Starting /dee2/code/volunteer_pipeline.sh SRR7170865 current disk space = 3087583080448 free memory = 1434356012 SRR7170865 SRAfilesize 93f1af8c4c1a7db44b89f6946e463b8b SRR7170865.sra SRR7170865.sra file validated SRR7170865 is paired end SRR7170865 is conventional basespace SRR7170865 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170865_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.728 34.0 33.0 34.0 32.0 34.0 2 33.28 34.0 33.0 34.0 32.0 34.0 3 33.263 34.0 33.0 34.0 33.0 34.0 4 33.3475 34.0 33.0 34.0 33.0 34.0 5 33.2995 34.0 33.0 34.0 33.0 34.0 6 36.91675 38.0 37.0 38.0 35.0 38.0 7 37.251 38.0 38.0 38.0 36.0 38.0 8 37.46975 38.0 38.0 38.0 37.0 38.0 9 37.50325 38.0 38.0 38.0 37.0 38.0 10-14 37.477850000000004 38.0 38.0 38.0 37.2 38.0 15-19 37.4353 38.0 38.0 38.0 37.0 38.0 20-24 37.37835 38.0 38.0 38.0 37.0 38.0 25-29 37.3467 38.0 38.0 38.0 37.0 38.0 30-34 37.3457 38.0 38.0 38.0 37.0 38.0 35-39 37.302150000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.2245 38.0 38.0 38.0 36.6 38.0 45-49 37.07695 38.0 38.0 38.0 36.0 38.0 50-54 37.0093 38.0 38.0 38.0 36.0 38.0 55-59 36.9972 38.0 38.0 38.0 36.0 38.0 60-64 36.9014 38.0 38.0 38.0 36.0 38.0 65-69 36.89665 38.0 38.0 38.0 35.4 38.0 70-74 36.8069 38.0 38.0 38.0 35.4 38.0 75-79 36.58385 38.0 38.0 38.0 34.4 38.0 80-84 36.540549999999996 38.0 38.0 38.0 34.4 38.0 85-89 36.43465 38.0 38.0 38.0 34.0 38.0 90-94 36.3729 38.0 38.0 38.0 34.0 38.0 95-99 36.300850000000004 38.0 38.0 38.0 34.0 38.0 100-104 35.97135 38.0 37.0 38.0 32.8 38.0 105-109 35.9269 38.0 37.0 38.0 33.0 38.0 110-114 35.693149999999996 38.0 37.0 38.0 31.4 38.0 115-119 35.428 38.0 36.2 38.0 30.2 38.0 120-124 35.115750000000006 38.0 36.0 38.0 28.2 38.0 125-129 35.0509 38.0 35.8 38.0 27.8 38.0 130-134 34.41125 38.0 34.8 38.0 25.0 38.0 135-139 34.22735 38.0 34.0 38.0 23.8 38.0 140-144 33.8205 38.0 33.2 38.0 23.6 38.0 145-149 32.9054 38.0 33.0 38.0 15.8 38.0 150-151 27.99625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 1.0 15 3.0 16 2.0 17 6.0 18 5.0 19 10.0 20 7.0 21 5.0 22 5.0 23 8.0 24 16.0 25 15.0 26 20.0 27 28.0 28 32.0 29 41.0 30 46.0 31 49.0 32 88.0 33 128.0 34 171.0 35 287.0 36 759.0 37 2265.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.61224489795918 13.724489795918368 10.229591836734695 35.433673469387756 2 20.45 19.575 36.25 23.724999999999998 3 18.3 25.7 29.225 26.775 4 22.400000000000002 34.050000000000004 23.0 20.549999999999997 5 21.75 36.1 24.95 17.2 6 17.875 36.9 26.25 18.975 7 13.4 23.575 44.9 18.125 8 17.75 24.5 30.8 26.950000000000003 9 17.549999999999997 23.25 33.25 25.95 10-14 19.91 29.654999999999998 26.71 23.724999999999998 15-19 19.6 28.715000000000003 27.97 23.715 20-24 19.665 28.71 28.075 23.549999999999997 25-29 19.875 29.715000000000003 27.034999999999997 23.375 30-34 19.634999999999998 28.84 27.79 23.735 35-39 19.564999999999998 28.915000000000003 28.46 23.06 40-44 20.044999999999998 29.360000000000003 27.384999999999998 23.21 45-49 19.919999999999998 29.095 27.474999999999998 23.51 50-54 20.315 28.310000000000002 28.285 23.09 55-59 19.665 29.020000000000003 27.779999999999998 23.535 60-64 20.705000000000002 27.894999999999996 27.725 23.674999999999997 65-69 19.794999999999998 28.935 28.38 22.89 70-74 20.244999999999997 28.999999999999996 27.200000000000003 23.555 75-79 19.919999999999998 28.625 27.63 23.825 80-84 19.939999999999998 28.565 28.04 23.455000000000002 85-89 20.075000000000003 