23.18623036125288 28.399879915941156 27.954568197738418 20.459321525067548 80-84 22.688150520416333 28.27762209767814 28.23258606885509 20.80164131305044 85-89 22.888010803781324 28.164857700195068 28.244885709998503 20.70224578602511 90-94 23.04421768707483 28.48639455782313 27.871148459383754 20.598239295718287 95-99 23.486174308715434 27.731386569328464 28.0314015700785 20.751037551877594 100-104 23.480566254814665 28.592866790055528 27.332299534790653 20.59426742033915 105-109 23.163530824659727 27.77722177742194 28.467774219375503 20.591473178542834 110-114 23.75093773443361 28.252063015753937 27.731932983245812 20.26506626656664 115-119 22.883306645316253 28.47277822257806 28.51781425140112 20.126100880704563 120-124 23.26663331665833 27.598799399699853 28.469234617308654 20.665332666333168 125-129 23.306314420094065 28.13969778845192 27.619333533473434 20.934654257980586 130-134 23.41702510753226 28.178453536060815 28.133440032009606 20.27108132439732 135-139 23.656828414207105 27.57878939469735 28.319159579789893 20.445222611305653 140-144 23.219287715086033 28.44637855142057 27.74109643857543 20.59323729491797 145-149 24.22832557906849 27.98539196558107 27.75026264445445 20.036019810895993 150-151 22.97111416781293 27.397774165311993 28.810804051519316 20.820307615355755 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 2.0 20 2.0 21 1.5 22 1.0 23 3.5 24 5.0 25 5.0 26 7.5 27 8.0 28 12.0 29 19.0 30 24.0 31 29.0 32 31.0 33 37.0 34 53.5 35 73.0 36 87.5 37 102.5 38 138.5 39 176.0 40 205.0 41 247.0 42 266.5 43 263.5 44 255.0 45 263.0 46 264.5 47 242.5 48 220.0 49 192.5 50 175.0 51 136.0 52 96.0 53 80.0 54 69.0 55 52.0 56 38.0 57 28.5 58 18.5 59 17.0 60 15.5 61 11.5 62 7.5 63 4.0 64 1.5 65 1.5 66 1.5 67 0.5 68 0.5 69 0.5 70 0.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.125 4 0.125 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.02 20-24 0.095 25-29 0.12 30-34 0.09 35-39 0.08 40-44 0.11499999999999999 45-49 0.08 50-54 0.08499999999999999 55-59 0.045 60-64 0.06999999999999999 65-69 0.08 70-74 0.075 75-79 0.06999999999999999 80-84 0.08 85-89 0.034999999999999996 90-94 0.04 95-99 0.005 100-104 0.045 105-109 0.08 110-114 0.025 115-119 0.08 120-124 0.05 125-129 0.06999999999999999 130-134 0.03 135-139 0.05 140-144 0.04 145-149 0.055 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47103274559194 98.725 2 0.4785894206549119 0.95 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025188916876574305 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCT 10 0.25 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.11249999999999999 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.65 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.7875000000000001 0.0 0.0 0.0 0.0 130-131 0.8625 0.0 0.0 0.0 0.0 132-133 0.9 0.0 0.0 0.0 0.0 134-135 0.9624999999999999 0.0 0.0 0.0 0.0 136-137 0.975 0.0 0.0 0.0 0.0 138-139 1.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATAAT 10 0.006830828 145.0 4 >>END_MODULE Read 489260 spots for SRR7170858.sra Written 489260 spots for SRR7170858.sra Read 489260 spots for SRR7170858.sra Written 489260 spots for SRR7170858.sra Read 489260 spots for SRR7170858.sra Written 489260 spots for SRR7170858.sra Read 489260 spots for SRR7170858.sra Written 489260 spots for SRR7170858.sra Read 489260 spots for SRR7170858.sra Written 489260 spots for SRR7170858.sra Read 489260 spots for SRR7170858.sra Written 489260 spots for SRR7170858.sra Read 489260 