Starting /dee2/code/volunteer_pipeline.sh SRR7170866 current disk space = 3087599869952 free memory = 1409703472 SRR7170866 SRAfilesize 1b658597479d89d8751d47b93b31aa9d SRR7170866.sra SRR7170866.sra file validated SRR7170866 is paired end SRR7170866 is conventional basespace SRR7170866 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170866_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96825 34.0 33.0 34.0 33.0 34.0 2 33.32175 34.0 33.0 34.0 33.0 34.0 3 33.2955 34.0 33.0 34.0 33.0 34.0 4 33.3075 34.0 33.0 34.0 33.0 34.0 5 33.34075 34.0 33.0 34.0 33.0 34.0 6 36.8105 38.0 37.0 38.0 35.0 38.0 7 37.27725 38.0 38.0 38.0 36.0 38.0 8 37.39875 38.0 38.0 38.0 37.0 38.0 9 37.497 38.0 38.0 38.0 37.0 38.0 10-14 37.482949999999995 38.0 38.0 38.0 37.2 38.0 15-19 37.4471 38.0 38.0 38.0 37.0 38.0 20-24 37.36229999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.35600000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.303399999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.325450000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.181200000000004 38.0 38.0 38.0 36.6 38.0 45-49 37.0532 38.0 38.0 38.0 36.0 38.0 50-54 36.96385 38.0 38.0 38.0 35.8 38.0 55-59 36.94315 38.0 38.0 38.0 35.6 38.0 60-64 36.935 38.0 38.0 38.0 35.4 38.0 65-69 36.86355 38.0 38.0 38.0 35.4 38.0 70-74 36.76199999999999 38.0 38.0 38.0 35.0 38.0 75-79 36.715650000000004 38.0 38.0 38.0 35.0 38.0 80-84 36.520799999999994 38.0 38.0 38.0 34.0 38.0 85-89 36.41949999999999 38.0 37.8 38.0 34.0 38.0 90-94 36.31995 38.0 37.4 38.0 34.0 38.0 95-99 36.16265 38.0 37.2 38.0 33.4 38.0 100-104 36.0823 38.0 37.0 38.0 33.0 38.0 105-109 35.68245 38.0 36.8 38.0 31.0 38.0 110-114 35.517 38.0 36.2 38.0 30.2 38.0 115-119 35.171549999999996 38.0 36.0 38.0 28.6 38.0 120-124 34.77535 38.0 35.0 38.0 26.8 38.0 125-129 34.47324999999999 38.0 34.0 38.0 25.4 38.0 130-134 33.95635 38.0 33.2 38.0 23.2 38.0 135-139 33.3472 38.0 33.0 38.0 20.4 38.0 140-144 32.54205 38.0 32.6 38.0 15.2 38.0 145-149 31.593700000000002 37.8 32.0 38.0 10.4 38.0 150-151 25.125375 32.0 16.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 2.0 15 1.0 16 3.0 17 2.0 18 4.0 19 7.0 20 5.0 21 4.0 22 5.0 23 6.0 24 13.0 25 14.0 26 29.0 27 29.0 28 39.0 29 49.0 30 58.0 31 65.0 32 96.0 33 155.0 34 209.0 35 414.0 36 941.0 37 1846.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.094034378159755 15.242669362992922 10.18705763397371 36.47623862487361 2 19.7 19.5 37.7 23.1 3 16.400000000000002 26.450000000000003 30.525000000000002 26.625 4 22.25 32.550000000000004 23.175 22.025 5 21.2 36.8 25.074999999999996 16.925 6 17.9 36.525 24.95 20.625 7 14.674999999999999 21.75 45.025 18.55 8 17.825 24.2 31.525 26.450000000000003 9 17.125 24.0 32.725 26.150000000000002 10-14 19.975 29.9 26.529999999999998 23.595 15-19 19.55 28.71 28.065 23.674999999999997 20-24 19.71 28.87 28.075 23.345 25-29 19.425 29.34 27.905 23.330000000000002 30-34 19.675 29.060000000000002 28.139999999999997 23.125 35-39 19.7 28.854999999999997 27.96 23.485 40-44 20.11 29.4 27.715 22.775000000000002 45-49 20.405 28.825 27.644999999999996 23.125 50-54 20.044999999999998 29.455 27.544999999999998 22.955000000000002 55-59 20.625 28.544999999999998 27.54 23.29 60-64 20.05 28.884999999999998 27.63 23.435 65-69 19.6 29.2 27.855 23.345 70-74 19.994999999999997 28.715000000000003 27.6 23.69 75-79 20.1 28.98 27.77 23.150000000000002 80-84 20.055 29.195 27.465 