Starting /dee2/code/volunteer_pipeline.sh SRR7170860 current disk space = 3087423016960 free memory = 1470542512 SRR7170860 SRAfilesize 7329e36f60187a106c726fa847d1b02f SRR7170860.sra SRR7170860.sra file validated SRR7170860 is paired end SRR7170860 is conventional basespace SRR7170860 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170860_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7725 34.0 33.0 34.0 32.0 34.0 2 33.22475 34.0 33.0 34.0 32.0 34.0 3 33.24125 34.0 33.0 34.0 31.0 34.0 4 33.4875 34.0 34.0 34.0 33.0 34.0 5 33.48125 34.0 33.0 34.0 33.0 34.0 6 37.12725 38.0 37.0 38.0 36.0 38.0 7 37.433 38.0 38.0 38.0 37.0 38.0 8 37.5135 38.0 38.0 38.0 37.0 38.0 9 37.61625 38.0 38.0 38.0 38.0 38.0 10-14 37.58845 38.0 38.0 38.0 38.0 38.0 15-19 37.57295 38.0 38.0 38.0 38.0 38.0 20-24 37.50735 38.0 38.0 38.0 37.8 38.0 25-29 37.48004999999999 38.0 38.0 38.0 37.6 38.0 30-34 37.425650000000005 38.0 38.0 38.0 37.2 38.0 35-39 37.3466 38.0 38.0 38.0 37.2 38.0 40-44 37.216950000000004 38.0 38.0 38.0 36.8 38.0 45-49 37.23779999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.11710000000001 38.0 38.0 38.0 36.8 38.0 55-59 36.95905 38.0 38.0 38.0 36.0 38.0 60-64 36.8235 38.0 38.0 38.0 35.6 38.0 65-69 36.930600000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.8362 38.0 38.0 38.0 35.6 38.0 75-79 36.40265000000001 38.0 38.0 38.0 35.2 38.0 80-84 36.0819 38.0 38.0 38.0 34.0 38.0 85-89 35.9932 38.0 38.0 38.0 33.8 38.0 90-94 35.8073 38.0 38.0 38.0 33.4 38.0 95-99 35.69945 38.0 38.0 38.0 33.2 38.0 100-104 35.68865 38.0 37.6 38.0 33.0 38.0 105-109 35.50555000000001 38.0 37.2 38.0 32.4 38.0 110-114 35.4291 38.0 37.0 38.0 30.8 38.0 115-119 35.10625 38.0 36.4 38.0 29.6 38.0 120-124 34.9966 38.0 36.0 38.0 28.8 38.0 125-129 34.60145 38.0 35.8 38.0 26.6 38.0 130-134 34.1942 38.0 34.8 38.0 23.8 38.0 135-139 33.971250000000005 38.0 34.6 38.0 22.8 38.0 140-144 33.469049999999996 38.0 33.0 38.0 20.2 38.0 145-149 32.7059 38.0 33.0 38.0 14.6 38.0 150-151 28.3705 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 3.0 9 4.0 10 3.0 11 1.0 12 5.0 13 2.0 14 2.0 15 1.0 16 3.0 17 6.0 18 16.0 19 47.0 20 5.0 21 8.0 22 5.0 23 9.0 24 7.0 25 13.0 26 14.0 27 26.0 28 18.0 29 35.0 30 50.0 31 39.0 32 74.0 33 96.0 34 141.0 35 288.0 36 745.0 37 2333.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.959237691900476 15.802011646373742 12.96982530439386 28.26892535733192 2 20.625 19.3 33.650000000000006 26.424999999999997 3 16.625 25.900000000000002 32.7 24.775 4 19.525000000000002 31.825 26.125 22.525000000000002 5 22.0 35.699999999999996 24.7 17.599999999999998 6 18.625 35.525 27.275 18.575 7 12.75 25.924999999999997 43.0 18.325 8 16.025 26.924999999999997 30.875000000000004 26.174999999999997 9 17.724999999999998 25.900000000000002 32.5 23.875 10-14 19.009999999999998 31.19 26.87 22.93 15-19 18.790000000000003 29.915000000000003 27.96 23.335 20-24 18.995 30.485 27.99 22.53 25-29 19.189999999999998 30.345 27.805000000000003 22.66 30-34 18.32 30.64 28.365000000000002 22.675 35-39 18.995 29.94 27.6 23.465 40-44 18.935 29.970000000000002 27.685 23.41 45-49 19.42 29.755 28.115000000000002 22.71 50-54 20.285 29.595 27.435 22.685 55-59 18.72 29.849999999999998 28.03 23.400000000000002 60-64 19.46 29.244999999999997 28.050000000000004 23.244999999999997 65-69 19.29 30.919999999999998 27.025 