Starting /dee2/code/volunteer_pipeline.sh SRR7170861 current disk space = 3087397322752 free memory = 1410174068 SRR7170861 SRAfilesize cc211136cc483c401e1fb76e7a154c72 SRR7170861.sra SRR7170861.sra file validated SRR7170861 is paired end SRR7170861 is conventional basespace SRR7170861 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170861_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.192 34.0 33.0 34.0 32.0 34.0 2 33.1985 34.0 33.0 34.0 32.0 34.0 3 33.16575 34.0 33.0 34.0 32.0 34.0 4 33.14875 34.0 33.0 34.0 31.0 34.0 5 33.31325 34.0 33.0 34.0 33.0 34.0 6 36.7725 38.0 37.0 38.0 35.0 38.0 7 37.08375 38.0 38.0 38.0 36.0 38.0 8 37.18675 38.0 38.0 38.0 36.0 38.0 9 37.4065 38.0 38.0 38.0 37.0 38.0 10-14 37.32975 38.0 38.0 38.0 37.0 38.0 15-19 37.291250000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.1969 38.0 38.0 38.0 36.6 38.0 25-29 37.2203 38.0 38.0 38.0 36.6 38.0 30-34 37.0295 38.0 38.0 38.0 36.2 38.0 35-39 36.89965 38.0 38.0 38.0 35.8 38.0 40-44 36.854 38.0 38.0 38.0 35.6 38.0 45-49 36.776300000000006 38.0 38.0 38.0 35.4 38.0 50-54 36.55545 38.0 38.0 38.0 34.4 38.0 55-59 36.5018 38.0 38.0 38.0 34.0 38.0 60-64 36.30544999999999 38.0 38.0 38.0 33.8 38.0 65-69 36.29979999999999 38.0 38.0 38.0 33.8 38.0 70-74 36.114 38.0 37.4 38.0 33.4 38.0 75-79 35.8851 38.0 37.0 38.0 33.0 38.0 80-84 35.6143 38.0 37.0 38.0 31.0 38.0 85-89 35.544200000000004 38.0 37.0 38.0 31.0 38.0 90-94 35.400150000000004 38.0 37.0 38.0 30.2 38.0 95-99 35.201350000000005 38.0 36.6 38.0 29.0 38.0 100-104 34.753 38.0 35.8 38.0 27.4 38.0 105-109 34.2906 38.0 35.2 38.0 24.4 38.0 110-114 33.813100000000006 38.0 33.8 38.0 21.4 38.0 115-119 33.54205 38.0 33.4 38.0 18.6 38.0 120-124 33.293049999999994 38.0 33.0 38.0 17.2 38.0 125-129 32.40585 38.0 32.4 38.0 14.2 38.0 130-134 31.78895 37.4 30.4 38.0 13.4 38.0 135-139 30.961499999999994 36.6 28.2 38.0 12.6 38.0 140-144 30.470499999999998 36.2 28.2 38.0 9.6 38.0 145-149 28.772750000000002 36.0 25.2 38.0 2.0 38.0 150-151 22.32675 28.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 2.0 8 6.0 9 2.0 10 4.0 11 0.0 12 2.0 13 2.0 14 0.0 15 9.0 16 10.0 17 9.0 18 16.0 19 36.0 20 10.0 21 13.0 22 10.0 23 23.0 24 22.0 25 28.0 26 40.0 27 35.0 28 58.0 29 51.0 30 76.0 31 113.0 32 116.0 33 181.0 34 265.0 35 500.0 36 1041.0 37 1318.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.0357698289269 18.170036288232243 14.359771902540174 28.434421980300673 2 20.625 21.75 34.875 22.75 3 15.328832208052013 29.732433108277068 31.557889472368096 23.380845211302827 4 19.35 34.375 26.5 19.775000000000002 5 20.849999999999998 37.65 24.474999999999998 17.025000000000002 6 17.925 38.375 25.575 18.125 7 13.100000000000001 26.400000000000002 43.0 17.5 8 16.6 26.6 30.2 26.6 9 15.975 26.200000000000003 33.375 24.45 10-14 18.915000000000003 31.775 26.119999999999997 23.189999999999998 15-19 18.435000000000002 31.055 27.505000000000003 23.005 20-24 19.045 30.615 27.455000000000002 22.884999999999998 25-29 18.815 30.75 27.689999999999998 22.745 30-34 18.785 30.669999999999998 27.725 22.82 35-39 19.08 30.814999999999998 27.744999999999997 22.36 40-44 18.66 31.085 27.315 22.939999999999998 45-49 19.235 30.19 27.79 22.785 50-54 19.220000000000002 30.259999999999998 