23.285 85-89 20.265 28.625 27.67 23.44 90-94 20.155 28.194999999999997 28.515 23.135 95-99 20.195 28.735 27.145000000000003 23.925 100-104 20.405 28.21 27.725 23.66 105-109 21.16 28.87 27.400000000000002 22.57 110-114 20.45 28.225 27.365000000000002 23.96 115-119 20.445 28.51 27.425 23.62 120-124 20.47 28.975 26.534999999999997 24.02 125-129 21.060000000000002 27.939999999999998 27.315 23.685000000000002 130-134 21.23 28.395 26.810000000000002 23.565 135-139 21.14 28.465 26.22 24.175 140-144 21.099999999999998 27.839999999999996 26.275 24.785 145-149 21.02 28.4 26.450000000000003 24.13 150-151 21.2375 27.6875 26.4125 24.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 2.0 17 2.0 18 0.5 19 0.0 20 0.5 21 2.5 22 4.0 23 3.0 24 1.0 25 3.5 26 8.5 27 10.0 28 12.5 29 23.0 30 28.5 31 30.5 32 44.0 33 52.0 34 69.0 35 103.5 36 108.0 37 116.5 38 151.0 39 180.0 40 198.0 41 208.0 42 234.5 43 256.5 44 262.5 45 261.5 46 246.5 47 215.0 48 210.0 49 199.5 50 162.0 51 131.5 52 101.5 53 75.0 54 58.5 55 53.0 56 49.0 57 37.5 58 21.0 59 19.0 60 15.0 61 8.0 62 5.5 63 3.5 64 3.0 65 2.0 66 1.5 67 1.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24261550113607 98.275 2 0.6311537490532694 1.25 3 0.07573844988639232 0.22499999999999998 4 0.0 0.0 5 0.050492299924261554 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 5 0.125 TruSeq Adapter, Index 8 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.5375000000000001 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.7625 0.0 0.0 0.025 0.0 90-91 0.875 0.0 0.0 0.025 0.0 92-93 0.925 0.0 0.0 0.025 0.0 94-95 1.1625 0.0 0.0 0.025 0.0 96-97 1.3624999999999998 0.0 0.0 0.025 0.0 98-99 1.625 0.0 0.0 0.025 0.0 100-101 1.8625 0.0 0.0 0.025 0.0 102-103 2.05 0.0 0.0 0.025 0.0 104-105 2.375 0.0 0.0 0.025 0.0 106-107 2.7125 0.0 0.0 0.025 0.0 108-109 3.125 0.0 0.0 0.025 0.0 110-111 3.7125000000000004 0.0 0.0 0.025 0.0 112-113 4.075 0.0 0.0 0.025 0.0 114-115 4.3625 0.0 0.0 0.025 0.0 116-117 4.775 0.0 0.0 0.025 0.0 118-119 5.2875 0.0 0.0 0.025 0.0 120-121 5.699999999999999 0.0 0.0 0.025 0.0 122-123 6.3875 0.0 0.0 0.025 0.0 124-125 6.975 0.0 0.0 0.025 0.0 126-127 7.6375 0.0 0.0 0.025 0.0 128-129 8.3625 0.0 0.0 0.025 0.0 130-131 8.9875 0.0 0.0 0.025 0.0 132-133 9.6375 0.0 0.0 0.025 0.0 134-135 10.325 0.0 0.0 0.025 0.0 136-137 10.9375 0.0 0.0 0.025 0.0 138-139 11.7 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCGT 20 0.0059376103 28.9975 135-139 CGTATGC 20 0.0059376103 28.9975 140-144 >>END_MODULE SRR7170866 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170866_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.888 33.0 33.0 34.0 32.0 34.0 2 33.02825 33.0 33.0 34.0 32.0 34.0 3 33.0485 34.0 33.0 34.0 32.0 34.0 4 33.05375 34.0 33.0 34.0 32.0 34.0 5 33.0595 34.0 33.0 34.0 32.0 34.0 6 37.20825 38.0 38.0 38.0 37.0 38.0 7 37.3155 38.0 38.0 38.0 37.0 38.0 8 37.31525 38.0 38.0 38.0 37.0 38.0 9 37.3385 38.0 38.0 38.0 37.0 38.0 10-14 37.268299999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.218149999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.08425 38.0 38.0 38.0 36.8 38.0 25-29 37.113550000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.12075000000001 38.0 38.0 38.0 36.8 38.0 35-39 37.028 38.0 38.0 38.0 36.6 38.0 40-44 37.07415 38.0 38.0 38.0 36.6 38.0 45-49 37.05575 38.0 38.0 38.0 36.4 38.0 50-54 37.005399999999995 38.0 38.0 38.0 36.2 38.0 55-59 36.93115 38.0 38.0 38.0 36.0 38.0 60-64 