Starting /dee2/code/volunteer_pipeline.sh SRR7170859 current disk space = 3087569170432 free memory = 1582358684 SRR7170859 SRAfilesize 8c30818a5225c4bcfb07e23fb1a89ecc SRR7170859.sra SRR7170859.sra file validated SRR7170859 is paired end SRR7170859 is conventional basespace SRR7170859 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170859_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.728 34.0 33.0 34.0 32.0 34.0 2 33.19675 34.0 33.0 34.0 32.0 34.0 3 33.18275 34.0 33.0 34.0 31.0 34.0 4 33.337 34.0 33.0 34.0 33.0 34.0 5 33.319 34.0 33.0 34.0 33.0 34.0 6 36.64775 38.0 37.0 38.0 34.0 38.0 7 37.1005 38.0 38.0 38.0 36.0 38.0 8 37.24175 38.0 38.0 38.0 37.0 38.0 9 37.3665 38.0 38.0 38.0 37.0 38.0 10-14 37.43415 38.0 38.0 38.0 37.0 38.0 15-19 37.3171 38.0 38.0 38.0 36.8 38.0 20-24 37.281400000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.27175 38.0 38.0 38.0 36.8 38.0 30-34 37.15675 38.0 38.0 38.0 36.0 38.0 35-39 37.1053 38.0 38.0 38.0 35.8 38.0 40-44 36.9736 38.0 38.0 38.0 35.8 38.0 45-49 36.936249999999994 38.0 38.0 38.0 35.6 38.0 50-54 36.602199999999996 38.0 38.0 38.0 34.2 38.0 55-59 36.5721 38.0 38.0 38.0 34.4 38.0 60-64 36.54090000000001 38.0 38.0 38.0 34.0 38.0 65-69 36.489000000000004 38.0 37.8 38.0 33.8 38.0 70-74 36.44415 38.0 37.8 38.0 34.0 38.0 75-79 36.1377 38.0 37.2 38.0 33.6 38.0 80-84 36.0645 38.0 37.0 38.0 33.4 38.0 85-89 35.76545 38.0 37.0 38.0 31.2 38.0 90-94 35.5818 38.0 36.8 38.0 30.8 38.0 95-99 35.3644 38.0 36.4 38.0 29.4 38.0 100-104 34.77460000000001 38.0 35.4 38.0 26.6 38.0 105-109 34.6981 38.0 35.2 38.0 26.0 38.0 110-114 34.42115 38.0 34.4 38.0 25.4 38.0 115-119 34.00725 38.0 33.6 38.0 23.2 38.0 120-124 33.29730000000001 38.0 33.0 38.0 19.0 38.0 125-129 32.38375 38.0 32.0 38.0 14.0 38.0 130-134 31.72555 37.2 30.4 38.0 13.2 38.0 135-139 30.668 36.0 28.2 38.0 12.6 38.0 140-144 30.5485 36.2 28.0 38.0 10.0 38.0 145-149 28.717750000000002 35.4 24.8 38.0 2.0 38.0 150-151 21.663125 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 3.0 13 1.0 14 4.0 15 5.0 16 4.0 17 4.0 18 12.0 19 18.0 20 10.0 21 17.0 22 19.0 23 17.0 24 20.0 25 38.0 26 30.0 27 42.0 28 49.0 29 40.0 30 84.0 31 80.0 32 133.0 33 197.0 34 361.0 35 543.0 36 1105.0 37 1161.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.38512480896587 14.493122771268466 11.869587366276107 35.25216505348956 2 20.375 18.55 36.05 25.025 3 17.133566783391696 25.237618809404704 30.21510755377689 27.41370685342671 4 20.625 32.125 24.325 22.925 5 21.925 36.475 24.325 17.275 6 17.45 37.5 25.724999999999998 19.325 7 12.825000000000001 25.575 43.875 17.724999999999998 8 17.474999999999998 26.05 31.874999999999996 24.6 9 16.55 27.250000000000004 31.724999999999998 24.474999999999998 10-14 18.715 31.64 26.6 23.044999999999998 15-19 18.69 30.705 27.485 23.119999999999997 20-24 18.64 30.2 28.075 23.085 25-29 18.56 31.41 27.165 22.865 30-34 18.41 30.53 27.950000000000003 23.11 35-39 19.485 30.145 27.529999999999998 22.84 40-44 18.834999999999997 31.505 27.075 22.585 45-49 19.055 30.580000000000002 26.775 23.59 50-54 