22.765 70-74 19.005 30.819999999999997 26.99 23.185 75-79 19.03 31.269999999999996 27.245 22.455 80-84 18.975 30.45 27.375 23.200000000000003 85-89 19.225 30.509999999999998 26.935 23.330000000000002 90-94 19.314999999999998 29.45 27.92 23.315 95-99 19.475 29.409999999999997 27.46 23.655 100-104 19.77 29.455 26.900000000000002 23.875 105-109 20.035 29.470000000000002 27.029999999999998 23.465 110-114 19.8 29.56 26.924999999999997 23.715 115-119 20.544999999999998 29.325000000000003 26.889999999999997 23.24 120-124 20.880000000000003 29.505 26.090000000000003 23.525 125-129 20.07 30.049999999999997 25.745 24.135 130-134 20.615 28.62 26.195 24.57 135-139 20.064999999999998 28.939999999999998 26.415 24.58 140-144 20.275000000000002 28.599999999999998 25.985000000000003 25.14 145-149 20.630000000000003 28.904999999999998 25.705 24.759999999999998 150-151 20.65 28.175 26.6125 24.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 1.0 4 2.0 5 1.5 6 1.5 7 1.0 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 1.0 14 1.0 15 0.5 16 1.0 17 2.5 18 2.0 19 1.5 20 2.0 21 2.5 22 5.0 23 5.0 24 6.0 25 7.5 26 10.5 27 19.5 28 25.5 29 32.0 30 42.5 31 60.5 32 65.0 33 69.0 34 99.5 35 132.5 36 137.5 37 151.0 38 169.5 39 169.0 40 192.0 41 207.0 42 216.0 43 234.0 44 223.5 45 230.5 46 223.0 47 199.0 48 194.5 49 170.5 50 148.0 51 120.0 52 99.5 53 79.0 54 58.0 55 45.0 56 29.0 57 22.5 58 17.0 59 18.0 60 16.0 61 7.5 62 5.5 63 4.0 64 4.0 65 3.0 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.125 #Duplication Level Percentage of deduplicated Percentage of total 1 98.89317889317888 96.05 2 0.8236808236808236 1.6 3 0.18018018018018017 0.525 4 0.0 0.0 5 0.05148005148005148 0.25 6 0.0 0.0 7 0.02574002574002574 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02574002574002574 1.4000000000000001 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 56 1.4000000000000001 TruSeq Adapter, Index 8 (97% over 36bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTATG 7 0.17500000000000002 TruSeq Adapter, Index 8 (97% over 35bp) NATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 5 0.125 TruSeq Adapter, Index 3 (97% over 34bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.4625 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.7625 0.0 0.0 0.0 0.0 86-87 0.9 0.0 0.0 0.0 0.0 88-89 0.975 0.0 0.0 0.0 0.0 90-91 1.1124999999999998 0.0 0.0 0.0 0.0 92-93 1.2625 0.0 0.0 0.0 0.0 94-95 1.35 0.0 0.0 0.0 0.0 96-97 1.6124999999999998 0.0 0.0 0.0 0.0 98-99 1.9125 0.0 0.0 0.0 0.0 100-101 2.2375 0.0 0.0 0.0 0.0 102-103 2.6375 0.0 0.0 0.0 0.0 104-105 3.075 0.0 0.0 0.0 0.0 106-107 3.65 0.0 0.0 0.0 0.0 108-109 4.1875 0.0 0.0 0.0 0.0 110-111 4.625 0.0 0.0 0.0 0.0 112-113 5.1375 0.0 0.0 0.0 0.0 114-115 5.7125 0.0 0.0 0.0 0.0 116-117 6.475 0.0 0.0 0.0 0.0 118-119 7.1875 0.0 0.0 0.0 0.0 120-121 7.65 0.0 0.0 0.0 0.0 122-123 8.125 0.0 0.0 0.0 0.0 124-125 8.5625 0.0 0.0 0.0 0.0 126-127 9.4 0.0 0.0 0.0 0.0 128-129 9.8875 0.0 0.0 0.0 0.0 130-131 10.5375 0.0 0.0 0.0 0.0 132-133 11.0125 0.0 0.0 0.0 0.0 134-135 11.55 0.0 0.0 0.0 0.0 136-137 12.475 0.0 0.0 0.0 0.0 138-139 13.