Starting /dee2/code/volunteer_pipeline.sh SRR7170864 current disk space = 3087456120832 free memory = 1580641284 SRR7170864 SRAfilesize 5be4371d4bd28b9b098f2e41a96e9494 SRR7170864.sra SRR7170864.sra file validated SRR7170864 is paired end SRR7170864 is conventional basespace SRR7170864 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170864_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.56925 34.0 33.0 34.0 32.0 34.0 2 33.283 34.0 33.0 34.0 33.0 34.0 3 33.271 34.0 33.0 34.0 33.0 34.0 4 33.50025 34.0 34.0 34.0 33.0 34.0 5 33.4245 34.0 33.0 34.0 33.0 34.0 6 36.94625 38.0 37.0 38.0 36.0 38.0 7 37.34 38.0 38.0 38.0 37.0 38.0 8 37.418 38.0 38.0 38.0 37.0 38.0 9 37.52425 38.0 38.0 38.0 37.0 38.0 10-14 37.59255 38.0 38.0 38.0 38.0 38.0 15-19 37.522800000000004 38.0 38.0 38.0 37.6 38.0 20-24 37.49865 38.0 38.0 38.0 37.4 38.0 25-29 37.465199999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.391 38.0 38.0 38.0 37.0 38.0 35-39 37.315149999999996 38.0 38.0 38.0 36.8 38.0 40-44 37.271300000000004 38.0 38.0 38.0 36.8 38.0 45-49 37.2071 38.0 38.0 38.0 36.4 38.0 50-54 37.174949999999995 38.0 38.0 38.0 36.0 38.0 55-59 37.09925 38.0 38.0 38.0 36.0 38.0 60-64 36.95655 38.0 38.0 38.0 35.8 38.0 65-69 36.976099999999995 38.0 38.0 38.0 35.8 38.0 70-74 36.90105 38.0 38.0 38.0 35.6 38.0 75-79 36.750099999999996 38.0 38.0 38.0 34.8 38.0 80-84 36.5526 38.0 38.0 38.0 34.0 38.0 85-89 36.5342 38.0 38.0 38.0 34.0 38.0 90-94 36.37495 38.0 37.8 38.0 34.0 38.0 95-99 36.251749999999994 38.0 37.4 38.0 33.8 38.0 100-104 36.043800000000005 38.0 37.0 38.0 32.6 38.0 105-109 35.90995 38.0 37.0 38.0 31.6 38.0 110-114 35.627649999999996 38.0 36.4 38.0 31.0 38.0 115-119 35.321299999999994 38.0 36.0 38.0 29.8 38.0 120-124 35.027 38.0 35.4 38.0 28.4 38.0 125-129 34.4026 38.0 34.0 38.0 25.0 38.0 130-134 34.0056 38.0 33.0 38.0 23.4 38.0 135-139 33.3457 38.0 33.0 38.0 20.4 38.0 140-144 32.394999999999996 37.8 32.0 38.0 15.2 38.0 145-149 31.03265 36.6 29.8 38.0 8.4 38.0 150-151 24.68475 31.5 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 2.0 15 1.0 16 3.0 17 3.0 18 1.0 19 3.0 20 1.0 21 5.0 22 8.0 23 5.0 24 13.0 25 15.0 26 26.0 27 21.0 28 39.0 29 27.0 30 48.0 31 70.0 32 109.0 33 156.0 34 221.0 35 430.0 36 1054.0 37 1737.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.63239074550128 13.856041131105398 11.002570694087403 38.508997429305914 2 19.575 20.974999999999998 37.45 22.0 3 16.950000000000003 26.400000000000002 28.849999999999998 27.800000000000004 4 21.325 33.35 23.175 22.15 5 20.225 38.9 23.9 16.975 6 18.099999999999998 35.825 24.925 21.15 7 14.025000000000002 23.0 43.725 19.25 8 17.25 23.95 30.875000000000004 27.925 9 17.599999999999998 22.650000000000002 32.875 26.875 10-14 19.415 29.815 27.034999999999997 23.735 15-19 19.98 28.82 27.779999999999998 23.419999999999998 20-24 19.470000000000002 28.89 27.975 23.665 25-29 19.925 28.625 28.21 23.24 30-34 19.73 28.865000000000002 28.22 23.185 35-39 20.169999999999998 29.265 27.939999999999998 22.625 40-44 19.335 29.375 28.189999999999998 23.1 45-49 19.48 29.054999999999996 28.005000000000003 23.46 50-54 19.85 28.884999999999998 27.93 23.335 55-59 19.38 29.26 27.950000000000003 23.41 60-64 20.150000000000002 28.939999999999998 27.634999999999998 23.275000000000002 65-69 19.825 28.744999999999997 27.855 23.575 70-74 19.73 29.18 28.199999999999996 22.89 75-79 19.39 29.25 28.505000000000003 22.855 80-84 20.495 29.065 