Starting /dee2/code/volunteer_pipeline.sh SRR7170868 current disk space = 3087719112704 free memory = 1580490016 SRR7170868 SRAfilesize 3d32c4e1b58579368fda6a96eb6ff771 SRR7170868.sra SRR7170868.sra file validated SRR7170868 is paired end SRR7170868 is conventional basespace SRR7170868 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170868_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.476 34.0 33.0 34.0 32.0 34.0 2 33.252 34.0 33.0 34.0 32.0 34.0 3 33.2005 34.0 33.0 34.0 32.0 34.0 4 33.25125 34.0 33.0 34.0 31.0 34.0 5 33.35475 34.0 33.0 34.0 33.0 34.0 6 36.8555 38.0 37.0 38.0 35.0 38.0 7 37.18325 38.0 38.0 38.0 36.0 38.0 8 37.338 38.0 38.0 38.0 37.0 38.0 9 37.447 38.0 38.0 38.0 37.0 38.0 10-14 37.444399999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.3794 38.0 38.0 38.0 37.0 38.0 20-24 37.33465 38.0 38.0 38.0 37.0 38.0 25-29 37.33895 38.0 38.0 38.0 37.0 38.0 30-34 37.1998 38.0 38.0 38.0 36.4 38.0 35-39 37.13975 38.0 38.0 38.0 36.0 38.0 40-44 37.1139 38.0 38.0 38.0 36.0 38.0 45-49 37.02395 38.0 38.0 38.0 35.8 38.0 50-54 36.85895 38.0 38.0 38.0 35.2 38.0 55-59 36.737700000000004 38.0 38.0 38.0 34.8 38.0 60-64 36.606649999999995 38.0 38.0 38.0 34.2 38.0 65-69 36.5716 38.0 38.0 38.0 34.0 38.0 70-74 36.56595 38.0 38.0 38.0 34.0 38.0 75-79 36.4152 38.0 37.8 38.0 34.0 38.0 80-84 36.1841 38.0 37.0 38.0 33.2 38.0 85-89 36.19525 38.0 37.0 38.0 33.0 38.0 90-94 36.04265 38.0 37.0 38.0 32.6 38.0 95-99 35.87025 38.0 37.0 38.0 31.8 38.0 100-104 35.39785 38.0 36.4 38.0 29.4 38.0 105-109 35.04975 38.0 35.8 38.0 28.4 38.0 110-114 34.4016 38.0 34.4 38.0 24.8 38.0 115-119 34.26285 38.0 34.0 38.0 24.0 38.0 120-124 33.9995 38.0 33.6 38.0 23.2 38.0 125-129 33.07090000000001 38.0 32.8 38.0 16.4 38.0 130-134 32.45385 37.8 31.4 38.0 14.4 38.0 135-139 31.749950000000002 37.2 30.4 38.0 13.2 38.0 140-144 31.225599999999996 36.8 30.0 38.0 12.4 38.0 145-149 29.231299999999997 35.8 26.8 38.0 3.8 38.0 150-151 22.307250000000003 27.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 3.0 13 2.0 14 0.0 15 1.0 16 2.0 17 4.0 18 5.0 19 7.0 20 11.0 21 11.0 22 13.0 23 10.0 24 16.0 25 31.0 26 45.0 27 34.0 28 48.0 29 54.0 30 68.0 31 93.0 32 131.0 33 184.0 34 284.0 35 509.0 36 1069.0 37 1362.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.300436905679774 16.294011822153685 10.382934978154717 32.022616294011826 2 19.55 20.45 35.8 24.2 3 18.85327991987982 28.092138207310967 27.065598397596396 25.98898347521282 4 21.224999999999998 33.025 24.675 21.075 5 19.575 37.9 24.3 18.224999999999998 6 18.175 35.875 26.05 19.900000000000002 7 12.725 23.45 44.375 19.45 8 17.724999999999998 23.425 30.275000000000002 28.575 9 17.45 23.275000000000002 31.2 28.075 10-14 20.005 28.88 26.85 24.265 15-19 19.794999999999998 28.835 27.6 23.77 20-24 20.03 29.099999999999998 27.279999999999998 23.59 25-29 19.68 29.365000000000002 27.855 23.1 30-34 19.794999999999998 28.89 28.084999999999997 23.23 35-39 19.825 29.515 27.58 23.080000000000002 40-44 19.925 28.825 27.860000000000003 23.39 45-49 20.200000000000003 29.13 27.169999999999998 23.5 50-54 20.11 28.225 28.139999999999997 