28.895 27.365000000000002 23.665 90-94 20.735 28.785 27.46 23.02 95-99 20.34 29.104999999999997 27.46 23.095 100-104 20.39 28.725 27.439999999999998 23.445 105-109 20.32 28.985 27.150000000000002 23.544999999999998 110-114 20.64 27.994999999999997 27.42 23.945 115-119 21.035 28.46 27.310000000000002 23.195 120-124 20.78 28.215 26.35 24.654999999999998 125-129 21.17 28.405 26.395000000000003 24.03 130-134 20.785 28.88 26.77 23.565 135-139 21.035 28.7 26.029999999999998 24.235 140-144 20.555 29.17 25.97 24.305 145-149 20.831041552077604 27.951397569878495 26.71633581679084 24.501225061253063 150-151 20.930232558139537 27.45686421605401 26.994248562140534 24.618654663665918 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 2.5 23 3.0 24 5.5 25 9.0 26 7.5 27 10.5 28 18.0 29 22.5 30 26.5 31 39.5 32 46.5 33 51.0 34 67.5 35 91.0 36 105.0 37 114.0 38 133.5 39 159.5 40 193.0 41 226.5 42 223.0 43 235.5 44 261.0 45 244.5 46 240.0 47 250.0 48 235.5 49 188.0 50 162.0 51 146.5 52 115.5 53 86.5 54 65.5 55 56.0 56 43.0 57 30.5 58 30.5 59 25.5 60 12.0 61 4.5 62 2.5 63 2.0 64 1.5 65 0.5 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24242424242425 98.25 2 0.7070707070707071 1.4000000000000001 3 0.025252525252525252 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025252525252525252 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.8375 0.0 0.0 0.0 0.0 90-91 1.0 0.0 0.0 0.0 0.0 92-93 1.1749999999999998 0.0 0.0 0.0 0.0 94-95 1.3875 0.0 0.0 0.0 0.0 96-97 1.575 0.0 0.0 0.0 0.0 98-99 1.7875 0.0 0.0 0.0 0.0 100-101 2.0999999999999996 0.0 0.0 0.0 0.0 102-103 2.375 0.0 0.0 0.0 0.0 104-105 2.7625 0.0 0.0 0.0 0.0 106-107 3.2625 0.0 0.0 0.0 0.0 108-109 3.8375 0.0 0.0 0.0 0.0 110-111 4.2625 0.0 0.0 0.0 0.0 112-113 4.825 0.0 0.0 0.0 0.0 114-115 5.35 0.0 0.0 0.0 0.0 116-117 5.9 0.0 0.0 0.0 0.0 118-119 6.675 0.0 0.0 0.0 0.0 120-121 7.4 0.0 0.0 0.0 0.0 122-123 7.8125 0.0 0.0 0.0 0.0 124-125 8.35 0.0 0.0 0.0 0.0 126-127 9.05 0.0 0.0 0.0 0.0 128-129 9.6375 0.0 0.0 0.0 0.0 130-131 10.3625 0.0 0.0 0.0 0.0 132-133 11.1625 0.0 0.0 0.0 0.0 134-135 11.9625 0.0 0.0 0.0 0.0 136-137 12.825 0.0 0.0 0.0 0.0 138-139 13.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170865 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170865_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9935 33.0 33.0 34.0 32.0 34.0 2 33.089 34.0 33.0 34.0 33.0 34.0 3 33.112 34.0 33.0 34.0 33.0 34.0 4 33.08925 34.0 33.0 34.0 33.0 34.0 5 33.09875 34.0 33.0 34.0 33.0 34.0 6 37.20275 38.0 38.0 38.0 37.0 38.0 7 37.22575 38.0 38.0 38.0 37.0 38.0 8 37.19675 38.0 38.0 38.0 37.0 38.0 9 37.24825 38.0 38.0 38.0 37.0 38.0 10-14 37.168350000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.1276 38.0 38.0 38.0 37.0 38.0 20-24 37.1343 38.0 38.0 38.0 37.0 38.0 25-29 37.10475 38.0 38.0 38.0 37.0 38.0 30-34 37.10119999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.064049999999995 38.0 38.0 38.0 37.0 38.0 40-44 36.994150000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.0428 38.0 38.0 38.0 36.8 38.0 50-54 37.01025 38.0 38.0 38.0 36.6 38.0 55-59 36.9422 38.0 38.0 38.0 36.2 38.0 60-64 36.8294 38.0 38.0 38.0 36.0 38.0 65-69 36.844449999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.7544 38.0 38.0 38.0 36.0 38.0 75-79 36.647149999999996 38.0 38.0 38.0 35.6 38.0 80-84 36.44115 38.0 38.0 38.0 34.6 38.0 85-89 36.40625 38.0 38.0 38.0 34.4 38.0 90-94 36.3131 38.0 38.0 38.0 34.0 38.0 