Starting /dee2/code/volunteer_pipeline.sh SRR7170862 current disk space = 3087546662912 free memory = 1536885340 SRR7170862 SRAfilesize d93aa7e9bdaa83d7aaa66e9917cac3cb SRR7170862.sra SRR7170862.sra file validated SRR7170862 is paired end SRR7170862 is conventional basespace SRR7170862 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170862_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.968 34.0 33.0 34.0 33.0 34.0 2 33.30825 34.0 33.0 34.0 33.0 34.0 3 33.3055 34.0 33.0 34.0 33.0 34.0 4 33.29175 34.0 33.0 34.0 33.0 34.0 5 33.20675 34.0 33.0 34.0 33.0 34.0 6 36.78225 38.0 37.0 38.0 35.0 38.0 7 37.16925 38.0 38.0 38.0 36.0 38.0 8 37.381 38.0 38.0 38.0 37.0 38.0 9 37.4615 38.0 38.0 38.0 37.0 38.0 10-14 37.42465 38.0 38.0 38.0 37.0 38.0 15-19 37.3615 38.0 38.0 38.0 37.0 38.0 20-24 37.306200000000004 38.0 38.0 38.0 36.8 38.0 25-29 37.2603 38.0 38.0 38.0 37.0 38.0 30-34 37.177949999999996 38.0 38.0 38.0 36.8 38.0 35-39 37.1067 38.0 38.0 38.0 36.4 38.0 40-44 37.0147 38.0 38.0 38.0 35.8 38.0 45-49 36.8959 38.0 38.0 38.0 35.6 38.0 50-54 36.835950000000004 38.0 38.0 38.0 35.0 38.0 55-59 36.81999999999999 38.0 38.0 38.0 35.4 38.0 60-64 36.729499999999994 38.0 38.0 38.0 35.0 38.0 65-69 36.73755 38.0 38.0 38.0 34.8 38.0 70-74 36.576699999999995 38.0 38.0 38.0 34.6 38.0 75-79 36.091750000000005 38.0 38.0 38.0 33.6 38.0 80-84 36.08255 38.0 38.0 38.0 33.6 38.0 85-89 36.0733 38.0 38.0 38.0 33.8 38.0 90-94 35.9534 38.0 37.6 38.0 33.2 38.0 95-99 35.83175 38.0 37.2 38.0 33.0 38.0 100-104 35.5472 38.0 37.0 38.0 31.4 38.0 105-109 35.37284999999999 38.0 37.0 38.0 30.2 38.0 110-114 35.2683 38.0 36.6 38.0 29.6 38.0 115-119 35.056650000000005 38.0 36.0 38.0 28.6 38.0 120-124 34.6269 38.0 35.2 38.0 26.6 38.0 125-129 34.51675 38.0 35.6 38.0 25.6 38.0 130-134 33.77745 38.0 34.0 38.0 22.2 38.0 135-139 33.66035 38.0 33.8 38.0 21.6 38.0 140-144 33.21145 38.0 33.2 38.0 16.2 38.0 145-149 32.23585 38.0 32.8 38.0 10.8 38.0 150-151 27.520875 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 1.0 8 3.0 9 2.0 10 1.0 11 2.0 12 0.0 13 5.0 14 1.0 15 3.0 16 1.0 17 7.0 18 8.0 19 34.0 20 6.0 21 5.0 22 7.0 23 16.0 24 16.0 25 27.0 26 28.0 27 20.0 28 31.0 29 37.0 30 54.0 31 71.0 32 90.0 33 105.0 34 186.0 35 304.0 36 782.0 37 2146.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.44877308373387 18.391095370604603 11.105489501644321 28.054642044017204 2 21.375 21.6 32.85 24.175 3 16.575 30.049999999999997 30.325000000000003 23.05 4 19.325 33.050000000000004 26.224999999999998 21.4 5 20.1 36.55 24.825 18.525 6 19.175 36.6 25.624999999999996 18.6 7 13.900000000000002 24.8 42.449999999999996 18.85 8 17.65 26.075 29.599999999999998 26.674999999999997 9 17.875 25.074999999999996 31.724999999999998 25.324999999999996 10-14 19.125 31.16 25.679999999999996 24.035 15-19 19.21 30.354999999999997 27.310000000000002 23.125 20-24 18.94 30.490000000000002 27.800000000000004 22.770000000000003 25-29 19.13 29.915000000000003 27.305 23.65 30-34 19.32 29.73 27.900000000000002 23.05 35-39 19.35 30.365 27.295 22.99 40-44 19.52 29.995 27.11 23.375 45-49 20.13 29.13 27.49 23.25 50-54 20.145 29.535 