19.25 30.599999999999998 27.155 22.994999999999997 55-59 19.11 29.675 28.025 23.189999999999998 60-64 19.45 29.475 28.1 22.975 65-69 18.965 30.975 27.284999999999997 22.775000000000002 70-74 19.215 30.104999999999997 27.295 23.385 75-79 19.12 30.354999999999997 27.605 22.919999999999998 80-84 19.39 30.495 26.88 23.235 85-89 19.405 29.865000000000002 27.229999999999997 23.5 90-94 19.295 29.799999999999997 27.33 23.575 95-99 19.305 29.654999999999998 27.925 23.115 100-104 19.955000000000002 29.695 27.250000000000004 23.1 105-109 20.24 29.185 27.169999999999998 23.405 110-114 20.515 29.45 26.965 23.07 115-119 20.235 29.509999999999998 26.255 24.0 120-124 20.669999999999998 29.14 26.38 23.810000000000002 125-129 20.46 29.5 26.19 23.849999999999998 130-134 21.2 28.865000000000002 25.52 24.415 135-139 21.05 29.160000000000004 25.629999999999995 24.16 140-144 21.39820973145972 28.8293243986598 25.398809821473222 24.37365604840726 145-149 21.438215732359854 28.74431164674701 25.358803820573083 24.458668800320048 150-151 21.3125 29.262500000000003 25.087500000000002 24.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 1.0 21 2.0 22 2.0 23 2.5 24 5.0 25 11.5 26 13.5 27 14.5 28 20.0 29 30.0 30 38.5 31 52.0 32 71.5 33 86.5 34 102.5 35 130.5 36 146.0 37 152.0 38 160.5 39 186.5 40 225.5 41 223.5 42 217.0 43 225.0 44 225.5 45 222.5 46 216.0 47 204.0 48 179.0 49 161.5 50 146.0 51 118.0 52 88.5 53 72.5 54 67.5 55 48.0 56 41.5 57 34.5 58 15.5 59 10.0 60 8.5 61 6.0 62 3.0 63 0.5 64 1.0 65 1.0 66 0.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.8499999999999999 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.015 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.49104859335038 96.275 2 1.1764705882352942 2.3 3 0.2557544757033248 0.75 4 0.025575447570332477 0.1 5 0.025575447570332477 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025575447570332477 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTAT 18 0.44999999999999996 TruSeq Adapter, Index 6 (97% over 36bp) CTTCATTAAAACCACACCAGAGGCCACAGACATGGCCAATACATAACAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 0.9624999999999999 0.0 0.0 0.0 0.0 94-95 1.1125 0.0 0.0 0.0 0.0 96-97 1.4375 0.0 0.0 0.0 0.0 98-99 1.75 0.0 0.0 0.0 0.0 100-101 2.1624999999999996 0.0 0.0 0.0 0.0 102-103 2.5875000000000004 0.0 0.0 0.0 0.0 104-105 3.1125 0.0 0.0 0.0 0.0 106-107 3.65 0.0 0.0 0.0 0.0 108-109 4.2 0.0 0.0 0.0 0.0 110-111 4.6375 0.0 0.0 0.0 0.0 112-113 5.325 0.0 0.0 0.0 0.0 114-115 5.775 0.0 0.0 0.0 0.0 116-117 6.4375 0.0 0.0 0.0 0.0 118-119 7.1125 0.0 0.0 0.0 0.0 120-121 7.675 0.0 0.0 0.0 0.0 122-123 8.6 0.0 0.0 0.0 0.0 124-125 9.55 0.0 0.0 0.0 0.0 126-127 10.3625 0.0 0.0 0.0 0.0 128-129 11.35 0.0 0.0 0.0 0.0 130-131 12.2875 0.0 0.0 0.0 0.0 132-133 13.2375 0.0 0.0 0.0 0.0 134-135 14.1875 0.0 0.0 0.0 0.0 136-137 15.3625 0.0 0.0 0.0 0.0 138-139 16.