95-99 36.29205 38.0 38.0 38.0 34.2 38.0 100-104 36.128499999999995 38.0 38.0 38.0 33.8 38.0 105-109 36.0148 38.0 37.8 38.0 33.8 38.0 110-114 35.640499999999996 38.0 37.0 38.0 32.2 38.0 115-119 35.405499999999996 38.0 37.0 38.0 30.2 38.0 120-124 35.146699999999996 38.0 36.2 38.0 28.8 38.0 125-129 34.82875 38.0 36.0 38.0 27.6 38.0 130-134 34.3832 38.0 35.2 38.0 24.4 38.0 135-139 33.753949999999996 38.0 34.2 38.0 22.2 38.0 140-144 33.3806 38.0 33.0 38.0 20.8 38.0 145-149 32.404450000000004 38.0 33.0 38.0 12.4 38.0 150-151 27.090249999999997 34.0 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 5.0 4 2.0 5 1.0 6 3.0 7 1.0 8 0.0 9 0.0 10 1.0 11 3.0 12 1.0 13 1.0 14 2.0 15 2.0 16 0.0 17 5.0 18 8.0 19 9.0 20 13.0 21 11.0 22 9.0 23 15.0 24 14.0 25 26.0 26 18.0 27 27.0 28 35.0 29 31.0 30 33.0 31 59.0 32 76.0 33 89.0 34 127.0 35 265.0 36 646.0 37 2451.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.5 18.325 12.75 26.424999999999997 2 24.775 25.124999999999996 33.875 16.225 3 20.775 27.950000000000003 31.900000000000002 19.375 4 24.6 34.8 21.8 18.8 5 25.25 36.35 22.075 16.325 6 19.494494494494493 37.23723723723724 24.6996996996997 18.56856856856857 7 19.43471735867934 19.259629814907452 41.44572286143072 19.85992996498249 8 20.980245061265315 24.031007751937985 29.107276819204802 25.881470367591895 9 22.0360180090045 24.362181090545274 29.839919959979987 23.761880940470235 10-14 23.580654851306697 28.70231300690898 26.15900670872134 21.558025433062983 15-19 23.00375469336671 27.964956195244056 28.240300375469335 20.7909887359199 20-24 22.815363813911564 28.44909609895338 28.068506184586106 20.66703390254895 25-29 22.95016278487353 28.30954169797145 27.64838467317806 21.09191084397696 30-34 22.283996994740797 28.249436513899322 28.790383170548463 20.67618332081142 35-39 23.201763173712685 27.9853736726107 28.115608094570227 20.697255059106393 40-44 23.146663995191343 28.225806451612907 27.8651572831096 20.762372270086153 45-49 23.07653776798237 27.980364656381486 28.13564415948708 20.80745341614907 50-54 23.075381918357124 27.588279489105936 28.745304282494367 20.591034310042573 55-59 23.106591865357643 27.885193348026448 28.200761370466843 20.80745341614907 60-64 23.39594290007513 27.923866766841975 27.893814174805907 20.786376158276983 65-69 23.105434510393188 27.352867518156778 28.259454044578014 21.282243926872027 70-74 23.63754758565418 27.73993187737928 28.225806451612907 20.396714085353636 75-79 22.602945596633603 27.862939585211905 28.34385332131049 21.190261496844006 80-84 23.26921150185352 28.33383428514177 27.617473199078248 20.77948101392646 85-89 23.617511520737327 27.855139250651174 28.185734321779204 20.341614906832298 90-94 23.75012523795211 27.291854523594832 28.469091273419494 20.488928965033566 95-99 24.202194278843745 27.77415961124192 27.88437453033415 20.139271579580182 100-104 23.793777243348867 27.92224059321609 27.786963274713163 20.49701888872188 105-109 23.61076314075262 28.00020043092649 28.300846820664425 20.088189607656464 110-114 24.34856684706354 28.332331128482664 27.55562236921227 19.763479655241532 115-119 24.753169949381046 28.27644965669323 27.183882122989022 19.7864982709367 120-124 24.589096011224694 28.31729805572259 27.445379835638406 19.648226097414312 125-129 25.08269018743109 27.839029768467476 27.593464969429686 19.484815074671747 130-134 25.72287647206214 28.30368328739664 26.539714357303936 19.433725883237287 135-139 26.273055332798716 28.122493985565356 26.944667201283078 18.659783480352846 140-144 26.27755511022044 28.401803607214426 26.58817635270541 18.73246492985972 145-149 26.749837166190694 28.44330878300516 26.589508492409443 18.217345558394708 150-151 26.766032064128257 28.1312625250501 26.91633266533066 18.18637274549098 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.5 4 2.0 5 1.