26.939999999999998 23.380000000000003 55-59 19.36 29.535 27.58 23.525 60-64 19.975 28.970000000000002 27.68 23.375 65-69 19.62 29.9 26.895000000000003 23.585 70-74 19.865 30.095 26.83 23.21 75-79 19.650000000000002 29.68 27.284999999999997 23.385 80-84 19.665 29.520000000000003 26.900000000000002 23.915 85-89 20.22 29.275000000000002 26.72 23.785 90-94 20.23 29.470000000000002 27.235 23.064999999999998 95-99 19.96 29.28 26.815 23.945 100-104 20.9 29.42 26.195 23.485 105-109 20.62 29.099999999999998 26.525 23.755000000000003 110-114 21.23 28.395 26.85 23.525 115-119 21.305 28.77 26.05 23.875 120-124 20.544999999999998 28.804999999999996 26.179999999999996 24.47 125-129 21.2 28.43 26.165 24.205 130-134 21.11 28.575 25.474999999999998 24.84 135-139 21.279999999999998 28.845 25.3 24.575 140-144 21.535 28.49 25.545 24.43 145-149 21.584999999999997 27.505000000000003 26.255 24.654999999999998 150-151 20.7625 28.1125 26.2125 24.9125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 2.0 2 1.0 3 0.5 4 1.0 5 1.0 6 1.0 7 0.5 8 0.0 9 1.0 10 1.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 1.0 19 1.5 20 1.0 21 1.5 22 2.5 23 4.5 24 6.5 25 7.5 26 10.0 27 13.0 28 15.0 29 26.0 30 45.0 31 54.5 32 62.0 33 71.5 34 79.0 35 107.0 36 129.5 37 130.0 38 143.5 39 163.0 40 179.5 41 188.5 42 200.5 43 210.0 44 222.0 45 226.5 46 218.5 47 216.5 48 215.0 49 220.0 50 180.0 51 134.5 52 110.5 53 90.5 54 81.0 55 62.0 56 46.0 57 33.0 58 22.5 59 17.5 60 15.5 61 9.0 62 4.5 63 2.5 64 0.5 65 0.5 66 0.0 67 0.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.01341589267287 94.975 2 1.6511867905056758 3.2 3 0.23219814241486067 0.675 4 0.07739938080495357 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025799793601651185 0.8500000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTAT 34 0.8500000000000001 TruSeq Adapter, Index 7 (97% over 38bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.11249999999999999 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.38749999999999996 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.5875 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.9750000000000001 0.0 0.0 0.0 0.0 90-91 1.1625 0.0 0.0 0.0 0.0 92-93 1.4874999999999998 0.0 0.0 0.0 0.0 94-95 1.8125 0.0 0.0 0.0 0.0 96-97 2.1375 0.0 0.0 0.0 0.0 98-99 2.5374999999999996 0.0 0.0 0.0 0.0 100-101 2.95 0.0 0.0 0.0 0.0 102-103 3.25 0.0 0.0 0.0 0.0 104-105 3.7125000000000004 0.0 0.0 0.0 0.0 106-107 4.35 0.0 0.0 0.0 0.0 108-109 4.8125 0.0 0.0 0.0 0.0 110-111 5.525 0.0 0.0 0.0 0.0 112-113 6.262499999999999 0.0 0.0 0.0 0.0 114-115 7.0125 0.0 0.0 0.0 0.0 116-117 7.575 0.0 0.0 0.0 0.0 118-119 8.25 0.0 0.0 0.0 0.0 120-121 8.75 0.0 0.0 0.0 0.0 122-123 9.475000000000001 0.0 0.0 0.0 0.0 124-125 10.3875 0.0 0.0 0.0 0.0 126-127 11.2625 0.0 0.0 0.0 0.0 128-129 12.3875 0.0 0.0 0.0 0.0 130-131 13.149999999999999 0.0 0.0 0.0 0.0 132-133 13.925 0.0 0.0 0.0 0.0 134-135 14.774999999999999 0.0 0.0 0.0 0.0 136-137 15.837499999999999 0.0 0.0 0.0 0.0 138-139 16.