27.800000000000004 22.64 85-89 20.125 29.085 27.58 23.21 90-94 20.13 28.95 28.065 22.855 95-99 20.385 28.804999999999996 27.735 23.075000000000003 100-104 19.99 28.775000000000002 27.915 23.32 105-109 19.86 29.04 27.66 23.44 110-114 20.555 28.365000000000002 27.755000000000003 23.325000000000003 115-119 20.485 28.810000000000002 27.615000000000002 23.09 120-124 20.669999999999998 28.439999999999998 27.384999999999998 23.505000000000003 125-129 20.235 28.785 27.694999999999997 23.285 130-134 20.86 29.025000000000002 26.93 23.185 135-139 20.845 28.565 27.189999999999998 23.400000000000002 140-144 20.815 28.560000000000002 27.075 23.549999999999997 145-149 20.369999999999997 28.685 27.439999999999998 23.505000000000003 150-151 21.1125 27.537499999999998 27.8125 23.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 2.0 22 3.0 23 2.5 24 3.0 25 5.0 26 8.0 27 10.5 28 10.5 29 18.0 30 28.0 31 35.0 32 44.5 33 52.5 34 70.5 35 87.5 36 100.0 37 127.0 38 154.5 39 193.0 40 219.0 41 225.5 42 265.5 43 275.0 44 273.0 45 271.5 46 238.5 47 223.0 48 208.5 49 171.5 50 143.5 51 122.0 52 89.0 53 71.5 54 56.5 55 48.5 56 42.0 57 29.0 58 21.0 59 13.5 60 7.5 61 6.5 62 6.0 63 3.5 64 2.0 65 2.0 66 1.5 67 1.5 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47129909365559 98.775 2 0.4028197381671702 0.8 3 0.0755287009063444 0.22499999999999998 4 0.050352467270896276 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0125 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.025 0.025 0.0 0.0 0.0 56-57 0.025 0.025 0.0 0.0 0.0 58-59 0.025 0.025 0.0 0.0 0.0 60-61 0.025 0.025 0.0 0.0 0.0 62-63 0.05 0.025 0.0 0.0 0.0 64-65 0.05 0.025 0.0 0.0 0.0 66-67 0.05 0.025 0.0 0.0 0.0 68-69 0.05 0.025 0.0 0.0 0.0 70-71 0.0625 0.025 0.0 0.0 0.0 72-73 0.1 0.025 0.0 0.0 0.0 74-75 0.15 0.025 0.0 0.0 0.0 76-77 0.2 0.025 0.0 0.0 0.0 78-79 0.2 0.025 0.0 0.0 0.0 80-81 0.2 0.025 0.0 0.0 0.0 82-83 0.25 0.025 0.0 0.0 0.0 84-85 0.35 0.025 0.0 0.0 0.0 86-87 0.475 0.025 0.0 0.0 0.0 88-89 0.5375000000000001 0.025 0.0 0.0 0.0 90-91 0.5625 0.025 0.0 0.0 0.0 92-93 0.675 0.025 0.0 0.0 0.0 94-95 0.7875 0.025 0.0 0.0 0.0 96-97 0.85 0.025 0.0 0.0 0.0 98-99 0.9874999999999999 0.025 0.0 0.0 0.0 100-101 1.2 0.025 0.0 0.0 0.0 102-103 1.4125 0.025 0.0 0.0 0.0 104-105 1.6625 0.025 0.0 0.0 0.0 106-107 2.025 0.025 0.0 0.0 0.0 108-109 2.425 0.025 0.0 0.0 0.0 110-111 2.6125 0.025 0.0 0.0 0.0 112-113 2.8125 0.025 0.0 0.0 0.0 114-115 3.25 0.025 0.0 0.0 0.0 116-117 3.6625 0.025 0.0 0.0 0.0 118-119 4.262499999999999 0.025 0.0 0.0 0.0 120-121 4.9375 0.025 0.0 0.0 0.0 122-123 5.300000000000001 0.025 0.0 0.0 0.0 124-125 5.75 0.025 0.0 0.0 0.0 126-127 6.1625 0.025 0.0 0.0 0.0 128-129 6.6375 0.025 0.0 0.0 0.0 130-131 7.275 0.025 0.0 0.0 0.0 132-133 7.9625 0.025 0.0 0.0 0.0 134-135 8.5625 0.025 0.0 0.0 0.0 136-137 9.2375 0.025 0.0 0.0 0.0 138-139 10.0375 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170864 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170864_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1135 33.0 33.0 34.0 33.0 34.0 2 33.19475 34.0 33.0 34.0 33.0 34.0 3 33.23025 34.0 33.0 34.0 33.0 34.0 4 33.28875 34.0 33.0 34.0 33.0 34.0 5 33.165 34.0 33.0 34.0 33.0 34.0 6 37.4455 38.0 38.0 38.0 38.0 38.0 7 37.53075 38.0 38.0 38.0 38.0 38.0 8 37.49425 38.0 38.0 38.0 38.0 38.0 9 37.516 38.0 38.0 38.0 38.0 38.0 10-14 37.47955 38.0 38.0 38.0 37.8 38.0 15-19 37.479 38.0 38.0 38.0 38.0 38.0 20-24 37.405350000000006 38.0 