Starting /dee2/code/volunteer_pipeline.sh SRR7170867 current disk space = 3087570452480 free memory = 1463525100 SRR7170867 SRAfilesize 559c0fe0b25901fcb2feff71fcf8feda SRR7170867.sra SRR7170867.sra file validated SRR7170867 is paired end SRR7170867 is conventional basespace SRR7170867 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170867_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5535 34.0 33.0 34.0 32.0 34.0 2 33.1845 34.0 33.0 34.0 32.0 34.0 3 33.1275 34.0 33.0 34.0 32.0 34.0 4 33.15275 34.0 33.0 34.0 31.0 34.0 5 33.3005 34.0 33.0 34.0 33.0 34.0 6 36.7425 38.0 37.0 38.0 34.0 38.0 7 37.11725 38.0 38.0 38.0 36.0 38.0 8 37.24825 38.0 38.0 38.0 36.0 38.0 9 37.3645 38.0 38.0 38.0 37.0 38.0 10-14 37.32735 38.0 38.0 38.0 37.0 38.0 15-19 37.25195 38.0 38.0 38.0 36.8 38.0 20-24 37.159800000000004 38.0 38.0 38.0 36.4 38.0 25-29 37.22855 38.0 38.0 38.0 36.4 38.0 30-34 37.051249999999996 38.0 38.0 38.0 35.8 38.0 35-39 36.9745 38.0 38.0 38.0 35.6 38.0 40-44 36.9384 38.0 38.0 38.0 35.6 38.0 45-49 36.80865 38.0 38.0 38.0 35.0 38.0 50-54 36.6498 38.0 38.0 38.0 34.6 38.0 55-59 36.5202 38.0 38.0 38.0 34.0 38.0 60-64 36.376850000000005 38.0 37.8 38.0 33.8 38.0 65-69 36.2847 38.0 37.8 38.0 33.4 38.0 70-74 36.28025 38.0 37.4 38.0 33.6 38.0 75-79 36.0779 38.0 37.0 38.0 33.2 38.0 80-84 35.697900000000004 38.0 37.0 38.0 31.4 38.0 85-89 35.675799999999995 38.0 37.0 38.0 31.4 38.0 90-94 35.54005 38.0 37.0 38.0 30.6 38.0 95-99 35.36675 38.0 36.2 38.0 29.8 38.0 100-104 34.7606 38.0 35.4 38.0 26.8 38.0 105-109 34.39695 38.0 34.4 38.0 24.6 38.0 110-114 33.81395 38.0 33.6 38.0 20.2 38.0 115-119 33.5523 38.0 33.0 38.0 19.8 38.0 120-124 33.35955 38.0 33.0 38.0 19.6 38.0 125-129 32.3709 37.4 32.0 38.0 14.0 38.0 130-134 31.79635 37.0 30.2 38.0 13.4 38.0 135-139 30.754949999999997 36.0 28.0 38.0 12.6 38.0 140-144 30.342599999999997 36.0 28.0 38.0 9.6 38.0 145-149 28.597550000000002 35.2 24.4 38.0 2.0 38.0 150-151 21.757375 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 0.0 8 1.0 9 1.0 10 2.0 11 1.0 12 0.0 13 1.0 14 5.0 15 4.0 16 3.0 17 7.0 18 12.0 19 24.0 20 10.0 21 12.0 22 16.0 23 25.0 24 28.0 25 30.0 26 29.0 27 41.0 28 66.0 29 55.0 30 83.0 31 123.0 32 143.0 33 188.0 34 310.0 35 497.0 36 1126.0 37 1155.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.90094701817251 16.969541847965193 10.545175326337343 31.584335807524955 2 24.075 18.9 32.800000000000004 24.224999999999998 3 19.053580370555835 25.98898347521282 29.794692038057086 25.162744116174263 4 22.225 32.9 24.275 20.599999999999998 5 22.8 35.275 23.325000000000003 18.6 6 22.025 34.625 22.95 20.4 7 15.075 23.825 41.15 19.950000000000003 8 19.375 23.425 26.825 30.375000000000004 9 19.075 24.25 29.799999999999997 26.875 10-14 21.47 28.65 25.1 24.779999999999998 15-19 21.295 27.685 26.290000000000003 24.73 20-24 21.154999999999998 27.77 26.185000000000002 24.89 25-29 21.33 27.705000000000002 26.31 24.654999999999998 30-34 20.48 27.37 27.310000000000002 24.84 35-39 21.335 28.294999999999998 25.835 24.535 40-44 21.295 27.634999999999998 26.955000000000002 24.115000000000002 45-49 21.75 27.794999999999998 26.295 24.16 50-54 21.195 27.72 26.645000000000003 24.44 55-59 20.755000000000003 27.58 27.229999999999997 24.435000000000002 60-64 21.135 27.18 27.01 24.675 65-69 21.165 28.46 25.790000000000003 24.585 70-74 20.94 28.494999999999997 25.88 