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAATAA 10 0.006832588 144.9875 7 >>END_MODULE SRR7170859 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170859_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9095 33.0 33.0 34.0 32.0 34.0 2 32.98475 33.0 33.0 34.0 32.0 34.0 3 32.996 34.0 33.0 34.0 32.0 34.0 4 32.9175 34.0 33.0 34.0 32.0 34.0 5 32.93875 34.0 33.0 34.0 32.0 34.0 6 37.09325 38.0 38.0 38.0 37.0 38.0 7 37.1495 38.0 38.0 38.0 37.0 38.0 8 37.18625 38.0 38.0 38.0 37.0 38.0 9 37.198 38.0 38.0 38.0 37.0 38.0 10-14 37.15625 38.0 38.0 38.0 37.0 38.0 15-19 37.13575 38.0 38.0 38.0 37.0 38.0 20-24 37.11625 38.0 38.0 38.0 37.0 38.0 25-29 37.08045 38.0 38.0 38.0 37.0 38.0 30-34 37.0412 38.0 38.0 38.0 36.8 38.0 35-39 36.948350000000005 38.0 38.0 38.0 36.0 38.0 40-44 37.03014999999999 38.0 38.0 38.0 36.4 38.0 45-49 36.945499999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.96055 38.0 38.0 38.0 36.0 38.0 55-59 36.925850000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.83024999999999 38.0 38.0 38.0 35.8 38.0 65-69 36.8221 38.0 38.0 38.0 35.8 38.0 70-74 36.75285 38.0 38.0 38.0 35.6 38.0 75-79 36.630849999999995 38.0 38.0 38.0 35.0 38.0 80-84 36.3534 38.0 38.0 38.0 34.0 38.0 85-89 36.27675 38.0 38.0 38.0 34.0 38.0 90-94 36.15575 38.0 38.0 38.0 33.8 38.0 95-99 36.0264 38.0 38.0 38.0 33.6 38.0 100-104 35.88575 38.0 37.0 38.0 33.0 38.0 105-109 35.82445 38.0 37.0 38.0 33.0 38.0 110-114 35.5798 38.0 37.0 38.0 31.2 38.0 115-119 35.27005 38.0 36.4 38.0 29.8 38.0 120-124 34.852250000000005 38.0 36.0 38.0 28.2 38.0 125-129 34.29815 38.0 34.6 38.0 25.0 38.0 130-134 33.65025 38.0 33.4 38.0 20.8 38.0 135-139 33.0163 38.0 33.0 38.0 16.2 38.0 140-144 31.9572 38.0 31.8 38.0 13.0 38.0 145-149 30.7003 36.4 29.8 38.0 5.8 38.0 150-151 24.541875 31.0 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 3.0 4 1.0 5 1.0 6 0.0 7 1.0 8 1.0 9 1.0 10 0.0 11 2.0 12 2.0 13 3.0 14 1.0 15 0.0 16 7.0 17 6.0 18 3.0 19 10.0 20 17.0 21 10.0 22 15.0 23 15.0 24 16.0 25 20.0 26 18.0 27 24.0 28 38.0 29 40.0 30 49.0 31 72.0 32 82.0 33 115.0 34 175.0 35 307.0 36 971.0 37 1963.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.15 21.575 12.825000000000001 24.45 2 27.38184546136534 25.731432858214554 31.45786446611653 15.428857214303576 3 22.155538884721178 26.506626656664167 32.23305826456614 19.10477619404851 4 24.462231115557778 33.81690845422711 23.28664332166083 18.434217108554275 5 25.337668834417208 35.99299649824913 21.860930465232617 16.808404202101052 6 20.290217663247436 38.05354015511634 23.14235676757568 18.513885414060546 7 19.189392044033024 20.540405303977984 41.43107330497873 18.839129347010257 8 21.891418563922944 24.193144858643983 28.021015761821367 25.894420815611706 9 22.59194395796848 24.74355766825119 28.696522391793845 23.967975981986488 10-14 24.39329497122842 28.651488616462345 26.21966474856142 20.735551663747813 15-19 23.777833375031275 27.695771828871653 28.231173380035024 20.295221416062045 20-24 23.422566925193898 28.481361020765572 27.990993244933698 20.10507880910683 25-29 24.153114836127095 27.875906930197647 28.071053289967473 19.89992494370778 30-34 23.30247685764323 28.13109832374281 28.446334751063297 20.120090067550663 35-39 22.8771578684013 28.011008256192145 