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTCG 10 0.006830828 145.0 6 CAGACGT 10 0.006830828 145.0 3 >>END_MODULE SRR7170862 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170862_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9085 33.0 33.0 34.0 32.0 34.0 2 32.969 34.0 33.0 34.0 32.0 34.0 3 32.92925 34.0 33.0 34.0 32.0 34.0 4 32.86925 34.0 33.0 34.0 32.0 34.0 5 32.914 34.0 33.0 34.0 33.0 34.0 6 37.02575 38.0 38.0 38.0 37.0 38.0 7 37.0325 38.0 38.0 38.0 37.0 38.0 8 37.051 38.0 38.0 38.0 37.0 38.0 9 37.048 38.0 38.0 38.0 37.0 38.0 10-14 37.006949999999996 38.0 38.0 38.0 37.0 38.0 15-19 36.95835 38.0 38.0 38.0 37.0 38.0 20-24 36.947799999999994 38.0 38.0 38.0 37.0 38.0 25-29 36.924749999999996 38.0 38.0 38.0 37.0 38.0 30-34 36.8695 38.0 38.0 38.0 37.0 38.0 35-39 36.844 38.0 38.0 38.0 36.8 38.0 40-44 36.81575 38.0 38.0 38.0 36.6 38.0 45-49 36.82095 38.0 38.0 38.0 36.6 38.0 50-54 36.869600000000005 38.0 38.0 38.0 37.0 38.0 55-59 36.74804999999999 38.0 38.0 38.0 36.4 38.0 60-64 36.660199999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.67725 38.0 38.0 38.0 36.0 38.0 70-74 36.627 38.0 38.0 38.0 36.0 38.0 75-79 36.49855 38.0 38.0 38.0 35.4 38.0 80-84 36.161899999999996 38.0 38.0 38.0 34.6 38.0 85-89 36.076800000000006 38.0 38.0 38.0 34.4 38.0 90-94 35.96355 38.0 38.0 38.0 34.0 38.0 95-99 35.903999999999996 38.0 38.0 38.0 33.8 38.0 100-104 35.75705000000001 38.0 38.0 38.0 33.6 38.0 105-109 35.6174 38.0 38.0 38.0 33.0 38.0 110-114 35.29915 38.0 37.6 38.0 30.2 38.0 115-119 35.081399999999995 38.0 37.0 38.0 28.8 38.0 120-124 34.868399999999994 38.0 36.4 38.0 28.4 38.0 125-129 34.56105 38.0 36.0 38.0 26.0 38.0 130-134 34.2932 38.0 36.0 38.0 24.4 38.0 135-139 33.537850000000006 38.0 34.4 38.0 19.8 38.0 140-144 33.28555 38.0 33.4 38.0 16.2 38.0 145-149 32.575300000000006 38.0 33.0 38.0 11.0 38.0 150-151 27.435125 34.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 8.0 4 3.0 5 5.0 6 3.0 7 2.0 8 3.0 9 4.0 10 2.0 11 0.0 12 3.0 13 6.0 14 1.0 15 5.0 16 4.0 17 6.0 18 8.0 19 14.0 20 35.0 21 13.0 22 12.0 23 9.0 24 11.0 25 18.0 26 18.0 27 27.0 28 29.0 29 31.0 30 45.0 31 44.0 32 67.0 33 78.0 34 100.0 35 206.0 36 565.0 37 2597.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.425 20.974999999999998 11.55 20.05 2 27.250000000000004 23.575 31.125000000000004 18.05 3 23.400000000000002 27.400000000000002 32.2 17.0 4 24.099999999999998 33.85 22.775000000000002 19.275000000000002 5 24.65 37.275000000000006 20.3 17.775 6 22.942206654991242 36.22717037778334 22.742056542406804 18.088566424818612 7 19.88991743807856 21.916437327995997 37.60320240180135 20.590442832124094 8 21.905476369092273 25.731432858214554 25.78144536134033 26.581645411352838 9 22.892169126845133 25.969477107830873 26.720040030022517 24.418313735301474 10-14 24.170544963218735 28.534254115998596 25.611770004503832 21.683430916278837 15-19 23.606245621058953 28.25042538284456 27.299569612651386 20.8437593834451 20-24 23.724655819774718 27.909887359198997 27.27909887359199 21.08635794743429 25-29 24.154686169413413 28.34744276912288 27.63612683464409 19.861744226819617 30-34 23.76039266753481 28.122808774917356 27.85234899328859 20.26444956425924 35-39 23.215627347858753 27.493112947658403 