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATGGA 10 0.006836113 144.9625 5 AAAAAAA 230 0.0017867725 6.9329896 70-74 >>END_MODULE SRR7170860 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170860_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.016 33.0 33.0 34.0 32.0 34.0 2 33.03075 34.0 33.0 34.0 32.0 34.0 3 33.013 34.0 33.0 34.0 32.0 34.0 4 33.0205 34.0 33.0 34.0 33.0 34.0 5 32.98425 34.0 33.0 34.0 32.0 34.0 6 37.1925 38.0 38.0 38.0 37.0 38.0 7 37.21225 38.0 38.0 38.0 37.0 38.0 8 37.17375 38.0 38.0 38.0 37.0 38.0 9 37.13875 38.0 38.0 38.0 37.0 38.0 10-14 37.136399999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.190000000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.07895 38.0 38.0 38.0 37.0 38.0 25-29 37.0949 38.0 38.0 38.0 37.0 38.0 30-34 37.049 38.0 38.0 38.0 37.0 38.0 35-39 36.96625 38.0 38.0 38.0 36.8 38.0 40-44 37.0094 38.0 38.0 38.0 37.0 38.0 45-49 37.0165 38.0 38.0 38.0 37.0 38.0 50-54 37.0087 38.0 38.0 38.0 37.0 38.0 55-59 36.9638 38.0 38.0 38.0 36.4 38.0 60-64 36.910450000000004 38.0 38.0 38.0 36.2 38.0 65-69 36.84395000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.851400000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.8277 38.0 38.0 38.0 35.8 38.0 80-84 36.126549999999995 38.0 38.0 38.0 34.4 38.0 85-89 36.06804999999999 38.0 38.0 38.0 34.2 38.0 90-94 36.00645 38.0 38.0 38.0 34.2 38.0 95-99 35.8236 38.0 38.0 38.0 33.8 38.0 100-104 35.70465 38.0 38.0 38.0 33.4 38.0 105-109 35.6502 38.0 38.0 38.0 33.2 38.0 110-114 35.474399999999996 38.0 37.8 38.0 32.2 38.0 115-119 35.29725 38.0 37.0 38.0 31.4 38.0 120-124 35.064499999999995 38.0 37.0 38.0 29.6 38.0 125-129 34.70225 38.0 36.4 38.0 27.4 38.0 130-134 34.306799999999996 38.0 35.8 38.0 25.0 38.0 135-139 33.608 38.0 33.8 38.0 20.0 38.0 140-144 33.20235 38.0 33.0 38.0 18.2 38.0 145-149 32.4869 38.0 33.0 38.0 10.4 38.0 150-151 27.533125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 4.0 4 0.0 5 0.0 6 1.0 7 1.0 8 1.0 9 1.0 10 1.0 11 3.0 12 3.0 13 6.0 14 4.0 15 5.0 16 5.0 17 4.0 18 9.0 19 17.0 20 57.0 21 10.0 22 9.0 23 11.0 24 12.0 25 13.0 26 18.0 27 22.0 28 27.0 29 28.0 30 43.0 31 46.0 32 45.0 33 73.0 34 129.0 35 212.0 36 561.0 37 2607.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.075 22.6 13.325000000000001 21.0 2 27.900000000000002 25.275 29.349999999999998 17.474999999999998 3 22.55 25.2 34.4 17.849999999999998 4 26.0 32.0 22.075 19.925 5 24.8 35.425000000000004 22.925 16.85 6 22.35 35.275 23.525 18.85 7 18.95 22.025 39.775 19.25 8 21.75 26.0 27.325 24.925 9 22.5 25.3 28.175 24.025 10-14 24.02 28.349999999999998 26.840000000000003 20.79 15-19 24.060000000000002 27.04 28.535 20.365 20-24 23.69 28.199999999999996 27.975 20.135 25-29 24.01 29.080000000000002 27.16 19.75 30-34 23.335 28.29 28.565 19.81 35-39 23.03 26.995 29.549999999999997 20.424999999999997 40-44 23.805 27.950000000000003 28.439999999999998 19.805 45-49 22.915 27.37 28.835 20.880000000000003 50-54 23.36 27.765 28.595 20.28 55-59 23.72 26.965 28.565 20.75 60-64 23.595 27.055 28.845 20.505000000000003 65-69 22.925 27.515 29.26 20.3 70-74 23.064999999999998 28.544999999999998 28.15 20.24 75-79 22.725 29.395 28.04 19.84 80-84 22.74 29.15 28.24 19.869999999999997 85-89 23.244999999999997 28.555000000000003 28.175 20.025000000000002 90-94 23.56 28.185 28.544999999999998 19.71 95-99 23.345 28.34 28.599999999999998 19.715 100-104 24.135 27.744999999999997 28.23 19.89 105-109 23.575 28.075 28.235 20.115 110-114 23.73 28.675 27.889999999999997 19.705000000000002 115-119 24.16 28.74 27.87 19.23 120-124 24.349999999999998 28.64 27.700000000000003 19.31 125-129 24.88 28.465 27.82 18.834999999999997 130-134 24.81 28.560000000000002 27.41 19.220000000000002 135-139 25.44 28.175 27.115000000000002 19.27 140-144 25.28 27.474999999999998 27.884999999999998 19.36 145-149 25.805 28.095 27.18 18.92 150-151 25.25 28.1875 27.750000000000004 18.