Starting /dee2/code/volunteer_pipeline.sh SRR7170863 current disk space = 3087625084928 free memory = 1460089044 SRR7170863 SRAfilesize 61550391862356785d753ac00d20ba54 SRR7170863.sra SRR7170863.sra file validated SRR7170863 is paired end SRR7170863 is conventional basespace SRR7170863 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170863_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.871 34.0 33.0 34.0 32.0 34.0 2 33.2865 34.0 33.0 34.0 33.0 34.0 3 33.27 34.0 33.0 34.0 33.0 34.0 4 33.32075 34.0 33.0 34.0 33.0 34.0 5 33.368 34.0 33.0 34.0 33.0 34.0 6 36.693 38.0 37.0 38.0 35.0 38.0 7 37.16975 38.0 38.0 38.0 36.0 38.0 8 37.35225 38.0 38.0 38.0 37.0 38.0 9 37.445 38.0 38.0 38.0 37.0 38.0 10-14 37.418350000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.34205 38.0 38.0 38.0 37.0 38.0 20-24 37.26465 38.0 38.0 38.0 36.8 38.0 25-29 37.290800000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.24235 38.0 38.0 38.0 36.8 38.0 35-39 37.1904 38.0 38.0 38.0 36.4 38.0 40-44 37.068200000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.962900000000005 38.0 38.0 38.0 35.8 38.0 50-54 36.75995 38.0 38.0 38.0 34.8 38.0 55-59 36.811899999999994 38.0 38.0 38.0 35.0 38.0 60-64 36.79600000000001 38.0 38.0 38.0 35.0 38.0 65-69 36.71445 38.0 38.0 38.0 34.8 38.0 70-74 36.65815 38.0 38.0 38.0 34.2 38.0 75-79 36.18065 38.0 38.0 38.0 34.0 38.0 80-84 35.8749 38.0 37.2 38.0 33.0 38.0 85-89 35.85 38.0 37.2 38.0 32.8 38.0 90-94 35.6971 38.0 37.0 38.0 32.4 38.0 95-99 35.58505 38.0 37.0 38.0 31.8 38.0 100-104 35.482800000000005 38.0 37.0 38.0 31.0 38.0 105-109 35.07345 38.0 36.2 38.0 28.8 38.0 110-114 34.8292 38.0 36.0 38.0 27.6 38.0 115-119 34.47225 38.0 35.2 38.0 25.8 38.0 120-124 34.165049999999994 38.0 34.2 38.0 24.4 38.0 125-129 33.7616 38.0 33.2 38.0 22.6 38.0 130-134 33.16585 38.0 33.0 38.0 17.0 38.0 135-139 32.4867 38.0 32.8 38.0 14.0 38.0 140-144 31.681400000000004 37.8 30.8 38.0 12.8 38.0 145-149 30.7168 37.4 29.8 38.0 5.8 38.0 150-151 24.22675 31.0 14.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 1.0 9 0.0 10 0.0 11 2.0 12 1.0 13 2.0 14 2.0 15 4.0 16 6.0 17 6.0 18 15.0 19 41.0 20 5.0 21 3.0 22 11.0 23 17.0 24 16.0 25 23.0 26 27.0 27 31.0 28 34.0 29 52.0 30 55.0 31 88.0 32 86.0 33 153.0 34 217.0 35 381.0 36 1024.0 37 1695.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.688657701091095 16.163410301953817 10.68256787617356 26.465364120781526 2 20.575 20.375 33.4 25.650000000000002 3 17.150000000000002 28.175 30.025000000000002 24.65 4 22.0 31.55 25.5 20.95 5 21.65 34.675 24.775 18.9 6 19.400000000000002 34.55 26.450000000000003 19.6 7 15.7 25.174999999999997 40.65 18.475 8 18.325 23.95 30.0 27.725 9 17.599999999999998 23.150000000000002 31.55 27.700000000000003 10-14 20.015 29.4 26.419999999999998 24.165 15-19 19.73 28.439999999999998 27.495000000000005 24.335 20-24 20.47 28.825 27.465 23.24 25-29 20.294999999999998 28.515 27.72 23.47 30-34 19.88 28.52 27.544999999999998 24.055 35-39 20.36 28.794999999999998 27.63 23.215 40-44 19.735 29.244999999999997 28.060000000000002 22.96 45-49 20.424999999999997 28.63 27.565 23.380000000000003 50-54 21.044999999999998 27.325 28.105000000000004 23.525 55-59 19.545 29.044999999999998 27.71 23.7 60-64 20.849999999999998 28.335 