38.0 38.0 37.8 38.0 25-29 37.346250000000005 38.0 38.0 38.0 37.6 38.0 30-34 37.3686 38.0 38.0 38.0 37.6 38.0 35-39 37.310050000000004 38.0 38.0 38.0 37.4 38.0 40-44 37.3151 38.0 38.0 38.0 37.2 38.0 45-49 37.32955 38.0 38.0 38.0 37.2 38.0 50-54 37.252649999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.2456 38.0 38.0 38.0 37.0 38.0 60-64 37.15035 38.0 38.0 38.0 37.0 38.0 65-69 37.1532 38.0 38.0 38.0 37.0 38.0 70-74 37.06245 38.0 38.0 38.0 36.6 38.0 75-79 36.9261 38.0 38.0 38.0 36.0 38.0 80-84 36.91605 38.0 38.0 38.0 36.0 38.0 85-89 36.83995 38.0 38.0 38.0 36.0 38.0 90-94 36.7226 38.0 38.0 38.0 35.4 38.0 95-99 36.641999999999996 38.0 38.0 38.0 35.0 38.0 100-104 36.458999999999996 38.0 38.0 38.0 34.4 38.0 105-109 36.268299999999996 38.0 38.0 38.0 34.2 38.0 110-114 36.131299999999996 38.0 38.0 38.0 33.8 38.0 115-119 35.99465 38.0 37.4 38.0 33.2 38.0 120-124 35.83325000000001 38.0 37.0 38.0 32.6 38.0 125-129 35.457049999999995 38.0 36.8 38.0 30.6 38.0 130-134 34.9079 38.0 36.0 38.0 28.4 38.0 135-139 34.41615 38.0 35.0 38.0 27.0 38.0 140-144 33.62025 38.0 33.4 38.0 20.8 38.0 145-149 32.6229 38.0 33.0 38.0 12.2 38.0 150-151 27.52475 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 3.0 4 0.0 5 1.0 6 1.0 7 4.0 8 2.0 9 0.0 10 2.0 11 0.0 12 1.0 13 0.0 14 2.0 15 4.0 16 4.0 17 7.0 18 2.0 19 5.0 20 5.0 21 5.0 22 6.0 23 10.0 24 6.0 25 12.0 26 11.0 27 15.0 28 27.0 29 39.0 30 34.0 31 43.0 32 75.0 33 99.0 34 123.0 35 250.0 36 584.0 37 2617.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.875 18.375 14.899999999999999 27.85 2 25.75719649561952 25.00625782227785 34.34292866082603 14.893617021276595 3 21.98297446169254 26.314471707561342 31.221832749123685 20.480721081622434 4 23.667750813109834 34.92619464598449 23.267450587940957 18.138603952964726 5 24.161241862794192 38.50776164246369 21.732598898347522 15.598397596394593 6 18.85 38.324999999999996 24.2 18.625 7 18.55 18.8 42.325 20.325 8 20.200000000000003 25.074999999999996 28.125 26.6 9 21.025 24.525 30.875000000000004 23.575 10-14 23.05230523052305 28.93289328932893 26.832683268326836 21.182118211821184 15-19 22.090522630657663 28.612153038259564 28.542135533883474 20.7551887971993 20-24 22.3884330598359 28.196918150890532 29.11246748048829 20.302181308785272 25-29 22.38014212791512 28.740866780102092 28.99609648683815 19.882894605144628 30-34 22.2055438807165 28.23976783748624 28.75512859001301 20.79955969178425 35-39 22.686343171585793 28.319159579789893 28.349174587293646 20.645322661330663 40-44 21.943040192201813 28.580009009459932 28.665098353270935 20.811852445067323 45-49 22.69975484064642 28.088257367288737 28.743683394206233 20.46830439785861 50-54 22.580806564595214 28.189732812969076 28.54498148704093 20.684479135394778 55-59 22.896448224112056 28.099049524762382 28.659329664832416 20.34517258629315 60-64 23.10539742884298 28.302736231304088 28.082637186734033 20.509229153118905 65-69 22.666333166583293 27.938969484742373 28.66433216608304 20.730365182591296 70-74 22.9926459552754 28.105458001901045 27.830306668667763 21.071589374155785 75-79 22.78139069534767 28.57928964482241 28.054027013506754 20.58529264632316 80-84 23.02151075537769 28.209104552276138 28.249124562281143 20.520260130065033 85-89 23.25313859850948 28.08482969039164 28.534987245535937 20.127044465562946 90-94 23.55824538588506 28.3499224728655 27.779722903016058 20.31210923823338 95-99 22.757275727572758 29.042904290429046 