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 2.0 12 0.5 13 0.5 14 0.0 15 1.0 16 1.5 17 0.5 18 0.5 19 1.5 20 1.5 21 2.0 22 2.5 23 1.5 24 2.5 25 2.5 26 4.0 27 9.0 28 10.0 29 14.0 30 27.0 31 40.5 32 45.5 33 54.0 34 71.0 35 84.0 36 94.0 37 115.0 38 146.5 39 164.5 40 196.5 41 230.0 42 227.0 43 247.5 44 249.5 45 223.0 46 235.0 47 239.0 48 223.5 49 193.0 50 156.5 51 137.0 52 121.5 53 98.0 54 76.5 55 64.5 56 52.5 57 38.5 58 26.5 59 19.5 60 15.5 61 9.0 62 4.5 63 3.5 64 3.0 65 3.0 66 2.0 67 1.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.66117404737385 95.8 2 1.1071060762100926 2.15 3 0.18022657054582905 0.525 4 0.025746652935118432 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025746652935118432 1.425 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCT 57 1.425 Illumina Single End PCR Primer 1 (96% over 33bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.7250000000000001 0.0 0.0 0.0 0.0 86-87 0.85 0.0 0.0 0.0 0.0 88-89 0.925 0.0 0.0 0.0 0.0 90-91 1.0625 0.0 0.0 0.0 0.0 92-93 1.2375 0.0 0.0 0.0 0.0 94-95 1.325 0.0 0.0 0.0 0.0 96-97 1.575 0.0 0.0 0.0 0.0 98-99 1.8625 0.0 0.0 0.0 0.0 100-101 2.1875 0.0 0.0 0.0 0.0 102-103 2.5875000000000004 0.0 0.0 0.0 0.0 104-105 3.025 0.0 0.0 0.0 0.0 106-107 3.55 0.0 0.0 0.0 0.0 108-109 4.0375 0.0 0.0 0.0 0.0 110-111 4.5 0.0 0.0 0.0 0.0 112-113 4.9875 0.0 0.0 0.0 0.0 114-115 5.5 0.0 0.0 0.0 0.0 116-117 6.225 0.0 0.0 0.0 0.0 118-119 6.85 0.0 0.0 0.0 0.0 120-121 7.300000000000001 0.0 0.0 0.0 0.0 122-123 7.800000000000001 0.0 0.0 0.0 0.0 124-125 8.15 0.0 0.0 0.0 0.0 126-127 8.962499999999999 0.0 0.0 0.0 0.0 128-129 9.475000000000001 0.0 0.0 0.0 0.0 130-131 10.100000000000001 0.0 0.0 0.0 0.0 132-133 10.625 0.0 0.0 0.0 0.0 134-135 11.287500000000001 0.0 0.0 0.0 0.0 136-137 12.15 0.0 0.0 0.0 0.0 138-139 12.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGACG 10 0.006830828 145.0 1 AAAAAAA 145 1.4678336E-4 10.0 70-74 >>END_MODULE Read 875380 spots for SRR7170860.sra Written 875380 spots for SRR7170860.sra Read 875380 spots for SRR7170860.sra Written 875380 spots for SRR7170860.sra Read 875380 spots for SRR7170860.sra Written 875380 spots for SRR7170860.sra Read 875380 spots for SRR7170860.sra Written 875380 spots for SRR7170860.sra Read 875380 spots for SRR7170860.sra Written 875380 spots for SRR7170860.sra Read 875380 spots for SRR7170860.sra Written 875380 spots for SRR7170860.sra Read 875380 spots for SRR7170860.sra Written 875380 spots for SRR7170860.sra Read 875380 spots for SRR7170860.sra Written 875380 spots for SRR7170860.sra Read 875380 spots for SRR7170860.sra Written 875380 spots for SRR7170860.sra Read 875380 spots for SRR7170860.sra Written 875380 spots for SRR7170860.sra Read 875380 spots for SRR7170860.sra Written 875380 spots for SRR7170860.sra Read 875380 spots for SRR7170860.sra Written 875380 spots for SRR7170860.sra Read 875380 spots for SRR7170860.sra Written 875380 spots for SRR7170860.sra Read 875380 spots for SRR7170860.sra Written 875380 spots for