23.525 55-59 20.169999999999998 28.65 27.665 23.515 60-64 20.599999999999998 28.52 27.725 23.155 65-69 20.599999999999998 28.804999999999996 27.334999999999997 23.26 70-74 20.4 28.615000000000002 27.589999999999996 23.395 75-79 20.3 28.315 28.03 23.355 80-84 20.285 28.849999999999998 27.175 23.69 85-89 20.45 28.945 26.83 23.775 90-94 20.66 27.935 27.605 23.799999999999997 95-99 20.395 28.675 27.185 23.745 100-104 20.66 28.360000000000003 27.339999999999996 23.64 105-109 20.31 28.535 27.384999999999998 23.77 110-114 21.415 28.175 27.065 23.345 115-119 21.17 29.175 26.645000000000003 23.01 120-124 21.099999999999998 29.134999999999998 26.584999999999997 23.18 125-129 21.025 28.439999999999998 26.765 23.77 130-134 21.085 28.615000000000002 26.755000000000003 23.544999999999998 135-139 21.125 28.615000000000002 26.595000000000002 23.665 140-144 21.785 28.910000000000004 25.595000000000002 23.71 145-149 21.29 28.565 26.150000000000002 23.995 150-151 21.5625 28.3625 25.7125 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 2.0 22 1.0 23 0.5 24 2.0 25 3.5 26 4.5 27 7.0 28 13.0 29 16.0 30 27.5 31 35.5 32 39.0 33 56.0 34 68.5 35 80.0 36 102.0 37 123.5 38 141.0 39 162.0 40 191.5 41 210.5 42 239.0 43 255.0 44 242.0 45 242.5 46 241.0 47 235.5 48 210.0 49 205.0 50 197.0 51 154.0 52 111.5 53 80.0 54 69.0 55 59.5 56 48.0 57 34.0 58 25.5 59 19.5 60 14.5 61 10.0 62 4.0 63 2.5 64 2.0 65 2.5 66 2.0 67 1.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.725 2 0.0 3 0.15 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34475806451613 98.55000000000001 2 0.5040322580645161 1.0 3 0.15120967741935484 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.8625 0.0 0.0 0.0 0.0 90-91 1.0875 0.0 0.0 0.0 0.0 92-93 1.375 0.0 0.0 0.0 0.0 94-95 1.575 0.0 0.0 0.0 0.0 96-97 1.8 0.0 0.0 0.0 0.0 98-99 1.975 0.0 0.0 0.0 0.0 100-101 2.2625 0.0 0.0 0.0 0.0 102-103 2.6500000000000004 0.0 0.0 0.0 0.0 104-105 2.925 0.0 0.0 0.0 0.0 106-107 3.3625 0.0 0.0 0.0 0.0 108-109 3.9125 0.0 0.0 0.0 0.0 110-111 4.375 0.0 0.0 0.0 0.0 112-113 4.9 0.0 0.0 0.0 0.0 114-115 5.4375 0.0 0.0 0.0 0.0 116-117 6.075 0.0 0.0 0.0 0.0 118-119 6.6875 0.0 0.0 0.0 0.0 120-121 7.199999999999999 0.0 0.0 0.0 0.0 122-123 7.9375 0.0 0.0 0.0 0.0 124-125 8.55 0.0 0.0 0.0 0.0 126-127 9.1375 0.0 0.0 0.0 0.0 128-129 9.8375 0.0 0.0 0.0 0.0 130-131 10.649999999999999 0.0 0.0 0.0 0.0 132-133 11.2375 0.0 0.0 0.0 0.0 134-135 12.0125 0.0 0.0 0.0 0.0 136-137 13.1125 0.0 0.0 0.0 0.0 138-139 14.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATCAA 10 0.006832588 144.9875 4 >>END_MODULE SRR7170868 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170868_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9 33.0 33.0 34.0 32.0 34.0 2 32.929 33.0 33.0 34.0 32.0 34.0 3 32.959 34.0 33.0 34.0 32.0 34.0 4 32.9295 34.0 33.0 34.0 32.0 34.0 5 32.98825 34.0 33.0 34.0 32.0 34.0 6 37.1265 38.0 38.0 38.0 37.0 38.0 7 37.05525 38.0 38.0 38.0 37.0 38.0 8 37.1635 38.0 38.0 38.0 37.0 38.0 9 37.1165 38.0 38.0 38.0 37.0 38.0 10-14 37.07484999999999 38.0 38.0 38.0 36.8 38.0 15-19 