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 1.0 19 1.5 20 1.0 21 0.5 22 1.0 23 2.0 24 2.5 25 2.5 26 4.5 27 7.5 28 7.0 29 15.5 30 22.5 31 23.0 32 31.5 33 43.0 34 53.5 35 67.5 36 90.0 37 117.0 38 141.0 39 157.0 40 180.5 41 224.0 42 246.0 43 259.5 44 263.5 45 258.5 46 260.0 47 245.0 48 232.5 49 206.5 50 165.5 51 132.5 52 111.0 53 99.5 54 77.5 55 55.5 56 52.5 57 42.0 58 27.5 59 20.5 60 14.0 61 7.5 62 4.5 63 3.5 64 3.5 65 2.0 66 0.5 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.05 8 0.025 9 0.05 10-14 0.13 15-19 0.125 20-24 0.155 25-29 0.17500000000000002 30-34 0.17500000000000002 35-39 0.18 40-44 0.18 45-49 0.18 50-54 0.17500000000000002 55-59 0.18 60-64 0.17500000000000002 65-69 0.17500000000000002 70-74 0.18 75-79 0.19 80-84 0.19 85-89 0.18 90-94 0.19 95-99 0.19499999999999998 100-104 0.20500000000000002 105-109 0.215 110-114 0.22 115-119 0.23500000000000001 120-124 0.22 125-129 0.22999999999999998 130-134 0.22499999999999998 135-139 0.24 140-144 0.2 145-149 0.20500000000000002 150-151 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44500504540868 98.55000000000001 2 0.4288597376387487 0.8500000000000001 3 0.10090817356205853 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025227043390514632 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 12 0.3 Illumina Single End PCR Primer 1 (97% over 34bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.65 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 90-91 0.975 0.0 0.0 0.0 0.0 92-93 1.15 0.0 0.0 0.0 0.0 94-95 1.3625 0.0 0.0 0.0 0.0 96-97 1.5375 0.0 0.0 0.0 0.0 98-99 1.7375 0.0 0.0 0.0 0.0 100-101 2.0250000000000004 0.0 0.0 0.0 0.0 102-103 2.2625 0.0 0.0 0.0 0.0 104-105 2.6624999999999996 0.0 0.0 0.0 0.0 106-107 3.125 0.0 0.0 0.0 0.0 108-109 3.7125 0.0 0.0 0.0 0.0 110-111 4.1375 0.0 0.0 0.0 0.0 112-113 4.7 0.0 0.0 0.0 0.0 114-115 5.25 0.0 0.0 0.0 0.0 116-117 5.7875 0.0 0.0 0.0 0.0 118-119 6.5875 0.0 0.0 0.0 0.0 120-121 7.35 0.0 0.0 0.0 0.0 122-123 7.800000000000001 0.0 0.0 0.0 0.0 124-125 8.35 0.0 0.0 0.0 0.0 126-127 9.025 0.0 0.0 0.0 0.0 128-129 9.6375 0.0 0.0 0.0 0.0 130-131 10.325 0.0 0.0 0.0 0.0 132-133 11.1125 0.0 0.0 0.0 0.0 134-135 11.8875 0.0 0.0 0.0 0.0 136-137 12.725 0.0 0.0 0.0 0.0 138-139 13.600000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTTGA 10 0.006830828 145.0 7 AGGAACC 10 0.006830828 145.0 3 GAACCAC 10 0.006830828 145.0 5 TCTCCGG 10 0.006830828 145.0 7 AGTTTCA 10 0.006830828 145.0 7 >>END_MODULE Read 616288 spots for SRR7170865.sra Written 616288 spots for SRR7170865.sra Read 616288 spots for SRR7170865.sra Written 616288 spots for SRR7170865.sra Read 616288 spots for SRR7170865.sra Written 616288 spots for SRR7170865.sra Read 616288 spots for SRR7170865.sra Written 616288 spots for SRR7170865.sra Read 616288 spots for SRR7170865.sra Written 616288 spots for SRR7170865.sra Read 616288 spots for SRR7170865.sra Written 616288 spots for SRR7170865.sra Read 616288 spots for SRR7170865.sra Written 616288 spots for SRR7170865.sra Read 616288 