24.685000000000002 75-79 21.18 28.349999999999998 25.990000000000002 24.48 80-84 21.154999999999998 28.375 26.119999999999997 24.349999999999998 85-89 21.535 27.985 26.179999999999996 24.3 90-94 21.025 28.17 26.21 24.595 95-99 21.6 27.665 26.31 24.425 100-104 21.67 27.894999999999996 26.215 24.22 105-109 21.41 27.665 26.505000000000003 24.42 110-114 22.0 27.21 26.755000000000003 24.035 115-119 21.945 27.6 25.705 24.75 120-124 22.215 27.47 25.86 24.455 125-129 21.825 28.389999999999997 25.380000000000003 24.404999999999998 130-134 22.535 26.985 25.765 24.715 135-139 22.23 28.215 25.335 24.22 140-144 21.85 27.939999999999998 25.555 24.654999999999998 145-149 22.215 27.265 25.405 25.115 150-151 22.7625 27.487499999999997 25.7875 23.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 2.0 22 2.0 23 1.5 24 2.0 25 3.0 26 6.0 27 7.0 28 8.0 29 12.0 30 18.5 31 20.5 32 24.0 33 38.5 34 51.5 35 64.0 36 75.5 37 89.0 38 103.0 39 124.0 40 146.0 41 163.5 42 191.0 43 205.5 44 225.5 45 232.5 46 223.0 47 224.5 48 230.5 49 225.0 50 193.0 51 165.0 52 145.0 53 134.0 54 131.5 55 112.5 56 80.5 57 67.0 58 60.0 59 46.0 60 42.0 61 31.5 62 20.0 63 14.5 64 6.0 65 4.0 66 5.0 67 5.5 68 4.5 69 3.5 70 1.5 71 0.5 72 1.0 73 1.5 74 1.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.325 2 0.0 3 0.15 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.625 #Duplication Level Percentage of deduplicated Percentage of total 1 97.67141009055628 94.375 2 1.9146183699870634 3.6999999999999997 3 0.2328589909443726 0.675 4 0.1034928848641656 0.4 5 0.0 0.0 6 0.0517464424320828 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0258732212160414 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 22 0.5499999999999999 TruSeq Adapter, Index 19 (97% over 38bp) GCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTT 6 0.15 No Hit ATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTATG 6 0.15 TruSeq Adapter, Index 19 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.11249999999999999 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.1749999999999998 0.0 0.0 0.0 0.0 102-103 1.3624999999999998 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.8875000000000002 0.0 0.0 0.0 0.0 108-109 2.1500000000000004 0.0 0.0 0.0 0.0 110-111 2.425 0.0 0.0 0.0 0.0 112-113 2.7375 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.2750000000000004 0.0 0.0 0.0 0.0 118-119 3.675 0.0 0.0 0.0 0.0 120-121 3.9875 0.0 0.0 0.0 0.0 122-123 4.325 0.0 0.0 0.0 0.0 124-125 4.637499999999999 0.0 0.0 0.0 0.0 126-127 5.25 0.0 0.0 0.0 0.0 128-129 5.7 0.0 0.0 0.0 0.0 130-131 6.275 0.0 0.0 0.0 0.0 132-133 6.8125 0.0 0.0 0.0 0.0 134-135 7.3625 0.0 0.0 0.0 0.0 136-137 7.925000000000001 0.0 0.0 0.0 0.0 138-139 8.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAATT 10 0.006577216 146.82278 1 CATTGTA 10 0.006832588 144.9875 4 TCCTCCT 10 0.006832588 144.9875 7 CTCCTCT 10 0.006832588 144.9875 9 ATTGTAG 10 0.006832588 144.9875 5 TCAGCAG 20 0.0059376103 28.9975 80-84 >>END_MODULE SRR7170867 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170867_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8805 33.0 33.0 34.0 32.0 34.0 2 32.897 34.0 33.0 34.0 32.0 34.0 3 32.8205 34.0 33.0 34.0 32.0 34.0 4 32.852 34.0 33.0 34.0 32.0 34.0 5 32.8605 34.0 33.0 34.0 32.0 34.0 6 36.976 38.0 38.0 38.0 36.0 38.0 7 36.981 38.0 38.0 38.0 37.0 38.0 8 37.00325 38.0 38.0 38.0 36.0 