37.078250000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.026300000000006 38.0 38.0 38.0 36.6 38.0 25-29 37.031 38.0 38.0 38.0 36.8 38.0 30-34 36.95245 38.0 38.0 38.0 36.2 38.0 35-39 36.944399999999995 38.0 38.0 38.0 36.2 38.0 40-44 36.97305 38.0 38.0 38.0 36.2 38.0 45-49 36.917649999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.87454999999999 38.0 38.0 38.0 36.0 38.0 55-59 36.8172 38.0 38.0 38.0 36.0 38.0 60-64 36.750449999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.67545 38.0 38.0 38.0 35.2 38.0 70-74 36.5517 38.0 38.0 38.0 34.8 38.0 75-79 36.51995000000001 38.0 38.0 38.0 34.6 38.0 80-84 36.380900000000004 38.0 38.0 38.0 34.2 38.0 85-89 36.3341 38.0 38.0 38.0 34.2 38.0 90-94 36.17595 38.0 38.0 38.0 33.8 38.0 95-99 35.94 38.0 37.8 38.0 33.2 38.0 100-104 35.88575 38.0 37.0 38.0 32.6 38.0 105-109 35.739799999999995 38.0 37.0 38.0 32.2 38.0 110-114 35.51345 38.0 37.0 38.0 31.0 38.0 115-119 35.2633 38.0 36.2 38.0 29.0 38.0 120-124 34.755 38.0 35.6 38.0 26.8 38.0 125-129 34.232 38.0 34.4 38.0 24.0 38.0 130-134 33.785650000000004 38.0 33.4 38.0 22.6 38.0 135-139 33.17175 38.0 33.0 38.0 18.2 38.0 140-144 32.23605 38.0 32.2 38.0 13.2 38.0 145-149 30.96785 37.6 31.0 38.0 5.8 38.0 150-151 25.154375 32.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 4.0 4 4.0 5 2.0 6 1.0 7 0.0 8 0.0 9 0.0 10 3.0 11 0.0 12 2.0 13 5.0 14 2.0 15 6.0 16 7.0 17 9.0 18 4.0 19 5.0 20 7.0 21 5.0 22 19.0 23 15.0 24 11.0 25 25.0 26 25.0 27 26.0 28 32.0 29 32.0 30 55.0 31 71.0 32 89.0 33 116.0 34 172.0 35 353.0 36 789.0 37 2093.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.35 19.525000000000002 14.249999999999998 22.875 2 26.625 23.125 32.1 18.15 3 21.3 27.1 32.550000000000004 19.05 4 23.7 33.6 23.925 18.775 5 23.549999999999997 36.775000000000006 22.2 17.474999999999998 6 20.525 36.775000000000006 23.474999999999998 19.225 7 18.325 20.599999999999998 40.425 20.65 8 20.825 24.75 26.875 27.55 9 21.6 25.575 29.075 23.75 10-14 23.79 27.755000000000003 26.76 21.695 15-19 23.115 27.52 28.365000000000002 21.0 20-24 22.85 27.950000000000003 28.199999999999996 21.0 25-29 23.04 27.93 28.46 20.57 30-34 23.01 28.275 27.88 20.835 35-39 23.275000000000002 27.955000000000002 28.16 20.61 40-44 22.695 27.83 28.415000000000003 21.060000000000002 45-49 23.39 27.57 28.51 20.53 50-54 22.945 28.345 28.435 20.275000000000002 55-59 23.645 27.315 28.23 20.810000000000002 60-64 23.200000000000003 27.029999999999998 28.87 20.9 65-69 23.015 27.575 28.21 21.2 70-74 23.05 27.73 27.950000000000003 21.27 75-79 23.04 27.445000000000004 28.384999999999998 21.13 80-84 23.255 28.105000000000004 27.965 20.674999999999997 85-89 23.28 27.595 28.144999999999996 20.979999999999997 90-94 23.62 27.810000000000002 27.82 20.75 95-99 23.02 27.375 28.675 20.93 100-104 23.435 28.02 27.575 20.97 105-109 24.12 27.165 27.98 20.735 110-114 23.535 27.72 28.110000000000003 20.635 115-119 24.77 28.265 27.57 19.395 120-124 25.39 27.384999999999998 27.38 19.845 125-129 24.33 28.275 27.29 20.105 130-134 25.319999999999997 28.105000000000004 27.034999999999997 19.54 135-139 25.655 27.644999999999996 27.485 19.215 140-144 26.465 28.08 25.900000000000002 19.555 145-149 26.565 27.689999999999998 26.51 19.235 150-151 26.25 27.1125 26.8375 19.