28.51138353765324 20.600450337753315 40-44 23.38253690267701 28.021015761821367 28.45634225669252 20.140105078809107 45-49 23.432574430823117 27.66574931198399 28.881661245934453 20.020015011258444 50-54 23.262446835126344 27.33049787340505 28.926695021265946 20.480360270202652 55-59 23.60270202651989 27.72079059294471 28.98173630222667 19.694771078308733 60-64 23.792844633475106 27.650738053540152 28.32124093069802 20.235176382286717 65-69 23.157368026019515 27.335501626219667 29.13685263947961 20.37027770828121 70-74 23.247435576682513 28.2661996497373 28.7215411558669 19.764823617713283 75-79 23.33750312734551 27.745809357017766 28.55641731298474 20.36027020265199 80-84 22.837127845884414 27.835876907680763 28.666499874906183 20.660495371528647 85-89 23.592694520890667 28.111083312484364 28.656492369276958 19.63972979734801 90-94 23.572679509632223 27.950963222416814 28.45133850387791 20.025018764073053 95-99 23.9279459594696 28.316237177883412 28.521391043282463 19.234425819364525 100-104 23.692769577182887 27.570678008506377 28.856642481861392 19.879909932449337 105-109 23.422566925193898 27.905929447085313 29.437077808356264 19.234425819364525 110-114 23.80785589191894 28.19114335751814 29.161871403552663 18.839129347010257 115-119 24.763572679509632 28.171128346259692 28.101075806855143 18.964223167375533 120-124 24.928696522391792 28.20115086314736 27.9459594696022 18.924193144858645 125-129 25.153865399049284 27.715786840130097 28.066049537152864 19.06429822366775 130-134 25.153865399049284 27.595696772579437 28.116087065298974 19.134350763072305 135-139 25.80435326494871 27.105328996747563 28.386289717287966 18.704028021015763 140-144 26.424818613960472 27.08531398548912 27.50562922191644 18.984238178633976 145-149 26.720040030022517 27.660745559169374 27.410557918438826 18.208656492369276 150-151 27.23292469352014 27.207905929447087 27.295471603702776 18.263697773329998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 1.0 25 4.0 26 5.0 27 5.5 28 9.5 29 15.0 30 22.0 31 29.5 32 43.5 33 53.0 34 59.0 35 71.5 36 99.0 37 126.5 38 144.0 39 175.5 40 182.5 41 208.5 42 246.5 43 259.0 44 275.0 45 272.0 46 250.0 47 233.5 48 229.0 49 206.0 50 169.0 51 130.5 52 104.5 53 89.5 54 76.5 55 61.5 56 41.0 57 26.5 58 20.0 59 15.0 60 8.5 61 5.5 62 6.0 63 4.5 64 1.5 65 1.0 66 1.0 67 0.0 68 0.5 69 1.0 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.05 5 0.05 6 0.075 7 0.075 8 0.075 9 0.075 10-14 0.075 15-19 0.075 20-24 0.075 25-29 0.075 30-34 0.075 35-39 0.075 40-44 0.075 45-49 0.075 50-54 0.075 55-59 0.075 60-64 0.075 65-69 0.075 70-74 0.075 75-79 0.075 80-84 0.075 85-89 0.075 90-94 0.075 95-99 0.075 100-104 0.075 105-109 0.075 110-114 0.075 115-119 0.075 120-124 0.075 125-129 0.075 130-134 0.075 135-139 0.075 140-144 0.075 145-149 0.075 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.58974358974359 96.125 2 1.0512820512820513 2.0500000000000003 3 0.1282051282051282 0.375 4 0.07692307692307693 0.3 5 0.07692307692307693 0.375 6 0.02564102564102564 0.15 7 0.0 0.0 8 0.02564102564102564 