27.36 23.16 55-59 18.94 30.2 27.485 23.375 60-64 18.935 30.385 27.474999999999998 23.205000000000002 65-69 18.825 31.295 26.900000000000002 22.98 70-74 19.23 30.795 26.919999999999998 23.055 75-79 19.97 30.240000000000002 27.134999999999998 22.655 80-84 19.665 29.880000000000003 27.38 23.075000000000003 85-89 19.11 29.659999999999997 27.47 23.76 90-94 19.67 29.975 27.224999999999998 23.13 95-99 19.425 29.54 27.534999999999997 23.5 100-104 19.785 30.055 26.66 23.5 105-109 20.09 29.565 26.905 23.44 110-114 20.34 29.53 26.584999999999997 23.544999999999998 115-119 20.495 29.294999999999998 26.424999999999997 23.785 120-124 20.794999999999998 29.455 25.979999999999997 23.77 125-129 20.405 29.515 26.11 23.97 130-134 21.025 29.360000000000003 25.39 24.224999999999998 135-139 21.16 28.95 26.085 23.805 140-144 20.48 28.945 25.69 24.884999999999998 145-149 20.580000000000002 28.9 25.840000000000003 24.68 150-151 21.2875 28.4125 25.900000000000002 24.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 2.5 2 1.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 1.5 9 1.0 10 0.0 11 0.5 12 1.5 13 1.0 14 0.0 15 0.5 16 1.0 17 1.0 18 2.0 19 2.5 20 2.0 21 1.5 22 3.5 23 6.0 24 8.0 25 8.5 26 13.0 27 19.0 28 19.0 29 35.0 30 52.5 31 58.0 32 70.5 33 90.0 34 99.5 35 122.0 36 153.5 37 151.5 38 163.0 39 188.0 40 203.5 41 214.5 42 220.5 43 228.5 44 221.5 45 213.0 46 209.0 47 203.5 48 180.0 49 154.0 50 140.5 51 120.5 52 95.0 53 70.5 54 60.0 55 50.5 56 40.0 57 31.0 58 16.0 59 12.0 60 12.0 61 7.5 62 6.0 63 2.5 64 0.0 65 0.0 66 1.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.55 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.18492103922567 97.35000000000001 2 0.6367804381049414 1.25 3 0.1273560876209883 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05094243504839531 1.0250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 28 0.7000000000000001 TruSeq Adapter, Index 19 (97% over 38bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTATG 13 0.325 TruSeq Adapter, Index 19 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.5375 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.9125 0.0 0.0 0.0 0.0 92-93 1.125 0.0 0.0 0.0 0.0 94-95 1.375 0.0 0.0 0.0 0.0 96-97 1.6375000000000002 0.0 0.0 0.0 0.0 98-99 2.0 0.0 0.0 0.0 0.0 100-101 2.3375 0.0 0.0 0.0 0.0 102-103 2.7875 0.0 0.0 0.0 0.0 104-105 3.1624999999999996 0.0 0.0 0.0 0.0 106-107 3.65 0.0 0.0 0.0 0.0 108-109 4.2375 0.0 0.0 0.0 0.0 110-111 4.6875 0.0 0.0 0.0 0.0 112-113 5.325 0.0 0.0 0.0 0.0 114-115 6.025 0.0 0.0 0.0 0.0 116-117 6.75 0.0 0.0 0.0 0.0 118-119 7.6625 0.0 0.0 0.0 0.0 120-121 8.3625 0.0 0.0 0.0 0.0 122-123 9.025 0.0 0.0 0.0 0.0 124-125 9.787500000000001 0.0 0.0 0.0 0.0 126-127 10.8 0.0 0.0 0.0 0.0 128-129 11.6875 0.0 0.0 0.0 0.0 130-131 12.6375 0.0 0.0 0.0 0.0 132-133 13.4625 0.0 0.0 0.0 0.0 134-135 14.2625 0.0 0.0 0.0 0.0 136-137 14.9375 0.0 0.0 0.0 0.0 138-139 15.899999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACGGAGT 10 0.006836113 144.9625 3 >>END_MODULE SRR7170861 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170861_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.914 33.0 33.0 34.0 32.0 34.0 2 32.845 33.0 33.0 34.0 32.0 34.0 3 32.90475 34.0 33.0 34.0 32.0 34.0 4 