27.99 22.825 65-69 20.369999999999997 29.599999999999998 27.075 22.955000000000002 70-74 20.06 29.37 26.795 23.775 75-79 20.45 28.465 27.474999999999998 23.61 80-84 19.869999999999997 28.449999999999996 27.650000000000002 24.03 85-89 20.044999999999998 28.825 26.855 24.275 90-94 20.36 29.215000000000003 26.979999999999997 23.445 95-99 20.77 28.425 26.884999999999998 23.919999999999998 100-104 20.580000000000002 28.77 27.24 23.41 105-109 21.27 28.470000000000002 26.790000000000003 23.47 110-114 20.715 28.7 26.68 23.905 115-119 20.565 28.535 26.68 24.22 120-124 20.669999999999998 28.599999999999998 26.68 24.05 125-129 21.09 28.134999999999998 26.669999999999998 24.104999999999997 130-134 21.27606380319016 28.48142407120356 26.106305315265764 24.136206810340514 135-139 21.531076553827692 28.821441072053606 25.801290064503224 23.84619230961548 140-144 21.6010800540027 27.841392069603483 26.246312315615782 24.311215560778038 145-149 20.79 28.815 25.82 24.575 150-151 21.375 27.3875 26.575 24.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 1.0 4 1.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 2.5 24 4.0 25 3.0 26 4.5 27 7.0 28 8.0 29 16.0 30 24.0 31 26.0 32 44.0 33 57.5 34 59.0 35 72.5 36 98.5 37 118.0 38 143.5 39 167.5 40 193.0 41 218.0 42 226.0 43 246.5 44 245.0 45 236.5 46 226.5 47 217.0 48 218.5 49 215.5 50 190.5 51 140.0 52 109.5 53 103.5 54 89.5 55 77.5 56 64.5 57 40.5 58 25.5 59 16.5 60 10.0 61 6.5 62 7.5 63 5.0 64 1.5 65 0.5 66 0.0 67 0.5 68 0.5 69 0.0 70 0.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.005 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.44559585492227 95.0 2 1.1139896373056994 2.15 3 0.233160621761658 0.675 4 0.05181347150259067 0.2 5 0.05181347150259067 0.25 6 0.05181347150259067 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05181347150259067 1.425 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 42 1.05 TruSeq Adapter, Index 2 (97% over 37bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTATG 15 0.375 TruSeq Adapter, Index 2 (97% over 36bp) GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 6 0.15 No Hit CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGTTTAATGACCGCA 6 0.15 No Hit CTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCT 5 0.125 No Hit GCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.0625 0.0 0.0 0.0 0.0 54-55 0.0875 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.16249999999999998 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.21250000000000002 0.0 0.0 0.0 0.0 72-73 0.2625 0.0 0.0 0.0 0.0 74-75 0.32499999999999996 0.0 0.0 0.0 0.0 76-77 0.3625 0.0 0.0 0.0 0.0 78-79 0.42500000000000004 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.825 0.0 0.0 0.0 0.0 88-89 0.9874999999999999 0.0 0.0 0.0 0.0 90-91 1.1 0.0 0.0 0.0 0.0 92-93 1.4874999999999998 0.0 0.0 0.0 0.0 94-95 1.6625 0.0 0.0 0.0 0.0 96-97 2.0374999999999996 0.0 0.0 0.0 0.0 98-99 2.5375 0.0 0.0 0.0 0.0 100-101 2.875 0.0 0.0 0.0 0.0 102-103 3.2 0.0 0.0 0.0 0.0 104-105 3.625 0.0 0.0 0.0 0.0 106-107 4.0 0.0 0.0 0.0 0.0 108-109 4.3625 0.0 0.0 0.0 0.0 110-111 4.8625 0.0 0.0 0.0 0.0 112-113 5.225 0.0 0.0 0.0 0.0 114-115 5.725 0.0 0.0 0.0 0.0 116-117 6.2375 0.0 0.0 0.0 0.0 118-119 6.775 0.0 0.0 0.0 0.0 120-121 7.3 0.0 0.0 0.0 0.0 122-123 7.85 0.0 0.0 0.0 0.0 124-125 8.425 0.0 0.0 0.0 0.0 126-127 9.175 0.0 0.0 0.0 0.0 128-129 9.8625 0.0 0.0 0.0 0.0 130-131 10.75 0.0 0.0 0.0 0.0 132-133 11.425 0.0 0.0 0.0 0.0 134-135 12.2125 0.0 0.0 0.0 0.0 136-137 13.100000000000001 0.0 0.0 0.0 0.0 138-139 13.