spots for SRR7170858.sra Written 489260 spots for SRR7170858.sra Read 489260 spots for SRR7170858.sra Written 489260 spots for SRR7170858.sra Read 489260 spots for SRR7170858.sra Written 489260 spots for SRR7170858.sra Read 489260 spots for SRR7170858.sra Written 489260 spots for SRR7170858.sra Read 489260 spots for SRR7170858.sra Written 489260 spots for SRR7170858.sra Read 489260 spots for SRR7170858.sra Written 489260 spots for SRR7170858.sra Read 489260 spots for SRR7170858.sra Written 489260 spots for SRR7170858.sra Read 489260 spots for SRR7170858.sra Written 489260 spots for SRR7170858.sra Read 489260 spots for SRR7170858.sra Written 489260 spots for SRR7170858.sra Read 489260 spots for SRR7170858.sra Written 489260 spots for SRR7170858.sra Read 489260 spots for SRR7170858.sra Written 489260 spots for SRR7170858.sra Read 489260 spots for SRR7170858.sra Written 489260 spots for SRR7170858.sra Read 489271 spots for SRR7170858.sra Written 489271 spots for SRR7170858.sra Read 489260 spots for SRR7170858.sra Written 489260 spots for SRR7170858.sra SRR ids: ['SRR7170858.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ibjp9mhy SRR7170858.sra spots: 9785211 blocks: [[1, 489260], [489261, 978520], [978521, 1467780], [1467781, 1957040], [1957041, 2446300], [2446301, 2935560], [2935561, 3424820], [3424821, 3914080], [3914081, 4403340], [4403341, 4892600], [4892601, 5381860], [5381861, 5871120], [5871121, 6360380], [6360381, 6849640], [6849641, 7338900], [7338901, 7828160], [7828161, 8317420], [8317421, 8806680], [8806681, 9295940], [9295941, 9785211]] SRR7170858 file size 3294606 SRR7170858 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170858 SRR7170858_1.fastq SRR7170858_2.fastq Input file: SRR7170858_1.fastq Paired file: SRR7170858_2.fastq trimmed: SRR7170858-trimmed-pair1.fastq, SRR7170858-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:11:32 2025 >> started Thu Feb 13 20:11:49 2025 >> done (16.376s) 9785211 read pairs processed; of these: 35480 ( 0.36%) short read pairs filtered out after trimming by size control 71983 ( 0.74%) empty read pairs filtered out after trimming by size control 9677748 (98.90%) read pairs available; of these: 6593216 (68.13%) trimmed read pairs available after processing 3084532 (31.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 19 0.00% 20 16 0.00% 21 25 0.00% 22 22 0.00% 23 23 0.00% 24 27 0.00% 25 31 0.00% 26 23 0.00% 27 20 0.00% 28 22 0.00% 29 37 0.00% 30 28 0.00% 31 14 0.00% 32 26 0.00% 33 28 0.00% 34 25 0.00% 35 23 0.00% 36 29 0.00% 37 33 0.00% 38 59 0.00% 39 55 0.00% 40 59 0.00% 41 60 0.00% 42 50 0.00% 43 44 0.00% 44 84 0.00% 45 72 0.00% 46 76 0.00% 47 83 0.00% 48 122 0.00% 49 112 0.00% 50 90 0.00% 51 148 0.00% 52 195 0.00% 53 172 0.00% 54 156 0.00% 55 164 0.00% 56 188 0.00% 57 186 0.00% 58 233 0.00% 59 240 0.00% 60 274 0.00% 61 347 0.00% 62 339 0.00% 63 369 0.00% 64 333 0.00% 65 327 0.00% 66 370 0.00% 67 415 0.00% 68 426 0.00% 69 495 0.01% 70 534 0.01% 71 645 0.01% 72 876 0.01% 73 949 0.01% 74 1219 0.01% 75 1812 0.02% 76 5054 0.05% 77 4777 0.05% 78 1944 0.02% 79 1499 0.02% 80 1556 0.02% 81 1663 0.02% 82 1858 0.02% 83 2500 0.03% 84 3866 0.04% 85 3421 0.04% 86 3299 0.03% 87 3335 0.03% 88 3528 0.04% 89 3626 0.04% 90 3522 0.04% 91 3845 0.04% 92 3855 0.04% 93 3914 0.04% 94 3999 0.04% 95 4192 0.04% 96 4240 0.04% 97 4358 0.05% 98 4463 0.05% 99 4672 0.05% 100 4844 0.05% 101 5213 0.05% 102 5611 0.06% 103 5997 0.06% 104 6380 0.07% 105 