32.84875 34.0 33.0 34.0 32.0 34.0 5 32.95875 34.0 33.0 34.0 32.0 34.0 6 37.015 38.0 38.0 38.0 37.0 38.0 7 37.14675 38.0 38.0 38.0 37.0 38.0 8 37.01825 38.0 38.0 38.0 37.0 38.0 9 37.06625 38.0 38.0 38.0 37.0 38.0 10-14 36.954750000000004 38.0 38.0 38.0 36.4 38.0 15-19 36.989149999999995 38.0 38.0 38.0 36.8 38.0 20-24 36.91 38.0 38.0 38.0 36.2 38.0 25-29 36.87405 38.0 38.0 38.0 36.0 38.0 30-34 36.82075 38.0 38.0 38.0 36.0 38.0 35-39 36.84855 38.0 38.0 38.0 36.0 38.0 40-44 36.86135 38.0 38.0 38.0 36.0 38.0 45-49 36.8481 38.0 38.0 38.0 36.0 38.0 50-54 36.764399999999995 38.0 38.0 38.0 35.8 38.0 55-59 36.7264 38.0 38.0 38.0 35.8 38.0 60-64 36.642700000000005 38.0 38.0 38.0 35.0 38.0 65-69 36.552350000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.46025 38.0 38.0 38.0 34.4 38.0 75-79 36.4405 38.0 38.0 38.0 34.6 38.0 80-84 36.03275 38.0 38.0 38.0 34.0 38.0 85-89 36.00435 38.0 38.0 38.0 34.0 38.0 90-94 35.77685 38.0 38.0 38.0 33.0 38.0 95-99 35.5133 38.0 37.2 38.0 31.6 38.0 100-104 35.40085 38.0 37.0 38.0 30.6 38.0 105-109 35.292649999999995 38.0 37.0 38.0 30.2 38.0 110-114 35.0673 38.0 37.0 38.0 28.8 38.0 115-119 34.766 38.0 36.0 38.0 27.6 38.0 120-124 34.36895 38.0 35.4 38.0 24.4 38.0 125-129 33.84735 38.0 34.4 38.0 21.8 38.0 130-134 33.3226 38.0 33.4 38.0 18.6 38.0 135-139 32.9044 38.0 33.0 38.0 14.2 38.0 140-144 32.01344999999999 38.0 32.8 38.0 12.8 38.0 145-149 30.93915 37.8 31.2 38.0 3.8 38.0 150-151 24.923625 32.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 5.0 4 4.0 5 0.0 6 2.0 7 4.0 8 1.0 9 2.0 10 0.0 11 2.0 12 6.0 13 6.0 14 6.0 15 6.0 16 7.0 17 7.0 18 9.0 19 20.0 20 27.0 21 11.0 22 19.0 23 16.0 24 14.0 25 28.0 26 26.0 27 30.0 28 39.0 29 36.0 30 49.0 31 69.0 32 67.0 33 88.0 34 151.0 35 312.0 36 787.0 37 2136.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.6 22.275 13.325000000000001 21.8 2 26.575 24.275 32.6 16.55 3 22.625 26.5 33.475 17.4 4 25.5 32.85 22.95 18.7 5 26.174999999999997 35.55 20.599999999999998 17.675 6 21.975 36.95 22.875 18.2 7 19.3 19.85 41.05 19.8 8 22.775000000000002 24.349999999999998 26.025 26.85 9 22.85 25.974999999999998 27.725 23.45 10-14 24.395 28.345 26.505000000000003 20.755000000000003 15-19 23.755000000000003 28.125 27.845 20.275000000000002 20-24 24.595 28.18 27.66 19.564999999999998 25-29 23.965 28.000000000000004 28.065 19.97 30-34 23.49 27.810000000000002 28.63 20.07 35-39 23.305 27.295 28.96 20.44 40-44 23.330000000000002 27.6 28.83 20.24 45-49 23.585 27.55 28.610000000000003 20.255000000000003 50-54 22.919999999999998 27.99 28.515 20.575 55-59 23.75 27.325 28.82 20.105 60-64 23.135 27.49 28.854999999999997 20.52 65-69 23.015 27.284999999999997 28.915000000000003 20.785 70-74 23.345 28.565 28.02 20.07 75-79 23.21 28.52 28.084999999999997 20.185 80-84 23.32 28.12 28.88 19.68 85-89 23.59 27.705000000000002 29.054999999999996 19.650000000000002 90-94 23.57 28.09 28.565 19.775000000000002 95-99 24.240000000000002 27.765 28.395 19.6 100-104 24.26 28.335 28.115000000000002 19.29 105-109 24.44 27.315 28.884999999999998 19.36 110-114 24.310000000000002 28.54 27.665 19.485 115-119 25.155 28.615000000000002 27.36 18.87 120-124 24.88 27.994999999999997 28.33 18.795 125-129 26.005 27.37 27.79 18.834999999999997 