28.352835283528353 19.846984698469846 100-104 23.523233131596058 28.369929475316365 27.70469664382534 20.402140749262244 105-109 23.151575787893947 28.199099549774886 28.114057028514257 20.535267633816908 110-114 23.572071621486444 28.708612583775135 28.048414524357305 19.670901270381115 115-119 23.901950975487743 28.349174587293646 28.084042021010507 19.664832416208103 120-124 23.774509803921568 28.686474589835935 27.756102440976388 19.782913165266105 125-129 23.936968484242122 28.584292146073036 27.533766883441718 19.94497248624312 130-134 24.516129032258064 28.707176794198553 27.171792948237062 19.604901225306325 135-139 24.956230303636637 28.127657445850634 27.992596668500823 18.923515582011905 140-144 24.918721552543392 28.600010003501225 27.569649377282047 18.911619066673335 145-149 25.048767068473964 29.210223578252386 27.07447606662332 18.666533286650328 150-151 24.518629657414355 27.556889222305575 28.532133033258315 19.392348087021755 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 1.0 12 1.5 13 1.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 1.0 22 1.0 23 1.5 24 3.5 25 4.5 26 3.5 27 9.0 28 15.0 29 17.0 30 23.0 31 31.0 32 37.0 33 46.0 34 55.0 35 76.5 36 100.0 37 129.0 38 160.5 39 174.0 40 201.5 41 224.5 42 273.0 43 283.5 44 287.5 45 290.5 46 241.0 47 227.0 48 221.0 49 190.5 50 150.5 51 117.0 52 86.5 53 68.5 54 62.5 55 52.0 56 34.0 57 26.5 58 20.5 59 14.5 60 10.5 61 6.0 62 4.5 63 3.5 64 2.0 65 1.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.15 4 0.075 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.025 20-24 0.06 25-29 0.09 30-34 0.06999999999999999 35-39 0.05 40-44 0.105 45-49 0.065 50-54 0.06999999999999999 55-59 0.05 60-64 0.045 65-69 0.05 70-74 0.055 75-79 0.05 80-84 0.05 85-89 0.034999999999999996 90-94 0.034999999999999996 95-99 0.01 100-104 0.034999999999999996 105-109 0.05 110-114 0.03 115-119 0.05 120-124 0.04 125-129 0.05 130-134 0.025 135-139 0.045 140-144 0.034999999999999996 145-149 0.034999999999999996 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3195564516129 98.52499999999999 2 0.6300403225806451 1.25 3 0.0 0.0 4 0.025201612903225805 0.1 5 0.025201612903225805 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.475 0.0 0.0 0.0 0.0 110-111 2.6875 0.0 0.0 0.0 0.0 112-113 2.8875 0.0 0.0 0.0 0.0 114-115 3.325 0.0 0.0 0.0 0.0 116-117 3.7125 0.0 0.0 0.0 0.0 118-119 4.324999999999999 0.0 0.0 0.0 0.0 120-121 4.9875 0.0 0.0 0.0 0.0 122-123 5.375 0.0 0.0 0.0 0.0 124-125 5.824999999999999 0.0 0.0 0.0 0.0 126-127 6.225 0.0 0.0 0.0 0.0 128-129 6.6625 0.0 0.0 0.0 0.0 130-131 7.300000000000001 0.0 0.0 0.0 0.0 132-133 7.975 0.0 0.0 0.0 0.0 134-135 8.575 0.0 0.0 0.0 0.0 136-137 9.225 0.0 0.0 0.0 0.0 138-139 10.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGATTC 10 0.006830828 145.0 3 AGATTCA 10 0.006830828 145.0 4 >>END_MODULE Read 613903 spots for SRR7170864.sra Written 613903 spots for SRR7170864.sra Read 613903 spots for SRR7170864.sra Written 613903 spots for SRR7170864.sra Read 613903 spots for SRR7170864.sra Written 613903 spots for SRR7170864.sra Read 613903 spots for SRR7170864.sra Written 613903 spots for SRR7170864.sra Read 613903 spots for SRR7170864.sra Written 613903 spots for SRR7170864.sra Read 613903 spots for SRR7170864.sra Written 613903 spots for SRR7170864.sra Read 613903 spots for SRR7170864.sra Written 613903 spots for SRR7170864.sra Read 613903 spots for SRR7170864.sra