27.938893062860004 21.35236664162284 40-44 23.68473794969436 28.02886060727528 27.362461168453756 20.923940274576612 45-49 23.207575529836163 27.83205571421414 27.877148153715115 21.083220602234583 50-54 23.305785123966942 27.858752817430503 28.079138492361633 20.756323566240923 55-59 23.49699398797595 27.354709418837675 27.675350701402806 21.472945891783567 60-64 22.852276711917046 27.18529279166458 28.40254470770926 21.559885788709114 65-69 22.992536191955118 27.59104343034614 28.172118419075286 21.244301958623453 70-74 23.009470361276747 27.894974194518213 28.220674450067644 20.874880994137396 75-79 23.721000150323196 28.315879140151324 27.664478629052464 20.298642080473016 80-84 23.090799759470837 28.302264982962516 27.680897975546202 20.926037282020445 85-89 23.672344689378757 27.970941883767537 27.950901803607213 20.405811623246493 90-94 24.130500150345796 27.94928335170893 27.618522601984562 20.30169389596071 95-99 23.85224538893344 27.771651964715318 28.07738572574178 20.298716920609465 100-104 24.104054934589744 27.45225803217884 28.128915843817353 20.314771189414063 105-109 24.045112781954884 27.44862155388471 28.040100250626566 20.466165413533837 110-114 24.799478644475638 27.52155604571887 27.857429316222177 19.821535993583318 115-119 26.03289209787405 27.93822703569996 26.925391095066185 19.103489771359808 120-124 25.502581841880982 28.80132350729433 26.219481626309722 19.476613024514965 125-129 25.228161668839633 27.78056363454017 27.69531641761107 19.295958279009128 130-134 26.227124592629732 27.781398846828782 27.365254449736774 18.62622211080471 135-139 26.791355362783936 28.014842300556587 26.72616958331244 18.467632753347036 140-144 26.759574894726292 27.777220774012434 27.03529175857229 18.427912572688992 145-149 26.671679197994987 27.939849624060148 26.80701754385965 18.581453634085214 150-151 27.112058159939835 27.813988468287793 26.29731762346453 18.776635748307847 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 2.0 4 1.5 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 0.5 19 0.0 20 1.0 21 4.0 22 5.5 23 3.5 24 4.0 25 5.0 26 5.0 27 8.0 28 11.0 29 13.0 30 16.0 31 24.5 32 26.0 33 36.0 34 57.5 35 72.5 36 89.5 37 107.0 38 120.5 39 156.5 40 179.0 41 182.0 42 212.5 43 228.0 44 242.0 45 253.0 46 244.5 47 245.5 48 231.0 49 211.5 50 194.0 51 162.5 52 139.0 53 123.5 54 101.0 55 81.5 56 63.0 57 41.0 58 28.0 59 19.0 60 10.5 61 7.5 62 7.5 63 5.0 64 3.5 65 2.5 66 2.0 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.075 8 0.025 9 0.075 10-14 0.08499999999999999 15-19 0.09 20-24 0.125 25-29 0.185 30-34 0.16999999999999998 35-39 0.17500000000000002 40-44 0.21 45-49 0.20500000000000002 50-54 0.17500000000000002 55-59 0.2 60-64 0.185 65-69 0.185 70-74 0.215 75-79 0.215 80-84 0.22 85-89 0.2 90-94 0.22999999999999998 95-99 0.24 100-104 0.245 105-109 0.25 110-114 0.26 115-119 0.27999999999999997 120-124 0.265 125-129 0.29 130-134 0.27499999999999997 135-139 0.28500000000000003 140-144 0.26 145-149 0.25 150-151 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.27319587628865 95.325 2 1.4175257731958764 2.75 3 0.15463917525773196 