38.0 9 36.9815 38.0 38.0 38.0 37.0 38.0 10-14 36.93655 38.0 38.0 38.0 36.4 38.0 15-19 36.9762 38.0 38.0 38.0 36.6 38.0 20-24 36.88935 38.0 38.0 38.0 36.0 38.0 25-29 36.8777 38.0 38.0 38.0 36.2 38.0 30-34 36.81935 38.0 38.0 38.0 36.0 38.0 35-39 36.81345 38.0 38.0 38.0 36.0 38.0 40-44 36.843050000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.82625 38.0 38.0 38.0 36.0 38.0 50-54 36.7572 38.0 38.0 38.0 36.0 38.0 55-59 36.6654 38.0 38.0 38.0 35.4 38.0 60-64 36.58845 38.0 38.0 38.0 35.2 38.0 65-69 36.59439999999999 38.0 38.0 38.0 34.8 38.0 70-74 36.468399999999995 38.0 38.0 38.0 34.4 38.0 75-79 36.34335 38.0 38.0 38.0 34.0 38.0 80-84 36.11514999999999 38.0 38.0 38.0 34.0 38.0 85-89 35.9616 38.0 38.0 38.0 33.4 38.0 90-94 35.80675 38.0 38.0 38.0 33.0 38.0 95-99 35.59635 38.0 37.4 38.0 31.0 38.0 100-104 35.4957 38.0 37.0 38.0 31.0 38.0 105-109 35.349 38.0 37.0 38.0 30.6 38.0 110-114 35.0865 38.0 37.0 38.0 28.6 38.0 115-119 34.77954999999999 38.0 36.0 38.0 27.4 38.0 120-124 34.528800000000004 38.0 35.6 38.0 25.6 38.0 125-129 33.90745 38.0 34.4 38.0 22.2 38.0 130-134 33.524649999999994 38.0 33.4 38.0 19.8 38.0 135-139 33.03835 38.0 33.0 38.0 16.6 38.0 140-144 32.24185 38.0 33.0 38.0 12.8 38.0 145-149 31.1222 38.0 31.6 38.0 5.8 38.0 150-151 25.4345 33.0 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 2.0 4 2.0 5 1.0 6 0.0 7 2.0 8 2.0 9 2.0 10 3.0 11 3.0 12 7.0 13 7.0 14 2.0 15 4.0 16 8.0 17 5.0 18 7.0 19 12.0 20 26.0 21 18.0 22 15.0 23 20.0 24 21.0 25 22.0 26 25.0 27 30.0 28 38.0 29 58.0 30 40.0 31 56.0 32 74.0 33 127.0 34 164.0 35 268.0 36 706.0 37 2211.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.449999999999996 21.224999999999998 14.149999999999999 23.175 2 28.449999999999996 23.599999999999998 28.849999999999998 19.1 3 21.925 27.025 31.724999999999998 19.325 4 23.625 33.925 21.55 20.9 5 25.75 34.425 20.175 19.650000000000002 6 22.35 36.199999999999996 21.7 19.75 7 19.1 19.45 39.324999999999996 22.125 8 22.45 22.825 26.5 28.225 9 23.025000000000002 24.224999999999998 26.75 26.0 10-14 23.985 26.625 25.885 23.505000000000003 15-19 23.86 26.695 26.979999999999997 22.465 20-24 23.665 27.145000000000003 27.32 21.87 25-29 23.825 27.29 27.27 21.615000000000002 30-34 23.32 27.66 27.11 21.91 35-39 23.49 27.43 27.115000000000002 21.965 40-44 23.935000000000002 27.12 27.255000000000003 21.69 45-49 23.735 26.900000000000002 27.275 22.09 50-54 23.925 27.034999999999997 27.275 21.765 55-59 24.385 26.345000000000002 26.905 22.365 60-64 24.385 26.57 26.900000000000002 22.145 65-69 23.95 26.19 27.04 22.82 70-74 23.65 27.11 26.415 22.825 75-79 24.14 27.169999999999998 26.275 22.415 80-84 24.0 26.655 26.810000000000002 22.535 85-89 24.39 26.96 26.25 22.400000000000002 90-94 23.74 27.37 26.740000000000002 22.15 95-99 24.099999999999998 26.979999999999997 26.72 22.2 100-104 24.0 27.02 26.97 22.009999999999998 105-109 24.505 26.669999999999998 27.3 21.525 110-114 24.931246562328116 27.061353067653382 26.761338066903345 21.246062303115156 115-119 25.025 27.415 26.58 20.979999999999997 120-124 25.64 26.834999999999997 26.14 21.385 125-129 25.25 27.450000000000003 25.929999999999996 21.37 130-134 25.525 26.605 26.68 21.19 135-139 25.53 25.995 26.945000000000004 21.529999999999998 140-144 25.56 27.015 26.71 20.715 145-149 25.645 27.105 26.540000000000003 20.71 150-151 27.025 26.825 25.912499999999998 20.2375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 1.5 24 1.5 25 2.0 26 3.0 27 4.0 28 4.5 29 7.0 30 12.0 31 17.0 32 18.5 33 22.0 34 37.0 35 57.5 36 67.0 37 76.0 38 89.0 39 111.0 40 140.5 41 165.5 42 178.0 43 219.5 44 273.0 45 259.0 46 238.5 47 250.5 48 245.5 49 220.5 50 188.5 51 165.0 52 144.0 53 119.0 54 109.0 55 102.5 56 86.5 57 71.0 58 61.0 59 53.5 60 45.5 61 37.0 62 33.0 63 24.0 64 10.5 65 3.5 66 3.5 67 2.0 68 1.0 69 1.5 70 1.5 71 3.0 72 2.5 73 2.0 74 2.5 75 1.