36.9074 38.0 38.0 38.0 36.0 38.0 65-69 36.8781 38.0 38.0 38.0 36.0 38.0 70-74 36.8196 38.0 38.0 38.0 35.8 38.0 75-79 36.641650000000006 38.0 38.0 38.0 35.0 38.0 80-84 36.544399999999996 38.0 38.0 38.0 34.6 38.0 85-89 36.4821 38.0 38.0 38.0 34.6 38.0 90-94 36.1668 38.0 38.0 38.0 33.8 38.0 95-99 36.23435 38.0 38.0 38.0 34.0 38.0 100-104 36.0413 38.0 37.2 38.0 33.4 38.0 105-109 35.950500000000005 38.0 37.6 38.0 33.4 38.0 110-114 35.6896 38.0 37.0 38.0 31.8 38.0 115-119 35.335 38.0 36.6 38.0 30.0 38.0 120-124 35.16895 38.0 36.0 38.0 29.8 38.0 125-129 34.756550000000004 38.0 35.6 38.0 27.2 38.0 130-134 34.34035 38.0 34.8 38.0 25.4 38.0 135-139 33.652699999999996 38.0 33.0 38.0 22.2 38.0 140-144 32.9939 38.0 33.0 38.0 17.4 38.0 145-149 32.03775 38.0 33.0 38.0 10.4 38.0 150-151 26.652 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 2.0 5 1.0 6 0.0 7 1.0 8 2.0 9 0.0 10 3.0 11 1.0 12 2.0 13 3.0 14 0.0 15 1.0 16 3.0 17 5.0 18 3.0 19 7.0 20 15.0 21 10.0 22 11.0 23 14.0 24 18.0 25 23.0 26 25.0 27 19.0 28 33.0 29 42.0 30 45.0 31 59.0 32 72.0 33 103.0 34 152.0 35 279.0 36 713.0 37 2325.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.675 19.7 12.125 27.500000000000004 2 24.787393696848426 25.662831415707853 33.46673336668334 16.08304152076038 3 21.491118338754063 26.56992744558419 31.448586439829874 20.490367775831874 4 23.011505752876438 35.942971485742866 23.111555777888945 17.933966983491743 5 24.412206103051524 37.44372186093047 22.36118059029515 15.78289144572286 6 18.9 38.675 23.799999999999997 18.625 7 18.575 18.575 41.9 20.95 8 20.9 24.45 28.65 26.0 9 23.3 23.775 30.25 22.675 10-14 22.947294729472947 28.342834283428342 26.687668766876687 22.022202220222024 15-19 23.507052115634693 27.283184955486643 28.343503050915274 20.86625987796339 20-24 22.884875168859757 28.02821834192225 28.393455746235052 20.69345074298294 25-29 22.636977733299975 28.071053289967473 28.576432324243186 20.715536652489366 30-34 22.596947710783088 27.875906930197647 28.676507380535405 20.850637978483864 35-39 22.94565108597738 27.955159643679313 28.45060554499049 20.648583725352818 40-44 23.37603843459113 28.090281253127813 27.790011009908916 20.743669302372133 45-49 22.77321857485989 27.807245796637307 28.33767013610889 21.081865492393913 50-54 22.919481559325426 27.908722414051944 28.574288144923184 20.597507881699446 55-59 23.427255893098444 27.7113257594715 28.071668084680446 20.789750262749614 60-64 22.779362458089373 27.383275784416757 28.484211579842867 21.353150177651003 65-69 22.759345443627083 27.723565030275733 28.544262623229745 20.972826902867435 70-74 23.44993244257619 27.763599059200324 27.863684131511786 20.922784366711706 75-79 23.474953710654056 27.838662863433917 28.043837261672422 20.642546164239604 80-84 22.86715036277208 28.396297222917187 28.126094570928196 20.610457843382537 85-89 23.672754565924443 28.111083312484364 27.955966975231423 20.26019514635977 90-94 23.596236612951657 28.195375838254428 27.97517765989391 20.23320988890001 95-99 23.571214092683416 27.800020018016212 27.734961465318786 20.89380442398158 100-104 24.296867180462417 28.24542087879091 27.13442097888099 20.323290961865677 105-109 24.095481158985137 27.853675624280637 27.878696892358505 20.17214632437572 110-114 23.875068822263376 28.194604334551276 27.61399469442915 20.316332148756196 115-119 24.853610930383866 27.911515940143133 27.19083128972524 20.044041839747763 