Written 613903 spots for SRR7170864.sra Read 613903 spots for SRR7170864.sra Written 613903 spots for SRR7170864.sra Read 613903 spots for SRR7170864.sra Written 613903 spots for SRR7170864.sra Read 613903 spots for SRR7170864.sra Written 613903 spots for SRR7170864.sra Read 613903 spots for SRR7170864.sra Written 613903 spots for SRR7170864.sra Read 613903 spots for SRR7170864.sra Written 613903 spots for SRR7170864.sra Read 613903 spots for SRR7170864.sra Written 613903 spots for SRR7170864.sra Read 613903 spots for SRR7170864.sra Written 613903 spots for SRR7170864.sra Read 613903 spots for SRR7170864.sra Written 613903 spots for SRR7170864.sra Read 613903 spots for SRR7170864.sra Written 613903 spots for SRR7170864.sra Read 613919 spots for SRR7170864.sra Written 613919 spots for SRR7170864.sra Read 613903 spots for SRR7170864.sra Written 613903 spots for SRR7170864.sra Read 613903 spots for SRR7170864.sra Written 613903 spots for SRR7170864.sra SRR ids: ['SRR7170864.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u5ynsio8 SRR7170864.sra spots: 12278076 blocks: [[1, 613903], [613904, 1227806], [1227807, 1841709], [1841710, 2455612], [2455613, 3069515], [3069516, 3683418], [3683419, 4297321], [4297322, 4911224], [4911225, 5525127], [5525128, 6139030], [6139031, 6752933], [6752934, 7366836], [7366837, 7980739], [7980740, 8594642], [8594643, 9208545], [9208546, 9822448], [9822449, 10436351], [10436352, 11050254], [11050255, 11664157], [11664158, 12278076]] SRR7170864 file size 4138936 SRR7170864 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170864 SRR7170864_1.fastq SRR7170864_2.fastq Input file: SRR7170864_1.fastq Paired file: SRR7170864_2.fastq trimmed: SRR7170864-trimmed-pair1.fastq, SRR7170864-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:55:31 2025 >> started Thu Feb 13 19:55:44 2025 >> done (13.137s) 12278076 read pairs processed; of these: 12694 ( 0.10%) short read pairs filtered out after trimming by size control 12459 ( 0.10%) empty read pairs filtered out after trimming by size control 12252923 (99.80%) read pairs available; of these: 8372180 (68.33%) trimmed read pairs available after processing 3880743 (31.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 6 0.00% 20 9 0.00% 21 6 0.00% 22 6 0.00% 23 19 0.00% 24 7 0.00% 25 7 0.00% 26 8 0.00% 27 10 0.00% 28 7 0.00% 29 5 0.00% 30 8 0.00% 31 14 0.00% 32 7 0.00% 33 17 0.00% 34 11 0.00% 35 17 0.00% 36 11 0.00% 37 15 0.00% 38 21 0.00% 39 16 0.00% 40 31 0.00% 41 25 0.00% 42 20 0.00% 43 38 0.00% 44 29 0.00% 45 39 0.00% 46 53 0.00% 47 61 0.00% 48 58 0.00% 49 73 0.00% 50 102 0.00% 51 99 0.00% 52 104 0.00% 53 136 0.00% 54 132 0.00% 55 147 0.00% 56 162 0.00% 57 225 0.00% 58 245 0.00% 59 286 0.00% 60 334 0.00% 61 358 0.00% 62 418 0.00% 63 436 0.00% 64 532 0.00% 65 567 0.00% 66 630 0.01% 67 733 0.01% 68 780 0.01% 69 947 0.01% 70 1102 0.01% 71 1258 0.01% 72 1429 0.01% 73 1578 0.01% 74 1789 0.01% 75 2091 0.02% 76 2609 0.02% 77 2832 0.02% 78 2774 0.02% 79 2958 0.02% 80 3229 0.03% 81 3658 0.03% 82 4151 0.03% 83 5264 0.04% 84 6671 0.05% 85 6103 0.05% 86 5907 0.05% 87 6500 0.05% 88 7097 0.06% 89 7667 0.06% 90 8325 0.07% 91 9198 0.08% 92 9687 0.08% 93 10902 0.09% 94 11649 0.10% 95 12529 0.10% 96 13101 0.11% 97 13871 0.11% 98 14534 0.12% 99 15176 0.12% 100 16235 0.13% 101 17069 0.14% 102 18807 0.15% 103 19734 0.16% 104 20682 0.17% 105 22295 0.18% 106 23126 0.19% 107 23816 0.19% 108 24733 