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.25 #Duplication Level Percentage of deduplicated Percentage of total 1 97.97402597402596 94.3 2 1.5844155844155845 3.05 3 0.23376623376623376 0.675 4 0.025974025974025976 0.1 5 0.025974025974025976 0.125 6 0.025974025974025976 0.15 7 0.05194805194805195 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.07792207792207792 1.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 28 0.7000000000000001 Illumina Single End PCR Primer 1 (96% over 32bp) AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 12 0.3 No Hit AACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 10 0.25 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit GTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGG 7 0.17500000000000002 No Hit CATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 6 0.15 No Hit ATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.11249999999999999 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.075 0.0 0.0 0.0 0.0 100-101 1.2000000000000002 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.8125 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.3499999999999996 0.0 0.0 0.0 0.0 112-113 2.6875 0.0 0.0 0.0 0.0 114-115 2.9000000000000004 0.0 0.0 0.0 0.0 116-117 3.2750000000000004 0.0 0.0 0.0 0.0 118-119 3.6875 0.0 0.0 0.0 0.0 120-121 3.9875 0.0 0.0 0.0 0.0 122-123 4.325 0.0 0.0 0.0 0.0 124-125 4.7375 0.0 0.0 0.0 0.0 126-127 5.3625 0.0 0.0 0.0 0.0 128-129 5.825 0.0 0.0 0.0 0.0 130-131 6.375 0.0 0.0 0.0 0.0 132-133 6.8875 0.0 0.0 0.0 0.0 134-135 7.425 0.0 0.0 0.0 0.0 136-137 8.0125 0.0 0.0 0.0 0.0 138-139 8.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTATGAT 10 0.006830828 145.0 7 CACACTC 10 0.006830828 145.0 2 AGTATGA 10 0.006830828 145.0 6 >>END_MODULE Read 674182 spots for SRR7170867.sra Written 674182 spots for SRR7170867.sra Read 674182 spots for SRR7170867.sra Written 674182 spots for SRR7170867.sra Read 674182 spots for SRR7170867.sra Written 674182 spots for SRR7170867.sra Read 674182 spots for SRR7170867.sra Written 674182 spots for SRR7170867.sra Read 674182 spots for SRR7170867.sra Written 674182 spots for SRR7170867.sra Read 674182 spots for SRR7170867.sra Written 674182 spots for SRR7170867.sra Read 674182 spots for SRR7170867.sra Written 674182 spots for SRR7170867.sra Read 674182 spots for SRR7170867.sra Written 674182 spots for SRR7170867.sra Read 674182 spots for SRR7170867.sra Written 674182 spots for SRR7170867.sra Read 674182 spots for SRR7170867.sra Written 674182 spots for SRR7170867.sra Read 674182 spots for SRR7170867.sra Written 674182 spots for SRR7170867.sra Read 674182 spots for SRR7170867.sra Written 674182 spots for SRR7170867.sra Read 674182 spots for SRR7170867.sra Written 674182 spots for SRR7170867.sra Read 674185 spots for SRR7170867.sra Written 674185 spots for SRR7170867.sra Read 674182 spots for SRR7170867.sra Written 674182 spots for SRR7170867.sra Read 674182 spots for SRR7170867.sra Written 674182 spots for SRR7170867.sra Read 674182 spots for SRR7170867.sra Written 674182 spots for SRR7170867.sra Read 674182 spots for SRR7170867.sra Written 674182 spots for SRR7170867.sra Read 674182 spots for SRR7170867.sra Written 674182 spots for SRR7170867.sra Read 674182 spots for SRR7170867.sra Written 674182 spots for SRR7170867.sra SRR ids: ['SRR7170867.