SRR7170860.sra Read 875380 spots for SRR7170860.sra Written 875380 spots for SRR7170860.sra Read 875380 spots for SRR7170860.sra Written 875380 spots for SRR7170860.sra Read 875395 spots for SRR7170860.sra Written 875395 spots for SRR7170860.sra Read 875380 spots for SRR7170860.sra Written 875380 spots for SRR7170860.sra Read 875380 spots for SRR7170860.sra Written 875380 spots for SRR7170860.sra Read 875380 spots for SRR7170860.sra Written 875380 spots for SRR7170860.sra SRR ids: ['SRR7170860.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b7xw8gaf SRR7170860.sra spots: 17507615 blocks: [[1, 875380], [875381, 1750760], [1750761, 2626140], [2626141, 3501520], [3501521, 4376900], [4376901, 5252280], [5252281, 6127660], [6127661, 7003040], [7003041, 7878420], [7878421, 8753800], [8753801, 9629180], [9629181, 10504560], [10504561, 11379940], [11379941, 12255320], [12255321, 13130700], [13130701, 14006080], [14006081, 14881460], [14881461, 15756840], [15756841, 16632220], [16632221, 17507615]] SRR7170860 file size 5911055 SRR7170860 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170860 SRR7170860_1.fastq SRR7170860_2.fastq Input file: SRR7170860_1.fastq Paired file: SRR7170860_2.fastq trimmed: SRR7170860-trimmed-pair1.fastq, SRR7170860-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:48:44 2025 >> started Thu Feb 13 19:49:04 2025 >> done (19.831s) 17507615 read pairs processed; of these: 32456 ( 0.19%) short read pairs filtered out after trimming by size control 231141 ( 1.32%) empty read pairs filtered out after trimming by size control 17244018 (98.49%) read pairs available; of these: 11190332 (64.89%) trimmed read pairs available after processing 6053686 (35.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 32 0.00% 20 24 0.00% 21 14 0.00% 22 29 0.00% 23 46 0.00% 24 41 0.00% 25 45 0.00% 26 49 0.00% 27 45 0.00% 28 44 0.00% 29 37 0.00% 30 56 0.00% 31 39 0.00% 32 39 0.00% 33 44 0.00% 34 46 0.00% 35 55 0.00% 36 48 0.00% 37 57 0.00% 38 66 0.00% 39 63 0.00% 40 71 0.00% 41 85 0.00% 42 111 0.00% 43 104 0.00% 44 114 0.00% 45 123 0.00% 46 166 0.00% 47 191 0.00% 48 217 0.00% 49 245 0.00% 50 305 0.00% 51 358 0.00% 52 386 0.00% 53 451 0.00% 54 472 0.00% 55 516 0.00% 56 532 0.00% 57 656 0.00% 58 787 0.00% 59 879 0.01% 60 1080 0.01% 61 1162 0.01% 62 1316 0.01% 63 1552 0.01% 64 1611 0.01% 65 1631 0.01% 66 1802 0.01% 67 1966 0.01% 68 2181 0.01% 69 2479 0.01% 70 3017 0.02% 71 3543 0.02% 72 4198 0.02% 73 4762 0.03% 74 5730 0.03% 75 7205 0.04% 76 16489 0.10% 77 15640 0.09% 78 8764 0.05% 79 8647 0.05% 80 9137 0.05% 81 10302 0.06% 82 11600 0.07% 83 12865 0.07% 84 15264 0.09% 85 16401 0.10% 86 17681 0.10% 87 19121 0.11% 88 20056 0.12% 89 21122 0.12% 90 23110 0.13% 91 24160 0.14% 92 26590 0.15% 93 28712 0.17% 94 30158 0.17% 95 31896 0.18% 96 32550 0.19% 97 33051 0.19% 98 33863 0.20% 99 35170 0.20% 100 36884 0.21% 101 38499 0.22% 102 41703 0.24% 103 44286 0.26% 104 46079 0.27% 105 47933 0.28% 106 48909 0.28% 107 49304 0.29% 108 50052 0.29% 109 50684 0.29% 110 51934 0.30% 111 54351 0.32% 112 56692 0.33% 113 59559 0.35% 114 62364 0.36% 115 64362 0.37% 116 66930 0.39% 117 66392 0.39% 118 66796 0.39% 119 67575 0.39% 120 68679 0.40% 121 70301 0.41% 122 72932 0.42% 123 76817 0.45% 124 80163 0.46% 125 82126 0.48% 126 84900 0.49% 127 85880 0.50% 128 87216 0.51% 129 