120-124 24.838596666833492 28.081677593714026 27.521145087833442 19.558580651619035 125-129 24.674674674674673 28.263263263263262 27.41741741741742 19.644644644644647 130-134 25.407867080372338 27.74997497747973 27.244520068061256 19.59763787408668 135-139 25.392853568211386 28.130317285557 27.274547092383145 19.202282053848464 140-144 25.5079571614453 28.07526774096687 27.16945250725653 19.247322590331297 145-149 25.836961417204623 28.389130761146973 27.233148175949555 18.54075964569884 150-151 26.8951713785339 27.920940705529144 27.1703777833375 18.01351013259945 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 1.5 14 1.0 15 0.5 16 1.0 17 1.0 18 1.0 19 0.5 20 0.5 21 0.5 22 0.5 23 2.5 24 2.5 25 3.5 26 9.0 27 10.0 28 11.0 29 11.0 30 17.0 31 25.5 32 28.5 33 41.5 34 54.5 35 71.5 36 90.0 37 110.0 38 140.5 39 151.5 40 169.5 41 203.5 42 247.5 43 273.0 44 278.0 45 286.0 46 272.0 47 257.5 48 233.5 49 199.0 50 168.5 51 130.5 52 106.0 53 86.5 54 69.0 55 62.5 56 49.5 57 37.0 58 26.0 59 18.5 60 10.5 61 7.5 62 6.0 63 2.0 64 1.5 65 1.0 66 1.0 67 2.0 68 1.5 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.075 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.03 20-24 0.065 25-29 0.075 30-34 0.075 35-39 0.09 40-44 0.09 45-49 0.08 50-54 0.08499999999999999 55-59 0.095 60-64 0.08499999999999999 65-69 0.08499999999999999 70-74 0.08499999999999999 75-79 0.08499999999999999 80-84 0.075 85-89 0.075 90-94 0.09 95-99 0.09 100-104 0.09 105-109 0.08499999999999999 110-114 0.105 115-119 0.095 120-124 0.095 125-129 0.1 130-134 0.09 135-139 0.09 140-144 0.09 145-149 0.08499999999999999 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19028340080972 98.0 2 0.6072874493927125 1.2 3 0.07591093117408906 0.22499999999999998 4 0.07591093117408906 0.3 5 0.025303643724696356 0.125 6 0.025303643724696356 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 0.875 0.0 0.0 0.0 0.0 94-95 1.1125 0.0 0.0 0.0 0.0 96-97 1.3375 0.0 0.0 0.0 0.0 98-99 1.6 0.0 0.0 0.0 0.0 100-101 1.8375 0.0 0.0 0.0 0.0 102-103 2.0250000000000004 0.0 0.0 0.0 0.0 104-105 2.35 0.0 0.0 0.0 0.0 106-107 2.6875 0.0 0.0 0.0 0.0 108-109 3.0625 0.0 0.0 0.0 0.0 110-111 3.6125 0.0 0.0 0.0 0.0 112-113 3.9875 0.0 0.0 0.0 0.0 114-115 4.3125 0.0 0.0 0.0 0.0 116-117 4.7125 0.0 0.0 0.0 0.0 118-119 5.25 0.0 0.0 0.0 0.0 120-121 5.675000000000001 0.0 0.0 0.0 0.0 122-123 6.3875 0.0 0.0 0.0 0.0 124-125 7.0 0.0 0.0 0.0 0.0 126-127 7.625 0.0 0.0 0.0 0.0 128-129 8.3375 0.0 0.0 0.0 0.0 130-131 8.962499999999999 0.0 0.0 0.0 0.0 132-133 9.5625 0.0 0.0 0.0 0.0 134-135 10.25 0.0 0.0 0.0 0.0 136-137 10.875 0.0 0.0 0.0 0.0 138-139 11.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATACCTG 10 0.006830828 145.0 6 ATCTCGG 20 0.00593511 29.0 140-144 >>END_MODULE Read 823720 spots for SRR7170866.sra Written 823720 spots for SRR7170866.sra Read 823720 spots for SRR7170866.sra Written 823720 spots for SRR7170866.sra Read 823720 spots for SRR7170866.sra Written 823720 spots for SRR7170866.sra Read 823720 spots for SRR7170866.sra Written 823720 spots for SRR7170866.sra Read 823720 spots for SRR7170866.sra Written 823720 spots for SRR7170866.sra Read 823720 spots for SRR7170866.sra Written 823720 spots for SRR7170866.sra Read 823720 spots for SRR7170866.sra Written 823720 spots for SRR7170866.sra Read 823720 spots for SRR7170866.sra Written 823720 spots for SRR7170866.sra Read 823720 spots for SRR7170866.sra Written 