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGAAA 20 0.0059376103 28.9975 60-64 AAAAAAA 140 3.8360668E-8 13.463125 70-74 >>END_MODULE SRR7170863 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170863_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77725 33.0 33.0 34.0 32.0 34.0 2 32.8605 33.0 33.0 34.0 32.0 34.0 3 32.83725 34.0 33.0 34.0 32.0 34.0 4 32.78025 34.0 33.0 34.0 32.0 34.0 5 32.806 34.0 33.0 34.0 32.0 34.0 6 36.94 38.0 38.0 38.0 37.0 38.0 7 36.95 38.0 38.0 38.0 37.0 38.0 8 36.9255 38.0 38.0 38.0 37.0 38.0 9 36.99125 38.0 38.0 38.0 37.0 38.0 10-14 36.9138 38.0 38.0 38.0 37.0 38.0 15-19 36.89665 38.0 38.0 38.0 37.0 38.0 20-24 36.84865 38.0 38.0 38.0 37.0 38.0 25-29 36.8163 38.0 38.0 38.0 36.8 38.0 30-34 36.74145 38.0 38.0 38.0 36.2 38.0 35-39 36.6331 38.0 38.0 38.0 36.0 38.0 40-44 36.72115 38.0 38.0 38.0 36.2 38.0 45-49 36.6646 38.0 38.0 38.0 36.0 38.0 50-54 36.646300000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.5776 38.0 38.0 38.0 36.0 38.0 60-64 36.5558 38.0 38.0 38.0 35.6 38.0 65-69 36.56914999999999 38.0 38.0 38.0 35.6 38.0 70-74 36.4965 38.0 38.0 38.0 35.4 38.0 75-79 36.3623 38.0 38.0 38.0 34.6 38.0 80-84 35.87755 38.0 38.0 38.0 33.8 38.0 85-89 35.7758 38.0 38.0 38.0 33.6 38.0 90-94 35.609249999999996 38.0 38.0 38.0 33.0 38.0 95-99 35.6088 38.0 38.0 38.0 33.0 38.0 100-104 35.334799999999994 38.0 37.2 38.0 31.0 38.0 105-109 35.29265 38.0 37.6 38.0 30.4 38.0 110-114 35.071600000000004 38.0 37.0 38.0 29.6 38.0 115-119 34.8008 38.0 36.6 38.0 27.8 38.0 120-124 34.6358 38.0 36.0 38.0 27.0 38.0 125-129 34.20465 38.0 35.8 38.0 23.6 38.0 130-134 33.7136 38.0 34.8 38.0 21.4 38.0 135-139 33.2592 38.0 33.2 38.0 16.0 38.0 140-144 32.5332 38.0 33.0 38.0 13.0 38.0 145-149 31.487000000000002 38.0 33.0 38.0 5.8 38.0 150-151 26.315375 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 6.0 4 3.0 5 5.0 6 1.0 7 2.0 8 4.0 9 2.0 10 2.0 11 1.0 12 11.0 13 8.0 14 3.0 15 5.0 16 6.0 17 4.0 18 11.0 19 8.0 20 47.0 21 17.0 22 14.0 23 7.0 24 12.0 25 22.0 26 25.0 27 26.0 28 25.0 29 45.0 30 37.0 31 43.0 32 80.0 33 101.0 34 130.0 35 216.0 36 633.0 37 2416.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.3 20.925 12.8 18.975 2 25.76288144072036 24.937468734367183 30.69034517258629 18.609304652326163 3 20.32032032032032 26.876876876876878 33.95895895895896 18.843843843843842 4 21.860930465232617 35.66783391695848 21.860930465232617 20.610305152576288 5 24.487243621810904 35.34267133566784 21.98599299649825 18.18409204602301 6 19.984992496248125 36.493246623311656 24.61230615307654 18.90945472736368 7 19.734867433716857 21.360680340170084 37.41870935467734 21.48574287143572 8 20.38519259629815 26.588294147073537 26.96348174087044 26.063031515757878 9 22.536268134067033 25.087543771885944 28.16408204102051 24.212106053026513 10-14 23.02151075537769 28.349174587293646 26.91345672836418 21.715857928964482 15-19 23.101550775387693 28.279139569784896 27.41370685342671 21.2056028014007 20-24 