0.2 9 0.0 0.0 >10 0.02564102564102564 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCT 17 0.42500000000000004 Illumina Single End PCR Primer 1 (96% over 32bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit GAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCA 5 0.125 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 0.9624999999999999 0.0 0.0 0.0 0.0 94-95 1.1125 0.0 0.0 0.0 0.0 96-97 1.4625 0.0 0.0 0.0 0.0 98-99 1.775 0.0 0.0 0.0 0.0 100-101 2.1875 0.0 0.0 0.0 0.0 102-103 2.6125 0.0 0.0 0.0 0.0 104-105 3.1875 0.0 0.0 0.0 0.0 106-107 3.7625 0.0 0.0 0.0 0.0 108-109 4.3 0.0 0.0 0.0 0.0 110-111 4.7625 0.0 0.0 0.0 0.0 112-113 5.425 0.0 0.0 0.0 0.0 114-115 5.925000000000001 0.0 0.0 0.0 0.0 116-117 6.575 0.0 0.0 0.0 0.0 118-119 7.2625 0.0 0.0 0.0 0.0 120-121 7.825 0.0 0.0 0.0 0.0 122-123 8.7375 0.0 0.0 0.0 0.0 124-125 9.7 0.0 0.0 0.0 0.0 126-127 10.55 0.0 0.0 0.0 0.0 128-129 11.5625 0.0 0.0 0.0 0.0 130-131 12.524999999999999 0.0 0.0 0.0 0.0 132-133 13.4375 0.0 0.0 0.0 0.0 134-135 14.425 0.0 0.0 0.0 0.0 136-137 15.725 0.0 0.0 0.0 0.0 138-139 16.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAGAAT 10 0.006830828 145.0 2 CTTAGAA 10 0.006830828 145.0 1 GAATCAG 10 0.006830828 145.0 5 TAGAATC 10 0.006830828 145.0 3 >>END_MODULE Read 650269 spots for SRR7170859.sra Written 650269 spots for SRR7170859.sra Read 650269 spots for SRR7170859.sra Written 650269 spots for SRR7170859.sra Read 650269 spots for SRR7170859.sra Written 650269 spots for SRR7170859.sra Read 650269 spots for SRR7170859.sra Written 650269 spots for SRR7170859.sra Read 650269 spots for SRR7170859.sra Written 650269 spots for SRR7170859.sra Read 650269 spots for SRR7170859.sra Written 650269 spots for SRR7170859.sra Read 650269 spots for SRR7170859.sra Written 650269 spots for SRR7170859.sra Read 650269 spots for SRR7170859.sra Written 650269 spots for SRR7170859.sra Read 650269 spots for SRR7170859.sra Written 650269 spots for SRR7170859.sra Read 650269 spots for SRR7170859.sra Written 650269 spots for SRR7170859.sra Read 650269 spots for SRR7170859.sra Written 650269 spots for SRR7170859.sra Read 650269 spots for SRR7170859.sra Written 650269 spots for SRR7170859.sra Read 650269 spots for SRR7170859.sra Written 650269 spots for SRR7170859.sra Read 650269 spots for SRR7170859.sra Written 650269 spots for SRR7170859.sra Read 650269 spots for SRR7170859.sra Written 650269 spots for SRR7170859.sra Read 650269 spots for SRR7170859.sra Written 650269 spots for SRR7170859.sra Read 650275 spots for SRR7170859.sra Written 650275 spots for SRR7170859.sra Read 650269 spots for SRR7170859.sra Written 650269 spots for SRR7170859.sra Read 650269 spots for SRR7170859.sra Written 650269 spots for SRR7170859.sra Read 650269 spots for SRR7170859.sra Written 650269 spots for SRR7170859.sra SRR ids: ['SRR7170859.