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.5 25 4.0 26 5.0 27 5.5 28 10.5 29 17.0 30 21.5 31 26.5 32 32.0 33 37.0 34 55.5 35 75.0 36 98.5 37 115.5 38 130.5 39 153.0 40 187.0 41 217.5 42 226.5 43 242.5 44 261.5 45 277.0 46 274.5 47 243.5 48 214.5 49 196.5 50 170.5 51 137.5 52 114.0 53 98.5 54 84.5 55 73.5 56 51.0 57 39.5 58 27.5 59 15.5 60 16.5 61 11.5 62 6.5 63 4.0 64 3.5 65 2.5 66 1.0 67 1.5 68 2.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.13989375158107 97.975 2 0.6071338224133569 1.2 3 0.17708069820389577 0.525 4 0.07589172780166961 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.8625 0.0 0.0 0.0 0.0 90-91 1.075 0.0 0.0 0.0 0.0 92-93 1.3375 0.0 0.0 0.0 0.0 94-95 1.525 0.0 0.0 0.0 0.0 96-97 1.75 0.0 0.0 0.0 0.0 98-99 1.9249999999999998 0.0 0.0 0.0 0.0 100-101 2.2125000000000004 0.0 0.0 0.0 0.0 102-103 2.6125 0.0 0.0 0.0 0.0 104-105 2.9124999999999996 0.0 0.0 0.0 0.0 106-107 3.375 0.0 0.0 0.0 0.0 108-109 3.875 0.0 0.0 0.0 0.0 110-111 4.35 0.0 0.0 0.0 0.0 112-113 4.8625 0.0 0.0 0.0 0.0 114-115 5.425000000000001 0.0 0.0 0.0 0.0 116-117 6.0375 0.0 0.0 0.0 0.0 118-119 6.625 0.0 0.0 0.0 0.0 120-121 7.15 0.0 0.0 0.0 0.0 122-123 7.825 0.0 0.0 0.0 0.0 124-125 8.425 0.0 0.0 0.0 0.0 126-127 8.975000000000001 0.0 0.0 0.0 0.0 128-129 9.6875 0.0 0.0 0.0 0.0 130-131 10.575 0.0 0.0 0.0 0.0 132-133 11.1125 0.0 0.0 0.0 0.0 134-135 11.9375 0.0 0.0 0.0 0.0 136-137 13.0625 0.0 0.0 0.0 0.0 138-139 14.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGGGGT 10 0.006830828 145.0 1 GGGGGTT 10 0.006830828 145.0 2 TTGTGGG 10 0.006830828 145.0 5 >>END_MODULE Read 699886 spots for SRR7170868.sra Written 699886 spots for SRR7170868.sra Read 699886 spots for SRR7170868.sra Written 699886 spots for SRR7170868.sra Read 699886 spots for SRR7170868.sra Written 699886 spots for SRR7170868.sra Read 699886 spots for SRR7170868.sra Written 699886 spots for SRR7170868.sra Read 699886 spots for SRR7170868.sra Written 699886 spots for SRR7170868.sra Read 699886 spots for SRR7170868.sra Written 699886 spots for SRR7170868.sra Read 699886 spots for SRR7170868.sra Written 699886 spots for SRR7170868.sra Read 699886 spots for SRR7170868.sra Written 699886 spots for SRR7170868.sra Read 699886 spots for SRR7170868.sra Written 699886 spots for SRR7170868.sra Read 699886 spots for SRR7170868.sra Written 699886 spots for SRR7170868.sra Read 699886 spots for SRR7170868.sra Written 699886 spots for SRR7170868.sra Read 699901 spots for SRR7170868.sra Written 699901 spots for SRR7170868.sra Read 699886 spots for SRR7170868.sra Written 699886 spots for SRR7170868.sra Read 699886 spots for SRR7170868.sra Written 699886 spots for SRR7170868.sra Read 699886 spots for SRR7170868.sra Written 699886 spots for SRR7170868.sra Read 699886 spots for SRR7170868.sra Written 699886 spots for SRR7170868.sra Read 699886 spots for SRR7170868.sra Written 699886 spots for SRR7170868.sra Read 699886 spots for SRR7170868.sra Written 699886 spots for SRR7170868.sra Read 699886 spots for SRR7170868.sra Written 699886 spots for SRR7170868.sra Read 699886 spots for SRR7170868.sra Written 699886 spots for SRR7170868.sra SRR ids: ['SRR7170868.