130-134 25.75 27.639999999999997 27.855 18.755 135-139 26.314999999999998 28.18 27.62 17.885 140-144 26.38 27.58 27.779999999999998 18.26 145-149 26.31 27.36 27.744999999999997 18.584999999999997 150-151 26.724999999999998 27.625 26.787499999999998 18.862499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 1.5 17 0.5 18 0.5 19 0.5 20 1.0 21 2.0 22 1.5 23 2.0 24 3.5 25 4.5 26 5.0 27 9.0 28 12.0 29 13.0 30 22.0 31 27.5 32 28.0 33 39.5 34 62.5 35 87.5 36 104.0 37 107.5 38 130.0 39 169.0 40 191.5 41 228.0 42 250.5 43 256.5 44 261.5 45 248.0 46 246.0 47 238.0 48 226.5 49 206.0 50 156.0 51 137.5 52 126.5 53 98.5 54 83.5 55 62.5 56 39.0 57 24.5 58 20.5 59 19.0 60 13.5 61 10.5 62 7.5 63 4.0 64 3.0 65 1.0 66 2.0 67 1.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36628643852978 98.0 2 0.4816223067173638 0.95 3 0.12674271229404308 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025348542458808618 0.675 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 27 0.675 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.23750000000000002 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 1.1125 0.0 0.0 0.0 0.0 94-95 1.35 0.0 0.0 0.0 0.0 96-97 1.6125 0.0 0.0 0.0 0.0 98-99 1.9874999999999998 0.0 0.0 0.0 0.0 100-101 2.3625 0.0 0.0 0.0 0.0 102-103 2.8625 0.0 0.0 0.0 0.0 104-105 3.225 0.0 0.0 0.0 0.0 106-107 3.675 0.0 0.0 0.0 0.0 108-109 4.275 0.0 0.0 0.0 0.0 110-111 4.762499999999999 0.0 0.0 0.0 0.0 112-113 5.375 0.0 0.0 0.0 0.0 114-115 6.0375 0.0 0.0 0.0 0.0 116-117 6.725 0.0 0.0 0.0 0.0 118-119 7.5875 0.0 0.0 0.0 0.0 120-121 8.3125 0.0 0.0 0.0 0.0 122-123 8.975 0.0 0.0 0.0 0.0 124-125 9.712499999999999 0.0 0.0 0.0 0.0 126-127 10.7625 0.0 0.0 0.0 0.0 128-129 11.725 0.0 0.0 0.0 0.0 130-131 12.6625 0.0 0.0 0.0 0.0 132-133 13.4625 0.0 0.0 0.0 0.0 134-135 14.2875 0.0 0.0 0.0 0.0 136-137 15.024999999999999 0.0 0.0 0.0 0.0 138-139 15.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 900843 spots for SRR7170861.sra Written 900843 spots for SRR7170861.sra Read 900843 spots for SRR7170861.sra Written 900843 spots for SRR7170861.sra Read 900843 spots for SRR7170861.sra Written 900843 spots for SRR7170861.sra Read 900843 spots for SRR7170861.sra Written 900843 spots for SRR7170861.sra Read 900843 spots for SRR7170861.sra Written 900843 spots for SRR7170861.sra Read 900843 spots for SRR7170861.sra Written 900843 spots for SRR7170861.sra Read 900843 spots for SRR7170861.sra Written 900843 spots for SRR7170861.sra Read 900843 spots for SRR7170861.sra Written 900843 spots for SRR7170861.sra Read 900843 spots for SRR7170861.sra Written 900843 spots for SRR7170861.sra Read 900843 spots for SRR7170861.sra Written 900843 spots for SRR7170861.sra Read 900843 spots for SRR7170861.sra Written 900843 spots for SRR7170861.sra Read 900843 spots for SRR7170861.sra Written 900843 spots for SRR7170861.sra Read 900843 spots for SRR7170861.sra Written 900843 spots for SRR7170861.sra Read 900843 spots for SRR7170861.sra Written 900843 spots for SRR7170861.sra Read 900861 spots for SRR7170861.sra Written 900861 spots for SRR7170861.sra Read 900843 spots for SRR7170861.sra Written 900843 spots for SRR7170861.sra Read 900843 spots for SRR7170861.sra Written 900843 spots for SRR7170861.sra Read 900843 spots for SRR7170861.sra Written 900843 spots for SRR7170861.sra Read 900843 spots for SRR7170861.sra Written 900843 spots for SRR7170861.sra Read 900843 spots for SRR7170861.sra Written 900843 spots for SRR7170861.sra SRR ids: ['SRR7170861.