23.012259194395796 27.655741806354765 28.596447335501622 20.735551663747813 25-29 23.19551506657323 28.861747922714986 27.300030033036336 20.64270697767544 30-34 22.649914906397036 27.930723796175794 28.756632295525076 20.662729001902093 35-39 22.468703054581873 27.946920380570855 28.482724086129195 21.101652478718076 40-44 23.29761666332866 28.084318045263366 28.084318045263366 20.5337472461446 45-49 22.844266399599398 27.98197295943916 27.946920380570855 21.226840260390585 50-54 23.01106493766585 27.92770239823762 27.832573974866072 21.22865868923046 55-59 23.338508539089496 27.01958231081284 28.62222667401212 21.019682476085542 60-64 23.08886107634543 27.2090112640801 28.120150187734666 21.5819774718398 65-69 22.908216914526065 26.58354614190576 28.946973111010966 21.56126383255721 70-74 22.176046465051073 28.80532745844182 27.458441818545964 21.560184257961147 75-79 23.244867300951427 27.931897846770156 27.74161241862794 21.081622433650477 80-84 22.781198378134853 28.662962406767782 27.09115482805226 21.464684387045104 85-89 23.124280494519244 28.30972521147205 26.893237899794787 21.672756394213923 90-94 23.948317307692307 28.109975961538463 26.717748397435898 21.223958333333336 95-99 23.43632630577395 28.17867694927137 27.57273774350243 20.81225900145225 100-104 24.074908617495367 28.726653647789295 26.813880126182966 20.384557608532372 105-109 24.823476388402025 27.773048224748358 27.452551454754868 19.950923932094746 110-114 24.432757325319308 28.01402454295016 27.392937640871523 20.160280490859 115-119 24.389022435897438 28.80108173076923 26.963141025641026 19.846754807692307 120-124 24.77588020233385 28.697350628537087 26.57885511093304 19.947914058196023 125-129 24.50798738043968 28.854724823476392 26.74144924633182 19.895838549752114 130-134 25.113926586208624 28.343933096299263 26.891682107266263 19.65045821022585 135-139 25.499524262607043 28.429065050828783 26.671340577895737 19.400070108668434 140-144 25.7549201261956 28.093544994741848 27.45755921678602 18.69397566227653 145-149 26.33291614518148 28.240300375469335 26.47309136420526 18.95369211514393 150-151 26.65832290362954 27.98498122653317 26.433041301627036 18.923654568210264 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 1.5 11 2.5 12 1.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 1.0 21 1.0 22 1.5 23 0.5 24 1.0 25 3.0 26 2.0 27 4.5 28 8.0 29 10.5 30 22.0 31 26.5 32 29.0 33 36.0 34 45.5 35 68.0 36 93.5 37 110.0 38 123.0 39 156.0 40 186.5 41 207.5 42 242.0 43 263.5 44 266.5 45 260.0 46 244.0 47 243.5 48 251.5 49 219.0 50 168.5 51 144.0 52 122.0 53 94.5 54 87.0 55 77.5 56 49.5 57 29.5 58 24.0 59 18.5 60 12.0 61 10.5 62 8.0 63 5.0 64 3.0 65 2.0 66 1.5 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.1 4 0.05 5 0.05 6 0.05 7 0.05 8 0.05 9 0.05 10-14 0.05 15-19 0.05 20-24 0.075 25-29 0.11 30-34 0.11 35-39 0.15 40-44 0.13999999999999999 45-49 0.15 50-54 0.135 55-59 0.165 60-64 0.125 65-69 0.145 70-74 0.13999999999999999 75-79 0.15 80-84 0.11499999999999999 85-89 0.105 90-94 0.16 95-99 0.155 100-104 0.145 105-109 0.155 110-114 0.17500000000000002 115-119 0.16 120-124 0.165 125-129 0.155 130-134 0.155 135-139 0.155 140-144 0.155 145-149 0.125 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.62516212710766 