spots for SRR7170865.sra Written 616288 spots for SRR7170865.sra Read 616288 spots for SRR7170865.sra Written 616288 spots for SRR7170865.sra Read 616288 spots for SRR7170865.sra Written 616288 spots for SRR7170865.sra Read 616288 spots for SRR7170865.sra Written 616288 spots for SRR7170865.sra Read 616288 spots for SRR7170865.sra Written 616288 spots for SRR7170865.sra Read 616288 spots for SRR7170865.sra Written 616288 spots for SRR7170865.sra Read 616288 spots for SRR7170865.sra Written 616288 spots for SRR7170865.sra Read 616288 spots for SRR7170865.sra Written 616288 spots for SRR7170865.sra Read 616288 spots for SRR7170865.sra Written 616288 spots for SRR7170865.sra Read 616288 spots for SRR7170865.sra Written 616288 spots for SRR7170865.sra Read 616288 spots for SRR7170865.sra Written 616288 spots for SRR7170865.sra Read 616288 spots for SRR7170865.sra Written 616288 spots for SRR7170865.sra Read 616300 spots for SRR7170865.sra Written 616300 spots for SRR7170865.sra SRR ids: ['SRR7170865.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_klkblzv5 SRR7170865.sra spots: 12325772 blocks: [[1, 616288], [616289, 1232576], [1232577, 1848864], [1848865, 2465152], [2465153, 3081440], [3081441, 3697728], [3697729, 4314016], [4314017, 4930304], [4930305, 5546592], [5546593, 6162880], [6162881, 6779168], [6779169, 7395456], [7395457, 8011744], [8011745, 8628032], [8628033, 9244320], [9244321, 9860608], [9860609, 10476896], [10476897, 11093184], [11093185, 11709472], [11709473, 12325772]] SRR7170865 file size 4155099 SRR7170865 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170865 SRR7170865_1.fastq SRR7170865_2.fastq Input file: SRR7170865_1.fastq Paired file: SRR7170865_2.fastq trimmed: SRR7170865-trimmed-pair1.fastq, SRR7170865-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:11:25 2025 >> started Thu Feb 13 20:11:40 2025 >> done (14.590s) 12325772 read pairs processed; of these: 15331 ( 0.12%) short read pairs filtered out after trimming by size control 52654 ( 0.43%) empty read pairs filtered out after trimming by size control 12257787 (99.45%) read pairs available; of these: 7948158 (64.84%) trimmed read pairs available after processing 4309629 (35.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 10 0.00% 20 15 0.00% 21 20 0.00% 22 17 0.00% 23 18 0.00% 24 17 0.00% 25 23 0.00% 26 13 0.00% 27 29 0.00% 28 19 0.00% 29 20 0.00% 30 27 0.00% 31 28 0.00% 32 22 0.00% 33 40 0.00% 34 38 0.00% 35 36 0.00% 36 40 0.00% 37 60 0.00% 38 70 0.00% 39 80 0.00% 40 123 0.00% 41 78 0.00% 42 67 0.00% 43 102 0.00% 44 106 0.00% 45 103 0.00% 46 137 0.00% 47 143 0.00% 48 192 0.00% 49 222 0.00% 50 227 0.00% 51 284 0.00% 52 330 0.00% 53 334 0.00% 54 402 0.00% 55 376 0.00% 56 447 0.00% 57 526 0.00% 58 543 0.00% 59 647 0.01% 60 718 0.01% 61 856 0.01% 62 962 0.01% 63 1104 0.01% 64 1165 0.01% 65 1222 0.01% 66 1309 0.01% 67 1425 0.01% 68 1682 0.01% 69 1824 0.01% 70 2209 0.02% 71 2494 0.02% 72 2903 0.02% 73 3179 0.03% 74 3677 0.03% 75 4213 0.03% 76 6687 0.05% 77 5899 0.05% 78 5045 0.04% 79 5403 0.04% 80 5881 0.05% 81 6823 0.06% 82 7601 0.06% 83 8569 0.07% 84 10250 0.08% 85 11022 0.09% 86 10727 0.09% 87 11643 0.09% 88 11742 0.10% 89 12634 0.10% 90 13571 0.11% 91 14620 0.12% 92 16002 0.13% 93 17488 0.14% 94 18773 0.15% 95 20015 0.16% 96 20137 0.16% 97 21095 0.17% 98 21521 0.18% 99 22508 0.18% 100 23610 0.19% 101 24840 0.20% 102 26312 0.21% 103 28214 0.23% 