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0sacjqad SRR7170861.sra spots: 18016878 blocks: [[1, 900843], [900844, 1801686], [1801687, 2702529], [2702530, 3603372], [3603373, 4504215], [4504216, 5405058], [5405059, 6305901], [6305902, 7206744], [7206745, 8107587], [8107588, 9008430], [9008431, 9909273], [9909274, 10810116], [10810117, 11710959], [11710960, 12611802], [12611803, 13512645], [13512646, 14413488], [14413489, 15314331], [15314332, 16215174], [16215175, 17116017], [17116018, 18016878]] SRR7170861 file size 6083628 SRR7170861 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170861 SRR7170861_1.fastq SRR7170861_2.fastq Input file: SRR7170861_1.fastq Paired file: SRR7170861_2.fastq trimmed: SRR7170861-trimmed-pair1.fastq, SRR7170861-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:38:18 2025 >> started Thu Feb 13 19:38:52 2025 >> done (33.666s) 18016878 read pairs processed; of these: 45652 ( 0.25%) short read pairs filtered out after trimming by size control 211819 ( 1.18%) empty read pairs filtered out after trimming by size control 17759407 (98.57%) read pairs available; of these: 12962910 (72.99%) trimmed read pairs available after processing 4796497 (27.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 22 0.00% 19 19 0.00% 20 20 0.00% 21 41 0.00% 22 48 0.00% 23 42 0.00% 24 63 0.00% 25 62 0.00% 26 55 0.00% 27 49 0.00% 28 75 0.00% 29 78 0.00% 30 89 0.00% 31 104 0.00% 32 100 0.00% 33 81 0.00% 34 109 0.00% 35 101 0.00% 36 115 0.00% 37 73 0.00% 38 96 0.00% 39 117 0.00% 40 124 0.00% 41 155 0.00% 42 158 0.00% 43 163 0.00% 44 212 0.00% 45 208 0.00% 46 235 0.00% 47 250 0.00% 48 248 0.00% 49 362 0.00% 50 361 0.00% 51 463 0.00% 52 531 0.00% 53 521 0.00% 54 592 0.00% 55 642 0.00% 56 695 0.00% 57 793 0.00% 58 933 0.01% 59 1051 0.01% 60 1308 0.01% 61 1537 0.01% 62 1698 0.01% 63 1850 0.01% 64 2050 0.01% 65 2134 0.01% 66 2250 0.01% 67 2381 0.01% 68 2776 0.02% 69 3034 0.02% 70 3632 0.02% 71 4507 0.03% 72 5625 0.03% 73 6436 0.04% 74 7513 0.04% 75 10371 0.06% 76 26465 0.15% 77 22395 0.13% 78 11336 0.06% 79 10429 0.06% 80 11166 0.06% 81 12832 0.07% 82 14854 0.08% 83 16758 0.09% 84 19523 0.11% 85 20389 0.11% 86 21664 0.12% 87 22780 0.13% 88 23622 0.13% 89 25198 0.14% 90 27384 0.15% 91 29220 0.16% 92 32517 0.18% 93 35859 0.20% 94 37356 0.21% 95 38533 0.22% 96 38503 0.22% 97 38544 0.22% 98 39158 0.22% 99 40129 0.23% 100 42271 0.24% 101 45745 0.26% 102 50768 0.29% 103 54460 0.31% 104 57450 0.32% 105 59627 0.34% 106 59867 0.34% 107 59284 0.33% 108 58803 0.33% 109 58124 0.33% 110 60538 0.34% 111 63943 0.36% 112 68726 0.39% 113 73118 0.41% 114 77933 0.44% 115 80371 0.45% 116 80726 0.45% 117 81195 0.46% 118 79576 0.45% 119 79850 0.45% 120 81093 0.46% 121 83255 0.47% 122 88427 0.50% 123 94158 0.53% 124 100845 0.57% 125 104869 0.59% 126 107099 0.60% 127 107380 0.60% 128 108303 0.61% 129 109339 0.62% 130 110014 0.62% 131 113482 0.64% 132 120180 0.68% 133 128778 0.73% 134 137861 0.78% 135 146902 0.83% 