0.44999999999999996 4 0.051546391752577324 0.2 5 0.051546391752577324 0.25 6 0.0 0.0 7 0.025773195876288662 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025773195876288662 0.8500000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 34 0.8500000000000001 Illumina Single End PCR Primer 1 (97% over 34bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit GTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTG 5 0.125 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.5 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.975 0.0 0.0 0.0 0.0 90-91 1.1375 0.0 0.0 0.0 0.0 92-93 1.4625 0.0 0.0 0.0 0.0 94-95 1.7875 0.0 0.0 0.0 0.0 96-97 2.1375 0.0 0.0 0.0 0.0 98-99 2.525 0.0 0.0 0.0 0.0 100-101 2.9000000000000004 0.0 0.0 0.0 0.0 102-103 3.2 0.0 0.0 0.0 0.0 104-105 3.6624999999999996 0.0 0.0 0.0 0.0 106-107 4.2875 0.0 0.0 0.0 0.0 108-109 4.800000000000001 0.0 0.0 0.0 0.0 110-111 5.575 0.0 0.0 0.0 0.0 112-113 6.3375 0.0 0.0 0.0 0.0 114-115 7.1 0.0 0.0 0.0 0.0 116-117 7.6875 0.0 0.0 0.0 0.0 118-119 8.3875 0.0 0.0 0.0 0.0 120-121 8.8625 0.0 0.0 0.0 0.0 122-123 9.6125 0.0 0.0 0.0 0.0 124-125 10.55 0.0 0.0 0.0 0.0 126-127 11.4375 0.0 0.0 0.0 0.0 128-129 12.5 0.0 0.0 0.0 0.0 130-131 13.2375 0.0 0.0 0.0 0.0 132-133 14.0 0.0 0.0 0.0 0.0 134-135 14.8625 0.0 0.0 0.0 0.0 136-137 15.8625 0.0 0.0 0.0 0.0 138-139 16.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 436364 spots for SRR7170862.sra Written 436364 spots for SRR7170862.sra Read 436364 spots for SRR7170862.sra Written 436364 spots for SRR7170862.sra Read 436364 spots for SRR7170862.sra Written 436364 spots for SRR7170862.sra Read 436364 spots for SRR7170862.sra Written 436364 spots for SRR7170862.sra Read 436364 spots for SRR7170862.sra Written 436364 spots for SRR7170862.sra Read 436364 spots for SRR7170862.sra Written 436364 spots for SRR7170862.sra Read 436364 spots for SRR7170862.sra Written 436364 spots for SRR7170862.sra Read 436364 spots for SRR7170862.sra Written 436364 spots for SRR7170862.sra Read 436364 spots for SRR7170862.sra Written 436364 spots for SRR7170862.sra Read 436364 spots for SRR7170862.sra Written 436364 spots for SRR7170862.sra Read 436364 spots for SRR7170862.sra Written 436364 spots for SRR7170862.sra Read 436364 spots for SRR7170862.sra Written 436364 spots for SRR7170862.sra Read 436364 spots for SRR7170862.sra Written 436364 spots for SRR7170862.sra Read 436364 spots for SRR7170862.sra Written 436364 spots for SRR7170862.sra Read 436367 spots for SRR7170862.sra Written 436367 spots for SRR7170862.sra Read 436364 spots for SRR7170862.sra Written 436364 spots for SRR7170862.sra Read 436364 spots for SRR7170862.sra Written 436364 spots for SRR7170862.sra Read 436364 spots for SRR7170862.sra Written 436364 spots for SRR7170862.sra Read 436364 spots for SRR7170862.sra Written 436364 spots for SRR7170862.sra Read 436364 spots for SRR7170862.sra Written 436364 spots for SRR7170862.sra SRR ids: ['SRR7170862.