823720 spots for SRR7170866.sra Read 823720 spots for SRR7170866.sra Written 823720 spots for SRR7170866.sra Read 823720 spots for SRR7170866.sra Written 823720 spots for SRR7170866.sra Read 823720 spots for SRR7170866.sra Written 823720 spots for SRR7170866.sra Read 823720 spots for SRR7170866.sra Written 823720 spots for SRR7170866.sra Read 823720 spots for SRR7170866.sra Written 823720 spots for SRR7170866.sra Read 823720 spots for SRR7170866.sra Written 823720 spots for SRR7170866.sra Read 823720 spots for SRR7170866.sra Written 823720 spots for SRR7170866.sra Read 823727 spots for SRR7170866.sra Written 823727 spots for SRR7170866.sra Read 823720 spots for SRR7170866.sra Written 823720 spots for SRR7170866.sra Read 823720 spots for SRR7170866.sra Written 823720 spots for SRR7170866.sra Read 823720 spots for SRR7170866.sra Written 823720 spots for SRR7170866.sra SRR ids: ['SRR7170866.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_llc9qagh SRR7170866.sra spots: 16474407 blocks: [[1, 823720], [823721, 1647440], [1647441, 2471160], [2471161, 3294880], [3294881, 4118600], [4118601, 4942320], [4942321, 5766040], [5766041, 6589760], [6589761, 7413480], [7413481, 8237200], [8237201, 9060920], [9060921, 9884640], [9884641, 10708360], [10708361, 11532080], [11532081, 12355800], [12355801, 13179520], [13179521, 14003240], [14003241, 14826960], [14826961, 15650680], [15650681, 16474407]] SRR7170866 file size 5560935 SRR7170866 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170866 SRR7170866_1.fastq SRR7170866_2.fastq Input file: SRR7170866_1.fastq Paired file: SRR7170866_2.fastq trimmed: SRR7170866-trimmed-pair1.fastq, SRR7170866-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:14:42 2025 >> started Thu Feb 13 20:15:00 2025 >> done (17.879s) 16474407 read pairs processed; of these: 13584 ( 0.08%) short read pairs filtered out after trimming by size control 28577 ( 0.17%) empty read pairs filtered out after trimming by size control 16432246 (99.74%) read pairs available; of these: 11349497 (69.07%) trimmed read pairs available after processing 5082749 (30.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 12 0.00% 20 12 0.00% 21 16 0.00% 22 15 0.00% 23 14 0.00% 24 15 0.00% 25 6 0.00% 26 11 0.00% 27 12 0.00% 28 17 0.00% 29 29 0.00% 30 14 0.00% 31 17 0.00% 32 24 0.00% 33 19 0.00% 34 28 0.00% 35 25 0.00% 36 20 0.00% 37 37 0.00% 38 36 0.00% 39 34 0.00% 40 39 0.00% 41 52 0.00% 42 57 0.00% 43 63 0.00% 44 77 0.00% 45 85 0.00% 46 73 0.00% 47 116 0.00% 48 135 0.00% 49 172 0.00% 50 155 0.00% 51 213 0.00% 52 217 0.00% 53 239 0.00% 54 276 0.00% 55 322 0.00% 56 381 0.00% 57 412 0.00% 58 480 0.00% 59 570 0.00% 60 647 0.00% 61 783 0.00% 62 848 0.01% 63 972 0.01% 64 1018 0.01% 65 1125 0.01% 66 1226 0.01% 67 1441 0.01% 68 1524 0.01% 69 1841 0.01% 70 2101 0.01% 71 2485 0.02% 72 2792 0.02% 73 3111 0.02% 74 3485 0.02% 75 3871 0.02% 76 4896 0.03% 77 4975 0.03% 78 5077 0.03% 79 5609 0.03% 80 6107 0.04% 81 6978 0.04% 82 7845 0.05% 83 9192 0.06% 84 11006 0.07% 85 10734 0.07% 86 11256 0.07% 87 12346 0.08% 88 13162 0.08% 89 13776 0.08% 90 14730 0.09% 91 15935 0.10% 92 17516 0.11% 93 18823 0.11% 94 19896 0.12% 95 21307 0.13% 96 22282 0.14% 97 23394 0.14% 98 24406 0.15% 99 25294 0.15% 100 27302 0.17% 101 28080 0.17% 102 30457 0.19% 103 31573 0.19% 104 33592 0.20% 105 35128 0.21% 106 36299 0.22% 107 37469 0.23% 108 38679 0.24% 109 39901 0.24% 110 