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h2lsocmr SRR7170867.sra spots: 13483643 blocks: [[1, 674182], [674183, 1348364], [1348365, 2022546], [2022547, 2696728], [2696729, 3370910], [3370911, 4045092], [4045093, 4719274], [4719275, 5393456], [5393457, 6067638], [6067639, 6741820], [6741821, 7416002], [7416003, 8090184], [8090185, 8764366], [8764367, 9438548], [9438549, 10112730], [10112731, 10786912], [10786913, 11461094], [11461095, 12135276], [12135277, 12809458], [12809459, 13483643]] SRR7170867 file size 4547463 SRR7170867 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170867 SRR7170867_1.fastq SRR7170867_2.fastq Input file: SRR7170867_1.fastq Paired file: SRR7170867_2.fastq trimmed: SRR7170867-trimmed-pair1.fastq, SRR7170867-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:23:27 2025 >> started Thu Feb 13 20:23:43 2025 >> done (16.380s) 13483643 read pairs processed; of these: 29669 ( 0.22%) short read pairs filtered out after trimming by size control 143515 ( 1.06%) empty read pairs filtered out after trimming by size control 13310459 (98.72%) read pairs available; of these: 9327347 (70.08%) trimmed read pairs available after processing 3983112 (29.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 22 0.00% 19 22 0.00% 20 23 0.00% 21 19 0.00% 22 13 0.00% 23 20 0.00% 24 26 0.00% 25 25 0.00% 26 21 0.00% 27 19 0.00% 28 37 0.00% 29 28 0.00% 30 23 0.00% 31 33 0.00% 32 41 0.00% 33 41 0.00% 34 42 0.00% 35 42 0.00% 36 27 0.00% 37 44 0.00% 38 39 0.00% 39 48 0.00% 40 51 0.00% 41 55 0.00% 42 56 0.00% 43 62 0.00% 44 101 0.00% 45 76 0.00% 46 74 0.00% 47 106 0.00% 48 112 0.00% 49 158 0.00% 50 141 0.00% 51 173 0.00% 52 185 0.00% 53 193 0.00% 54 242 0.00% 55 198 0.00% 56 288 0.00% 57 294 0.00% 58 371 0.00% 59 396 0.00% 60 482 0.00% 61 532 0.00% 62 605 0.00% 63 703 0.01% 64 721 0.01% 65 735 0.01% 66 776 0.01% 67 842 0.01% 68 925 0.01% 69 1028 0.01% 70 1374 0.01% 71 1522 0.01% 72 1872 0.01% 73 2279 0.02% 74 2699 0.02% 75 3818 0.03% 76 10741 0.08% 77 10981 0.08% 78 4957 0.04% 79 3987 0.03% 80 4221 0.03% 81 4584 0.03% 82 5388 0.04% 83 6182 0.05% 84 7481 0.06% 85 7703 0.06% 86 7823 0.06% 87 8214 0.06% 88 8590 0.06% 89 8628 0.06% 90 9640 0.07% 91 10779 0.08% 92 11935 0.09% 93 13155 0.10% 94 13953 0.10% 95 15391 0.12% 96 15257 0.11% 97 15163 0.11% 98 15139 0.11% 99 15794 0.12% 100 17316 0.13% 101 18642 0.14% 102 20987 0.16% 103 22626 0.17% 104 23837 0.18% 105 24855 0.19% 106 25469 0.19% 107 25379 0.19% 108 25887 0.19% 109 26055 0.20% 110 27732 0.21% 111 28996 0.22% 112 31886 0.24% 113 33706 0.25% 114 36722 0.28% 115 38099 0.29% 116 39057 0.29% 117 39725 0.30% 118 39270 0.30% 119 39828 0.30% 120 41594 0.31% 121 43789 0.33% 122 46753 0.35% 123 50650 0.38% 124 54067 0.41% 125 56609 0.43% 126 59510 0.45% 127 60389 0.45% 128 61769 0.46% 129 63045 0.47% 130 65077 0.49% 131 67938 0.51% 132 73532 0.55% 133 80518 0.60% 134 86490 0.65% 135 93824 0.70% 