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xwsjk28f SRR7170859.sra spots: 13005386 blocks: [[1, 650269], [650270, 1300538], [1300539, 1950807], [1950808, 2601076], [2601077, 3251345], [3251346, 3901614], [3901615, 4551883], [4551884, 5202152], [5202153, 5852421], [5852422, 6502690], [6502691, 7152959], [7152960, 7803228], [7803229, 8453497], [8453498, 9103766], [9103767, 9754035], [9754036, 10404304], [10404305, 11054573], [11054574, 11704842], [11704843, 12355111], [12355112, 13005386]] SRR7170859 file size 4385398 SRR7170859 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170859 SRR7170859_1.fastq SRR7170859_2.fastq Input file: SRR7170859_1.fastq Paired file: SRR7170859_2.fastq trimmed: SRR7170859-trimmed-pair1.fastq, SRR7170859-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:33:22 2025 >> started Thu Feb 13 20:33:40 2025 >> done (17.974s) 13005386 read pairs processed; of these: 15565 ( 0.12%) short read pairs filtered out after trimming by size control 112394 ( 0.86%) empty read pairs filtered out after trimming by size control 12877427 (99.02%) read pairs available; of these: 9295189 (72.18%) trimmed read pairs available after processing 3582238 (27.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 13 0.00% 20 15 0.00% 21 6 0.00% 22 4 0.00% 23 21 0.00% 24 19 0.00% 25 15 0.00% 26 14 0.00% 27 27 0.00% 28 20 0.00% 29 21 0.00% 30 20 0.00% 31 25 0.00% 32 15 0.00% 33 33 0.00% 34 32 0.00% 35 34 0.00% 36 23 0.00% 37 29 0.00% 38 49 0.00% 39 33 0.00% 40 48 0.00% 41 57 0.00% 42 57 0.00% 43 52 0.00% 44 61 0.00% 45 67 0.00% 46 130 0.00% 47 98 0.00% 48 129 0.00% 49 205 0.00% 50 174 0.00% 51 217 0.00% 52 236 0.00% 53 233 0.00% 54 260 0.00% 55 323 0.00% 56 309 0.00% 57 390 0.00% 58 425 0.00% 59 513 0.00% 60 582 0.00% 61 758 0.01% 62 845 0.01% 63 919 0.01% 64 916 0.01% 65 1059 0.01% 66 1184 0.01% 67 1365 0.01% 68 1411 0.01% 69 1668 0.01% 70 1931 0.01% 71 2213 0.02% 72 2780 0.02% 73 3051 0.02% 74 3680 0.03% 75 4891 0.04% 76 9762 0.08% 77 8436 0.07% 78 5380 0.04% 79 5558 0.04% 80 6026 0.05% 81 6920 0.05% 82 7983 0.06% 83 8836 0.07% 84 10820 0.08% 85 11296 0.09% 86 11849 0.09% 87 12464 0.10% 88 13465 0.10% 89 14078 0.11% 90 15352 0.12% 91 17094 0.13% 92 18505 0.14% 93 20910 0.16% 94 22079 0.17% 95 23320 0.18% 96 24546 0.19% 97 25083 0.19% 98 25891 0.20% 99 27309 0.21% 100 29183 0.23% 101 30512 0.24% 102 33230 0.26% 103 35338 0.27% 104 37023 0.29% 105 38988 0.30% 106 40037 0.31% 107 41016 0.32% 108 42032 0.33% 109 42532 0.33% 110 44204 0.34% 111 45848 0.36% 112 48075 0.37% 113 50410 0.39% 114 52303 0.41% 115 54670 0.42% 116 56494 0.44% 117 57478 0.45% 118 58685 0.46% 119 58432 0.45% 120 60711 0.47% 121 62739 0.49% 122 63842 0.50% 123 66922 0.52% 124 70284 0.55% 125 71945 0.56% 126 74479 0.58% 127 76076 0.59% 128 78151 0.61% 129 80438 0.62% 130 82655 0.64% 131 84443 0.66% 132 87609 0.68% 133 92174 0.72% 134 96862 0.75% 135 102878 0.80% 136 107288 0.83% 137 112622 0.87% 138 118997 0.92% 139 125897 0.98% 140 132307 1.03% 141 141402 1.10% 142 155262 1.21% 143 172020 1.34% 144 198025 1.54% 145 231710 1.80% 146 285503 2.22% 147 376046 2.92% 148 547509 4.25% 149 999037 7.76% 150 3056191 23.73% 151 3582238 27.82% 12877427 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=40 