41164 0.25% 111 42818 0.26% 112 45008 0.27% 113 46584 0.28% 114 48668 0.30% 115 50649 0.31% 116 52401 0.32% 117 53823 0.33% 118 55335 0.34% 119 56308 0.34% 120 58384 0.36% 121 60480 0.37% 122 62521 0.38% 123 65619 0.40% 124 68428 0.42% 125 70577 0.43% 126 74044 0.45% 127 75914 0.46% 128 78770 0.48% 129 82180 0.50% 130 84818 0.52% 131 88711 0.54% 132 93216 0.57% 133 98841 0.60% 134 103986 0.63% 135 110440 0.67% 136 117399 0.71% 137 125344 0.76% 138 133905 0.81% 139 143834 0.88% 140 153856 0.94% 141 169177 1.03% 142 188425 1.15% 143 212818 1.30% 144 245875 1.50% 145 290528 1.77% 146 359874 2.19% 147 477372 2.91% 148 714065 4.35% 149 1316427 8.01% 150 4232057 25.75% 151 5082749 30.93% 16432246 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=26 prefix-density=0.67 prefix-fanout=1.9 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=76.62 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=11.0 sequence=ACCACACCAGAGGCCACAGACATGGCCAATACATAACAATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=23 prefix-density=1.11 prefix-fanout=1.0 sequence=ATCGTCGAGACCGAGAAGAACTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=26.51 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.3 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR7170866 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:15:43 Started mapping on | Feb 13 20:15:43 Finished on | Feb 13 20:17:21 Mapping speed, Million of reads per hour | 603.63 Number of input reads | 16432246 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 15587152 Uniquely mapped reads % | 94.86% Average mapped length | 287.43 Number of splices: Total | 14419862 Number of splices: Annotated (sjdb) | 14064837 Number of splices: GT/AG | 14146185 Number of splices: GC/AG | 210273 Number of splices: AT/AC | 9016 Number of splices: Non-canonical | 54388 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 433798 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 44226 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.16% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 422764 422764 422764 N_multimapping 433798 433798 433798 N_noFeature 651042 15236004 798494 N_ambiguous 316385 1363 111865 UnstrandedReadsAssigned:14619725 PositiveStrandReadsAssigned:349785 NegativeStrandReadsAssigned:14676793 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR7170866 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170866-trimmed-pair1.fastq SRR7170866-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,432,246 reads, 14,564,448 reads pseudoaligned [quant] estimated average fragment length: 226.61 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR7170866.ke.tsv 34699 SRR7170866.se.tsv 87100 total ==> SRR7170866.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.39 854 26.7447 Potri.005G024800.1.v4.1 1035 809.39 147 10.1946 Potri.004G059700.1.v4.1 961 735.43 4 0.305302 Potri.007G009000.2.v4.1 1416 1190.39 0 0 Potri.003G141000.2.v4.1 2943 2717.39 962.372 19.8794 Potri.016G087400.1.v4.1 270 92.1214 1051 640.404 Potri.015G069301.1.v4.1 564 343.297 0 0 Potri.010G195200.1.v4.1 1773 1547.39 137 4.96973 Potri.012G127500.1.v4.1 977 751.416 64 4.78092 ==> SRR7170866.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 451 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 296 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 57 SRR7170866 completed mapping pipeline successfully