104 29012 0.24% 105 30455 0.25% 106 31281 0.26% 107 32080 0.26% 108 32679 0.27% 109 33629 0.27% 110 34392 0.28% 111 35805 0.29% 112 36960 0.30% 113 38466 0.31% 114 39812 0.32% 115 41438 0.34% 116 42356 0.35% 117 43411 0.35% 118 43530 0.36% 119 44809 0.37% 120 45734 0.37% 121 46929 0.38% 122 48316 0.39% 123 50073 0.41% 124 51635 0.42% 125 53625 0.44% 126 55296 0.45% 127 56925 0.46% 128 57675 0.47% 129 59629 0.49% 130 61074 0.50% 131 62526 0.51% 132 65257 0.53% 133 68871 0.56% 134 71758 0.59% 135 75300 0.61% 136 79199 0.65% 137 84239 0.69% 138 87834 0.72% 139 94473 0.77% 140 101542 0.83% 141 109220 0.89% 142 120876 0.99% 143 135499 1.11% 144 156878 1.28% 145 185546 1.51% 146 232192 1.89% 147 308549 2.52% 148 452758 3.69% 149 835503 6.82% 150 2997488 24.45% 151 4309629 35.16% 12257787 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=13 prefix-density=0.54 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=57.16 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.3 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACAT criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=20 prefix-density=0.64 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=11.59 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATAC SRR7170865 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:12:25 Started mapping on | Feb 13 20:12:26 Finished on | Feb 13 20:13:56 Mapping speed, Million of reads per hour | 490.31 Number of input reads | 12257787 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 11661243 Uniquely mapped reads % | 95.13% Average mapped length | 286.68 Number of splices: Total | 10498255 Number of splices: Annotated (sjdb) | 10237662 Number of splices: GT/AG | 10290754 Number of splices: GC/AG | 163200 Number of splices: AT/AC | 6968 Number of splices: Non-canonical | 37333 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 336914 % of reads mapped to multiple loci | 2.75% Number of reads mapped to too many loci | 21133 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.90% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 270329 270329 270329 N_multimapping 336914 336914 336914 N_noFeature 507079 11430924 623810 N_ambiguous 192631 1030 78335 UnstrandedReadsAssigned:10961533 PositiveStrandReadsAssigned:229289 NegativeStrandReadsAssigned:10959098 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR7170865 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170865-trimmed-pair1.fastq SRR7170865-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,257,787 reads, 10,958,356 reads pseudoaligned [quant] estimated average fragment length: 219.513 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52401 SRR7170865.ke.tsv 34699 SRR7170865.se.tsv 87100 total ==> SRR7170865.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.49 399 19.1446 Potri.005G024800.1.v4.1 1035 816.487 151 15.968 Potri.004G059700.1.v4.1 961 742.506 13 1.5117 Potri.007G009000.2.v4.1 1416 1197.49 0 0 Potri.003G141000.2.v4.1 2943 2724.49 571 18.0956 Potri.016G087400.1.v4.1 270 95.6123 623 562.596 Potri.015G069301.1.v4.1 564 349.951 0 0 Potri.010G195200.1.v4.1 1773 1554.49 61 3.38817 Potri.012G127500.1.v4.1 977 758.506 143 16.2779 ==> SRR7170865.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 621 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 236 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7170865 completed mapping pipeline successfully