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_meonxvld SRR7170862.sra spots: 8727283 blocks: [[1, 436364], [436365, 872728], [872729, 1309092], [1309093, 1745456], [1745457, 2181820], [2181821, 2618184], [2618185, 3054548], [3054549, 3490912], [3490913, 3927276], [3927277, 4363640], [4363641, 4800004], [4800005, 5236368], [5236369, 5672732], [5672733, 6109096], [6109097, 6545460], [6545461, 6981824], [6981825, 7418188], [7418189, 7854552], [7854553, 8290916], [8290917, 8727283]] SRR7170862 file size 2938175 SRR7170862 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170862 SRR7170862_1.fastq SRR7170862_2.fastq Input file: SRR7170862_1.fastq Paired file: SRR7170862_2.fastq trimmed: SRR7170862-trimmed-pair1.fastq, SRR7170862-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:58:08 2025 >> started Thu Feb 13 19:58:19 2025 >> done (11.393s) 8727283 read pairs processed; of these: 23135 ( 0.27%) short read pairs filtered out after trimming by size control 96711 ( 1.11%) empty read pairs filtered out after trimming by size control 8607437 (98.63%) read pairs available; of these: 5792058 (67.29%) trimmed read pairs available after processing 2815379 (32.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 9 0.00% 21 18 0.00% 22 21 0.00% 23 26 0.00% 24 31 0.00% 25 29 0.00% 26 25 0.00% 27 36 0.00% 28 32 0.00% 29 34 0.00% 30 30 0.00% 31 32 0.00% 32 47 0.00% 33 34 0.00% 34 35 0.00% 35 34 0.00% 36 37 0.00% 37 42 0.00% 38 68 0.00% 39 65 0.00% 40 51 0.00% 41 61 0.00% 42 54 0.00% 43 69 0.00% 44 87 0.00% 45 76 0.00% 46 104 0.00% 47 98 0.00% 48 119 0.00% 49 160 0.00% 50 161 0.00% 51 196 0.00% 52 218 0.00% 53 232 0.00% 54 260 0.00% 55 302 0.00% 56 285 0.00% 57 336 0.00% 58 390 0.00% 59 463 0.01% 60 536 0.01% 61 640 0.01% 62 776 0.01% 63 883 0.01% 64 923 0.01% 65 952 0.01% 66 943 0.01% 67 1055 0.01% 68 1221 0.01% 69 1460 0.02% 70 1758 0.02% 71 2006 0.02% 72 2558 0.03% 73 2931 0.03% 74 3210 0.04% 75 4263 0.05% 76 10756 0.12% 77 9411 0.11% 78 4846 0.06% 79 4815 0.06% 80 5351 0.06% 81 6282 0.07% 82 7208 0.08% 83 8070 0.09% 84 9858 0.11% 85 10211 0.12% 86 10334 0.12% 87 10786 0.13% 88 11445 0.13% 89 11700 0.14% 90 12935 0.15% 91 14556 0.17% 92 16258 0.19% 93 17655 0.21% 94 18445 0.21% 95 18874 0.22% 96 19109 0.22% 97 18981 0.22% 98 19114 0.22% 99 19742 0.23% 100 20895 0.24% 101 22807 0.26% 102 25676 0.30% 103 27381 0.32% 104 29067 0.34% 105 29537 0.34% 106 29935 0.35% 107 29330 0.34% 108 28828 0.33% 109 29558 0.34% 110 29977 0.35% 111 31947 0.37% 112 34307 0.40% 113 36538 0.42% 114 38587 0.45% 115 40091 0.47% 116 40202 0.47% 117 40153 0.47% 118 39208 0.46% 119 38703 0.45% 120 39298 0.46% 121 40589 0.47% 122 42984 0.50% 123 46492 0.54% 124 48775 0.57% 125 49922 0.58% 126 51523 0.60% 127 50809 0.59% 128 50463 0.59% 129 50669 0.59% 130 50525 0.59% 131 51498 0.60% 132 53927 0.63% 133 58085 0.67% 134 61565 0.72% 135 65153 0.76% 136 66608 0.77% 137 68932 0.80% 138 70884 0.82% 139 72996 0.85% 140 75248 0.87% 141 80220 0.93% 142 87076 1.01% 143 98671 1.15% 144 112957 1.31% 145 131816 1.53% 146 160858 1.87% 147 208715 2.42% 148 298646 3.47% 149 536912 6.24% 150 1939237 22.53% 151 2815379 32.71% 8607437 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=35 prefix-density=0.93 prefix-fanout=1.4 