95.05 2 0.8300907911802854 1.6 3 0.20752269779507135 0.6 4 0.07782101167315175 0.3 5 0.12970168612191957 0.625 6 0.05188067444876784 0.3 7 0.0 0.0 8 0.05188067444876784 0.4 9 0.0 0.0 >10 0.02594033722438392 1.125 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 45 1.125 Illumina Single End PCR Primer 1 (96% over 32bp) AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 8 0.2 No Hit GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 6 0.15 No Hit GTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGA 6 0.15 No Hit AGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCG 5 0.125 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit AACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.0625 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.0875 0.0 0.0 0.0 0.0 54-55 0.1125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.21250000000000002 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.2625 0.0 0.0 0.0 0.0 70-71 0.2875 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.4 0.0 0.0 0.0 0.0 76-77 0.4375 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.8999999999999999 0.0 0.0 0.0 0.0 88-89 1.0625 0.0 0.0 0.0 0.0 90-91 1.15 0.0 0.0 0.0 0.0 92-93 1.5125 0.0 0.0 0.0 0.0 94-95 1.6625 0.0 0.0 0.0 0.0 96-97 2.0125 0.0 0.0 0.0 0.0 98-99 2.5 0.0 0.0 0.0 0.0 100-101 2.875 0.0 0.0 0.0 0.0 102-103 3.1875 0.0 0.0 0.0 0.0 104-105 3.5625 0.0 0.0 0.0 0.0 106-107 3.9250000000000003 0.0 0.0 0.0 0.0 108-109 4.324999999999999 0.0 0.0 0.0 0.0 110-111 4.85 0.0 0.0 0.0 0.0 112-113 5.1875 0.0 0.0 0.0 0.0 114-115 5.675000000000001 0.0 0.0 0.0 0.0 116-117 6.175000000000001 0.0 0.0 0.0 0.0 118-119 6.725 0.0 0.0 0.0 0.0 120-121 7.3 0.0 0.0 0.0 0.0 122-123 7.875 0.0 0.0 0.0 0.0 124-125 8.5 0.0 0.0 0.0 0.0 126-127 9.2875 0.0 0.0 0.0 0.0 128-129 9.975 0.0 0.0 0.0 0.0 130-131 10.899999999999999 0.0 0.0 0.0 0.0 132-133 11.6125 0.0 0.0 0.0 0.0 134-135 12.4125 0.0 0.0 0.0 0.0 136-137 13.1875 0.0 0.0 0.0 0.0 138-139 13.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 250 6.859955E-8 9.309091 70-74 >>END_MODULE Read 847206 spots for SRR7170863.sra Written 847206 spots for SRR7170863.sra Read 847206 spots for SRR7170863.sra Written 847206 spots for SRR7170863.sra Read 847206 spots for SRR7170863.sra Written 847206 spots for SRR7170863.sra Read 847206 spots for SRR7170863.sra Written 847206 spots for SRR7170863.sra Read 847206 spots for SRR7170863.sra Written 847206 spots for SRR7170863.sra Read 847206 spots for SRR7170863.sra Written 847206 spots for SRR7170863.sra Read 847206 spots for SRR7170863.sra Written 847206 spots for SRR7170863.sra Read 847206 spots for SRR7170863.sra Written 847206 spots for SRR7170863.sra Read 847206 spots for SRR7170863.sra Written 847206 spots for SRR7170863.sra Read 847206 spots for SRR7170863.sra Written 847206 spots for SRR7170863.sra Read 847206 spots for SRR7170863.sra Written 847206 spots for SRR7170863.sra Read 847206 spots for SRR7170863.sra Written 847206 spots for SRR7170863.sra Read 847206 spots for SRR7170863.sra Written 847206 spots for SRR7170863.sra Read 847206 spots for SRR7170863.sra Written 847206 spots for SRR7170863.sra Read 847206 spots for SRR7170863.sra Written 847206 spots for SRR7170863.sra Read 847206 spots for SRR7170863.sra Written 847206 spots for SRR7170863.sra Read 847206 spots for SRR7170863.sra Written 847206 spots for SRR7170863.sra Read 847206 spots for SRR7170863.sra Written 847206 spots for SRR7170863.sra Read 847206 spots for SRR7170863.sra Written 847206 spots for SRR7170863.sra Read 847206 spots for SRR7170863.sra Written 847206 spots for SRR7170863.sra SRR ids: ['SRR7170863.