6612 0.07% 106 6836 0.07% 107 7215 0.07% 108 7406 0.08% 109 7762 0.08% 110 8463 0.09% 111 8869 0.09% 112 9613 0.10% 113 10355 0.11% 114 11003 0.11% 115 11744 0.12% 116 12300 0.13% 117 12951 0.13% 118 13823 0.14% 119 14711 0.15% 120 15733 0.16% 121 16783 0.17% 122 18147 0.19% 123 19824 0.20% 124 21471 0.22% 125 23137 0.24% 126 25217 0.26% 127 27061 0.28% 128 28847 0.30% 129 31367 0.32% 130 33572 0.35% 131 36743 0.38% 132 40000 0.41% 133 44163 0.46% 134 48720 0.50% 135 53829 0.56% 136 60118 0.62% 137 66956 0.69% 138 74104 0.77% 139 82791 0.86% 140 92303 0.95% 141 105729 1.09% 142 122388 1.26% 143 143653 1.48% 144 170098 1.76% 145 207181 2.14% 146 262236 2.71% 147 353351 3.65% 148 525385 5.43% 149 938191 9.69% 150 2630566 27.18% 151 3084532 31.87% 9677748 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=23 prefix-density=0.46 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=373.81 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=15.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=27 prefix-density=0.79 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=18.55 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.7 sequence=ATTTTTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTACCATTGCCTTCTCTCCCTTATCCATGGCAGCTCGAGAATT SRR7170858 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:12:49 Started mapping on | Feb 13 20:12:49 Finished on | Feb 13 20:13:54 Mapping speed, Million of reads per hour | 536.00 Number of input reads | 9677748 Average input read length | 284 UNIQUE READS: Uniquely mapped reads number | 8809012 Uniquely mapped reads % | 91.02% Average mapped length | 284.09 Number of splices: Total | 8516524 Number of splices: Annotated (sjdb) | 8323409 Number of splices: GT/AG | 8360965 Number of splices: GC/AG | 125018 Number of splices: AT/AC | 4595 Number of splices: Non-canonical | 25946 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 264501 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 72503 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.35% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 632548 632548 632548 N_multimapping 264501 264501 264501 N_noFeature 372492 8667461 409944 N_ambiguous 185482 872 80838 UnstrandedReadsAssigned:8251038 PositiveStrandReadsAssigned:140679 NegativeStrandReadsAssigned:8318230 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=146 echo kmer=141 SRR7170858 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170858-trimmed-pair1.fastq SRR7170858-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,677,748 reads, 8,475,223 reads pseudoaligned [quant] estimated average fragment length: 310.989 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,017 rounds 52401 SRR7170858.ke.tsv 34699 SRR7170858.se.tsv 87100 total ==> SRR7170858.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1708.01 456 28.0943 Potri.005G024800.1.v4.1 1035 725.011 197 28.5934 Potri.004G059700.1.v4.1 961 651.095 2 0.323243 Potri.007G009000.2.v4.1 1416 1106.01 0 0 Potri.003G141000.2.v4.1 2943 2633.01 341.31 13.6408 Potri.016G087400.1.v4.1 270 64.198 627 1027.75 Potri.015G069301.1.v4.1 564 268.726 0 0 Potri.010G195200.1.v4.1 1773 1463.01 255.917 18.4075 Potri.012G127500.1.v4.1 977 667.04 42 6.62584 ==> SRR7170858.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 229 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 202 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR7170858 completed mapping pipeline successfully