0.20% 109 25611 0.21% 110 26884 0.22% 111 28331 0.23% 112 29638 0.24% 113 30949 0.25% 114 32115 0.26% 115 33793 0.28% 116 34880 0.28% 117 36123 0.29% 118 37522 0.31% 119 38429 0.31% 120 39553 0.32% 121 40962 0.33% 122 42780 0.35% 123 45005 0.37% 124 47057 0.38% 125 48556 0.40% 126 50438 0.41% 127 53204 0.43% 128 54665 0.45% 129 56871 0.46% 130 59257 0.48% 131 62345 0.51% 132 65528 0.53% 133 69908 0.57% 134 73299 0.60% 135 78595 0.64% 136 84478 0.69% 137 90152 0.74% 138 96858 0.79% 139 104454 0.85% 140 113097 0.92% 141 124731 1.02% 142 139935 1.14% 143 158880 1.30% 144 186761 1.52% 145 221367 1.81% 146 277606 2.27% 147 368862 3.01% 148 551557 4.50% 149 1016277 8.29% 150 3204695 26.15% 151 3880743 31.67% 12252923 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=20 prefix-density=0.27 prefix-fanout=2.1 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=31.02 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.3 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=18 prefix-density=0.43 prefix-fanout=2.4 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=45.05 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=12.0 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7170864 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:56:39 Started mapping on | Feb 13 19:56:39 Finished on | Feb 13 19:57:48 Mapping speed, Million of reads per hour | 639.28 Number of input reads | 12252923 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 11738457 Uniquely mapped reads % | 95.80% Average mapped length | 288.94 Number of splices: Total | 11258959 Number of splices: Annotated (sjdb) | 10963886 Number of splices: GT/AG | 11049889 Number of splices: GC/AG | 158979 Number of splices: AT/AC | 7168 Number of splices: Non-canonical | 42923 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 300080 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 12362 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.62% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 222471 222471 222471 N_multimapping 300080 300080 300080 N_noFeature 573787 11480140 695681 N_ambiguous 215881 1027 78749 UnstrandedReadsAssigned:10948789 PositiveStrandReadsAssigned:257290 NegativeStrandReadsAssigned:10964027 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR7170864 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170864-trimmed-pair1.fastq SRR7170864-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,252,923 reads, 10,903,903 reads pseudoaligned [quant] estimated average fragment length: 232.752 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,217 rounds 52401 SRR7170864.ke.tsv 34699 SRR7170864.se.tsv 87100 total ==> SRR7170864.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.25 773 33.6561 Potri.005G024800.1.v4.1 1035 803.248 250 24.2057 Potri.004G059700.1.v4.1 961 729.294 9 0.959768 Potri.007G009000.2.v4.1 1416 1184.25 0 0 Potri.003G141000.2.v4.1 2943 2711.25 682.814 19.5866 Potri.016G087400.1.v4.1 270 90.0444 728 628.783 Potri.015G069301.1.v4.1 564 338.925 0 0 Potri.010G195200.1.v4.1 1773 1541.25 105 5.29838 Potri.012G127500.1.v4.1 977 745.269 451 47.0641 ==> SRR7170864.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 200 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 285 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 53 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 13 SRR7170864 completed mapping pipeline successfully