136 99952 0.75% 137 106371 0.80% 138 113318 0.85% 139 120192 0.90% 140 130371 0.98% 141 143152 1.08% 142 160645 1.21% 143 184398 1.39% 144 217595 1.63% 145 260142 1.95% 146 323465 2.43% 147 429959 3.23% 148 627040 4.71% 149 1132699 8.51% 150 3425834 25.74% 151 3983112 29.92% 13310459 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=21 prefix-density=0.57 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=24 fanout-score=20.72 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=2.3 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTG criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=32 prefix-density=1.02 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=85.22 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=4.1 sequence=AGGAAAGGCTTACGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGTAAGCGACGAAATGCTTCGGGGAGTTGAAAATAAGCGTAGATCCGGAGATTCCCGAATAGGTTAACCTTTCAAACTGCTGCCGAATCCATGGGCAGGCAAGAGACAACCTGGCGAACTGAAACATCTTAGTAACCAGAGGAAAAGAA SRR7170867 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:24:27 Started mapping on | Feb 13 20:24:27 Finished on | Feb 13 20:26:19 Mapping speed, Million of reads per hour | 427.84 Number of input reads | 13310459 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 11609011 Uniquely mapped reads % | 87.22% Average mapped length | 288.60 Number of splices: Total | 10351266 Number of splices: Annotated (sjdb) | 10128708 Number of splices: GT/AG | 10164454 Number of splices: GC/AG | 143941 Number of splices: AT/AC | 6187 Number of splices: Non-canonical | 36684 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.03% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 453055 % of reads mapped to multiple loci | 3.40% Number of reads mapped to too many loci | 802612 % of reads mapped to too many loci | 6.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.99% % of reads unmapped: other | 1.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1268070 1268070 1268070 N_multimapping 453055 453055 453055 N_noFeature 641635 11281825 749805 N_ambiguous 296539 2593 75474 UnstrandedReadsAssigned:10670837 PositiveStrandReadsAssigned:324593 NegativeStrandReadsAssigned:10783732 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=142 echo kmer=137 SRR7170867 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170867-trimmed-pair1.fastq SRR7170867-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,310,459 reads, 11,298,164 reads pseudoaligned [quant] estimated average fragment length: 239.991 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52401 SRR7170867.ke.tsv 34699 SRR7170867.se.tsv 87100 total ==> SRR7170867.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.01 395 12.5603 Potri.005G024800.1.v4.1 1035 796.009 90 6.39596 Potri.004G059700.1.v4.1 961 722.066 3 0.235031 Potri.007G009000.2.v4.1 1416 1177.01 0 0 Potri.003G141000.2.v4.1 2943 2704.01 495 10.3557 Potri.016G087400.1.v4.1 270 88.4079 1005 643.067 Potri.015G069301.1.v4.1 564 332.075 0 0 Potri.010G195200.1.v4.1 1773 1534.01 23 0.848166 Potri.012G127500.1.v4.1 977 738.044 593 45.4521 ==> SRR7170867.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 93 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 323 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 72 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7170867 completed mapping pipeline successfully