sequence=GTAATGTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCGTTGAATGGTGCAACCATGTTGGCCTGTGCAGGGGTGCGGTTAACTGTGGCAACGGCCGCCGATGAAATCACAGAGGAAGCCATCTCTTACAGGCTACTTAGCTATTACACCCTCTATATGTGGTTTTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=45 fanout-score=35.65 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.5 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACAT criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=31 prefix-density=0.58 prefix-fanout=2.6 sequence=ACAAGCCAACATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=40.82 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.1 sequence=GAAAGAGATGAGGCCTAACGTAAGTATTGAATTCCTCTGGTGGCTCTCTTTAACTATCCTGCTGGTTTCTGTGATCACATCTACTTCTACAGCTGCCTTTCTTGAAAGCAACTCGAGCCCCATTTTCAATGCCACAATCGGTGAAGGTAATGAAGAGGAGTTCTCTATGGAATCTGAAGTGCATCAGAGACTGCTGGCCTATCCGGGTAATCATATTAACTATAAGACTTTAGAACGACAACAAGTTTGCAATGCACAAATGTATGGCAGCTGT SRR7170862 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:59:05 Started mapping on | Feb 13 19:59:05 Finished on | Feb 13 20:00:09 Mapping speed, Million of reads per hour | 484.17 Number of input reads | 8607437 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 8165329 Uniquely mapped reads % | 94.86% Average mapped length | 283.28 Number of splices: Total | 6542101 Number of splices: Annotated (sjdb) | 6391333 Number of splices: GT/AG | 6405630 Number of splices: GC/AG | 105622 Number of splices: AT/AC | 6631 Number of splices: Non-canonical | 24218 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.03% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 260087 % of reads mapped to multiple loci | 3.02% Number of reads mapped to too many loci | 30087 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.68% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 203597 203597 203597 N_multimapping 260087 260087 260087 N_noFeature 215756 7980605 274019 N_ambiguous 215140 514 88394 UnstrandedReadsAssigned:7734433 PositiveStrandReadsAssigned:184210 NegativeStrandReadsAssigned:7802916 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=135 echo kmer=131 SRR7170862 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170862-trimmed-pair1.fastq SRR7170862-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,607,437 reads, 7,874,871 reads pseudoaligned [quant] estimated average fragment length: 196.938 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52401 SRR7170862.ke.tsv 34699 SRR7170862.se.tsv 87100 total ==> SRR7170862.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1822.06 140 6.7622 Potri.005G024800.1.v4.1 1035 839.062 311 32.6204 Potri.004G059700.1.v4.1 961 765.067 5 0.575166 Potri.007G009000.2.v4.1 1416 1220.06 0 0 Potri.003G141000.2.v4.1 2943 2747.06 121.139 3.88095 Potri.016G087400.1.v4.1 270 102.194 589 507.241 Potri.015G069301.1.v4.1 564 370.036 0 0 Potri.010G195200.1.v4.1 1773 1577.06 11 0.613857 Potri.012G127500.1.v4.1 977 781.062 394 44.395 ==> SRR7170862.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 242 Potri.001G212900.v4.1 28 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7170862 completed mapping pipeline successfully