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_itfum4jx SRR7170863.sra spots: 16944120 blocks: [[1, 847206], [847207, 1694412], [1694413, 2541618], [2541619, 3388824], [3388825, 4236030], [4236031, 5083236], [5083237, 5930442], [5930443, 6777648], [6777649, 7624854], [7624855, 8472060], [8472061, 9319266], [9319267, 10166472], [10166473, 11013678], [11013679, 11860884], [11860885, 12708090], [12708091, 13555296], [13555297, 14402502], [14402503, 15249708], [15249709, 16096914], [16096915, 16944120]] SRR7170863 file size 5720105 SRR7170863 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170863 SRR7170863_1.fastq SRR7170863_2.fastq Input file: SRR7170863_1.fastq Paired file: SRR7170863_2.fastq trimmed: SRR7170863-trimmed-pair1.fastq, SRR7170863-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:10:21 2025 >> started Thu Feb 13 20:10:48 2025 >> done (27.641s) 16944120 read pairs processed; of these: 63983 ( 0.38%) short read pairs filtered out after trimming by size control 266385 ( 1.57%) empty read pairs filtered out after trimming by size control 16613752 (98.05%) read pairs available; of these: 11929892 (71.81%) trimmed read pairs available after processing 4683860 (28.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 35 0.00% 19 37 0.00% 20 68 0.00% 21 53 0.00% 22 52 0.00% 23 83 0.00% 24 76 0.00% 25 78 0.00% 26 72 0.00% 27 96 0.00% 28 80 0.00% 29 100 0.00% 30 105 0.00% 31 133 0.00% 32 91 0.00% 33 108 0.00% 34 96 0.00% 35 138 0.00% 36 146 0.00% 37 170 0.00% 38 263 0.00% 39 283 0.00% 40 436 0.00% 41 241 0.00% 42 260 0.00% 43 269 0.00% 44 265 0.00% 45 403 0.00% 46 498 0.00% 47 490 0.00% 48 607 0.00% 49 636 0.00% 50 764 0.00% 51 835 0.01% 52 919 0.01% 53 985 0.01% 54 1083 0.01% 55 1013 0.01% 56 1172 0.01% 57 1351 0.01% 58 1490 0.01% 59 1582 0.01% 60 1804 0.01% 61 2082 0.01% 62 2280 0.01% 63 2546 0.02% 64 2698 0.02% 65 2697 0.02% 66 2825 0.02% 67 3087 0.02% 68 3291 0.02% 69 3809 0.02% 70 4598 0.03% 71 5254 0.03% 72 6966 0.04% 73 8151 0.05% 74 10182 0.06% 75 15094 0.09% 76 44665 0.27% 77 44838 0.27% 78 17928 0.11% 79 13346 0.08% 80 13285 0.08% 81 14582 0.09% 82 15728 0.09% 83 17330 0.10% 84 20934 0.13% 85 21233 0.13% 86 21552 0.13% 87 22475 0.14% 88 22710 0.14% 89 23522 0.14% 90 24939 0.15% 91 26923 0.16% 92 28722 0.17% 93 31131 0.19% 94 32680 0.20% 95 34518 0.21% 96 34045 0.20% 97 34677 0.21% 98 34609 0.21% 99 35315 0.21% 100 38283 0.23% 101 39181 0.24% 102 43083 0.26% 103 45294 0.27% 104 47037 0.28% 105 48970 0.29% 106 48848 0.29% 107 49507 0.30% 108 49679 0.30% 109 49900 0.30% 110 50848 0.31% 111 53253 0.32% 112 56761 0.34% 113 59192 0.36% 114 62687 0.38% 115 63728 0.38% 116 65183 0.39% 117 66331 0.40% 118 66207 0.40% 119 66252 0.40% 120 68326 0.41% 121 69425 0.42% 122 73025 0.44% 123 76834 0.46% 124 80461 0.48% 125 83697 0.50% 126 86262 0.52% 127 87565 0.53% 128 89572 0.54% 129 