prefix-density=0.39 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=89.75 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.1 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAA criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=19 prefix-density=0.51 prefix-fanout=2.8 sequence=TGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAAGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAAAGTACAGTTAGCTAGCCATGGCCTCCTCAAATCCTTTCTACAGGATCTCATTTGATGGCTAGTAATCTGTAAGTGTCTTGTATTTCCTGCTGCTTTGTTGGTTCCATTCCATGGAATTATGTATCTTTAATCGGAAGCTTGATTCTGCTTTTATGTTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=31.77 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.6 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7170859 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:34:22 Started mapping on | Feb 13 20:34:22 Finished on | Feb 13 20:35:36 Mapping speed, Million of reads per hour | 626.47 Number of input reads | 12877427 Average input read length | 284 UNIQUE READS: Uniquely mapped reads number | 12283134 Uniquely mapped reads % | 95.39% Average mapped length | 283.95 Number of splices: Total | 9619987 Number of splices: Annotated (sjdb) | 9389898 Number of splices: GT/AG | 9423634 Number of splices: GC/AG | 150685 Number of splices: AT/AC | 8220 Number of splices: Non-canonical | 37448 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 2.65 Insertion rate per base | 0.03% Insertion average length | 1.96 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 317268 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 27769 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.85% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 290120 290120 290120 N_multimapping 317268 317268 317268 N_noFeature 421738 11853969 569107 N_ambiguous 370816 1040 88709 UnstrandedReadsAssigned:11490580 PositiveStrandReadsAssigned:428125 NegativeStrandReadsAssigned:11625318 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=135 echo kmer=131 SRR7170859 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170859-trimmed-pair1.fastq SRR7170859-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,877,427 reads, 11,583,915 reads pseudoaligned [quant] estimated average fragment length: 202.742 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,251 rounds 52401 SRR7170859.ke.tsv 34699 SRR7170859.se.tsv 87100 total ==> SRR7170859.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1816.26 313 10.1049 Potri.005G024800.1.v4.1 1035 833.258 290 20.4073 Potri.004G059700.1.v4.1 961 759.27 14 1.08118 Potri.007G009000.2.v4.1 1416 1214.26 0 0 Potri.003G141000.2.v4.1 2943 2741.26 522 11.1657 Potri.016G087400.1.v4.1 270 98.9845 636.796 377.225 Potri.015G069301.1.v4.1 564 364.186 0 0 Potri.010G195200.1.v4.1 1773 1571.26 44 1.642 Potri.012G127500.1.v4.1 977 775.258 96 7.26092 ==> SRR7170859.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 214 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 492 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170859 completed mapping pipeline successfully