136 153551 0.86% 137 160121 0.90% 138 166335 0.94% 139 174011 0.98% 140 184205 1.04% 141 197068 1.11% 142 214679 1.21% 143 242045 1.36% 144 280208 1.58% 145 329636 1.86% 146 399197 2.25% 147 517792 2.92% 148 746668 4.20% 149 1341459 7.55% 150 4135603 23.29% 151 4796497 27.01% 17759407 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=20 prefix-density=0.55 prefix-fanout=2.4 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=78.47 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=10.7 sequence=AAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAAC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=36 prefix-density=0.38 prefix-fanout=1.9 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=96.04 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.7 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAA SRR7170861 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:39:50 Started mapping on | Feb 13 19:39:50 Finished on | Feb 13 19:42:15 Mapping speed, Million of reads per hour | 440.92 Number of input reads | 17759407 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 16826427 Uniquely mapped reads % | 94.75% Average mapped length | 282.67 Number of splices: Total | 12265722 Number of splices: Annotated (sjdb) | 11949463 Number of splices: GT/AG | 12006775 Number of splices: GC/AG | 188355 Number of splices: AT/AC | 9507 Number of splices: Non-canonical | 61085 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.44 Insertion rate per base | 0.03% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 498255 % of reads mapped to multiple loci | 2.81% Number of reads mapped to too many loci | 34000 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.17% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 480253 480253 480253 N_multimapping 498255 498255 498255 N_noFeature 542681 16363006 709551 N_ambiguous 428260 1508 131207 UnstrandedReadsAssigned:15855486 PositiveStrandReadsAssigned:461913 NegativeStrandReadsAssigned:15985669 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=134 echo kmer=129 SRR7170861 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170861-trimmed-pair1.fastq SRR7170861-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,759,407 reads, 16,003,483 reads pseudoaligned [quant] estimated average fragment length: 201.008 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,373 rounds 52401 SRR7170861.ke.tsv 34699 SRR7170861.se.tsv 87100 total ==> SRR7170861.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1817.99 779 21.5968 Potri.005G024800.1.v4.1 1035 834.992 565 34.1043 Potri.004G059700.1.v4.1 961 760.999 10 0.662306 Potri.007G009000.2.v4.1 1416 1215.99 0 0 Potri.003G141000.2.v4.1 2943 2742.99 918 16.8679 Potri.016G087400.1.v4.1 270 100.467 949.633 476.403 Potri.015G069301.1.v4.1 564 366.129 0 0 Potri.010G195200.1.v4.1 1773 1572.99 326 10.4456 Potri.012G127500.1.v4.1 977 776.992 181 11.741 ==> SRR7170861.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 452 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 526 Potri.001G212900.v4.1 18 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 71 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR7170861 completed mapping pipeline successfully