92177 0.55% 130 93441 0.56% 131 97408 0.59% 132 102801 0.62% 133 109360 0.66% 134 115480 0.70% 135 124846 0.75% 136 130634 0.79% 137 139234 0.84% 138 146032 0.88% 139 155538 0.94% 140 164019 0.99% 141 177587 1.07% 142 195648 1.18% 143 219840 1.32% 144 252049 1.52% 145 295717 1.78% 146 362983 2.18% 147 476301 2.87% 148 703705 4.24% 149 1273683 7.67% 150 3989305 24.01% 151 4683860 28.19% 16613752 reads passed initial QC criterion=sequence-density sequence-density=1.36 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=34 prefix-density=1.21 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=33 fanout-score=31.53 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=10.1 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=1.69 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=31 prefix-density=1.71 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=16.48 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.9 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7170863 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:11:28 Started mapping on | Feb 13 20:11:29 Finished on | Feb 13 20:14:14 Mapping speed, Million of reads per hour | 362.48 Number of input reads | 16613752 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 15679009 Uniquely mapped reads % | 94.37% Average mapped length | 283.74 Number of splices: Total | 14945042 Number of splices: Annotated (sjdb) | 14601345 Number of splices: GT/AG | 14658000 Number of splices: GC/AG | 221209 Number of splices: AT/AC | 9561 Number of splices: Non-canonical | 56272 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 424940 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 52631 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.67% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 558910 558910 558910 N_multimapping 424940 424940 424940 N_noFeature 584593 15253783 742729 N_ambiguous 396149 1243 128210 UnstrandedReadsAssigned:14698267 PositiveStrandReadsAssigned:423983 NegativeStrandReadsAssigned:14808070 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=137 echo kmer=133 SRR7170863 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170863-trimmed-pair1.fastq SRR7170863-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,613,752 reads, 14,711,820 reads pseudoaligned [quant] estimated average fragment length: 214.711 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52401 SRR7170863.ke.tsv 34699 SRR7170863.se.tsv 87100 total ==> SRR7170863.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1804.29 405 10.2985 Potri.005G024800.1.v4.1 1035 821.289 291 16.2563 Potri.004G059700.1.v4.1 961 747.316 10 0.613932 Potri.007G009000.2.v4.1 1416 1202.29 0 0 Potri.003G141000.2.v4.1 2943 2729.29 415.571 6.98586 Potri.016G087400.1.v4.1 270 98.5167 1098.68 511.667 Potri.015G069301.1.v4.1 564 354.493 0 0 Potri.010G195200.1.v4.1 1773 1559.29 28 0.823864 Potri.012G127500.1.v4.1 977 763.303 170 10.2182 ==> SRR7170863.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 516 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 500 Potri.001G212900.v4.1 24 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 66 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR7170863 completed mapping pipeline successfully