90665 0.53% 130 91231 0.53% 131 93759 0.54% 132 98629 0.57% 133 102421 0.59% 134 106186 0.62% 135 112736 0.65% 136 116376 0.67% 137 122881 0.71% 138 128570 0.75% 139 134876 0.78% 140 142637 0.83% 141 153125 0.89% 142 167632 0.97% 143 188567 1.09% 144 213882 1.24% 145 252026 1.46% 146 308784 1.79% 147 405069 2.35% 148 600487 3.48% 149 1131572 6.56% 150 4092624 23.73% 151 6053686 35.11% 17244018 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=18 prefix-density=0.75 prefix-fanout=2.4 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=59.99 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.0 sequence=TCAACAATTCTCGCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAATGATATTCATCTCCAA criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=24 prefix-density=0.54 prefix-fanout=1.9 sequence=CTACCCATGTTTGGATGCACTGAGGCATCTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=54.53 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.6 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT SRR7170860 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:49:51 Started mapping on | Feb 13 19:49:51 Finished on | Feb 13 19:53:07 Mapping speed, Million of reads per hour | 316.73 Number of input reads | 17244018 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 15667578 Uniquely mapped reads % | 90.86% Average mapped length | 285.57 Number of splices: Total | 11913881 Number of splices: Annotated (sjdb) | 11547505 Number of splices: GT/AG | 11657823 Number of splices: GC/AG | 193342 Number of splices: AT/AC | 12775 Number of splices: Non-canonical | 49941 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 2.66 Insertion rate per base | 0.03% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 433529 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 69274 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.12% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1176004 1176004 1176004 N_multimapping 433529 433529 433529 N_noFeature 747144 15294743 895147 N_ambiguous 348009 1338 122593 UnstrandedReadsAssigned:14572425 PositiveStrandReadsAssigned:371497 NegativeStrandReadsAssigned:14649838 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=142 echo kmer=137 SRR7170860 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170860-trimmed-pair1.fastq SRR7170860-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,244,018 reads, 14,771,225 reads pseudoaligned [quant] estimated average fragment length: 214.782 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52401 SRR7170860.ke.tsv 34699 SRR7170860.se.tsv 87100 total ==> SRR7170860.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1804.22 359 11.9543 Potri.005G024800.1.v4.1 1035 821.218 291 21.2889 Potri.004G059700.1.v4.1 961 747.257 18 1.44718 Potri.007G009000.2.v4.1 1416 1202.22 0 0 Potri.003G141000.2.v4.1 2943 2729.22 417 9.17947 Potri.016G087400.1.v4.1 270 97.8665 992 608.972 Potri.015G069301.1.v4.1 564 354.363 0 0 Potri.010G195200.1.v4.1 1773 1559.22 0 0 Potri.012G127500.1.v4.1 977 763.253 191 15.0344 ==> SRR7170860.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 665 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 625 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 29 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170860 completed mapping pipeline successfully