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ajshiqya SRR7170868.sra spots: 13997735 blocks: [[1, 699886], [699887, 1399772], [1399773, 2099658], [2099659, 2799544], [2799545, 3499430], [3499431, 4199316], [4199317, 4899202], [4899203, 5599088], [5599089, 6298974], [6298975, 6998860], [6998861, 7698746], [7698747, 8398632], [8398633, 9098518], [9098519, 9798404], [9798405, 10498290], [10498291, 11198176], [11198177, 11898062], [11898063, 12597948], [12597949, 13297834], [13297835, 13997735]] SRR7170868 file size 4721672 SRR7170868 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170868 SRR7170868_1.fastq SRR7170868_2.fastq Input file: SRR7170868_1.fastq Paired file: SRR7170868_2.fastq trimmed: SRR7170868-trimmed-pair1.fastq, SRR7170868-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:35:55 2025 >> started Thu Feb 13 20:36:10 2025 >> done (14.719s) 13997735 read pairs processed; of these: 27258 ( 0.19%) short read pairs filtered out after trimming by size control 45048 ( 0.32%) empty read pairs filtered out after trimming by size control 13925429 (99.48%) read pairs available; of these: 9952670 (71.47%) trimmed read pairs available after processing 3972759 (28.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 13 0.00% 20 18 0.00% 21 18 0.00% 22 22 0.00% 23 19 0.00% 24 30 0.00% 25 28 0.00% 26 31 0.00% 27 37 0.00% 28 29 0.00% 29 30 0.00% 30 38 0.00% 31 46 0.00% 32 36 0.00% 33 38 0.00% 34 48 0.00% 35 48 0.00% 36 49 0.00% 37 61 0.00% 38 71 0.00% 39 79 0.00% 40 95 0.00% 41 115 0.00% 42 131 0.00% 43 94 0.00% 44 113 0.00% 45 126 0.00% 46 141 0.00% 47 152 0.00% 48 174 0.00% 49 234 0.00% 50 286 0.00% 51 324 0.00% 52 339 0.00% 53 410 0.00% 54 394 0.00% 55 443 0.00% 56 466 0.00% 57 536 0.00% 58 661 0.00% 59 743 0.01% 60 880 0.01% 61 1014 0.01% 62 1104 0.01% 63 1250 0.01% 64 1357 0.01% 65 1371 0.01% 66 1445 0.01% 67 1620 0.01% 68 1798 0.01% 69 2196 0.02% 70 2418 0.02% 71 3033 0.02% 72 3435 0.02% 73 3846 0.03% 74 4227 0.03% 75 4706 0.03% 76 5561 0.04% 77 6197 0.04% 78 5701 0.04% 79 6179 0.04% 80 6650 0.05% 81 7931 0.06% 82 9398 0.07% 83 10491 0.08% 84 12025 0.09% 85 12880 0.09% 86 12948 0.09% 87 14120 0.10% 88 14590 0.10% 89 15459 0.11% 90 16816 0.12% 91 18523 0.13% 92 20041 0.14% 93 22270 0.16% 94 23715 0.17% 95 24521 0.18% 96 24769 0.18% 97 25409 0.18% 98 25559 0.18% 99 26412 0.19% 100 28214 0.20% 101 30557 0.22% 102 32632 0.23% 103 35392 0.25% 104 37311 0.27% 105 38960 0.28% 106 38635 0.28% 107 39018 0.28% 108 39316 0.28% 109 40063 0.29% 110 41425 0.30% 111 43700 0.31% 112 46740 0.34% 113 49951 0.36% 114 52349 0.38% 115 54441 0.39% 116 54530 0.39% 117 55146 0.40% 118 55165 0.40% 119 55334 0.40% 120 57355 0.41% 121 59441 0.43% 122 62229 0.45% 123 66684 0.48% 124 70378 0.51% 125 73112 0.53% 126 74931 0.54% 127 75978 0.55% 128 77292 0.56% 129 79117 0.57% 130 80850 0.58% 131 84187 0.60% 132 88076 0.63% 133 95579 0.69% 134 100923 0.72% 135 108560 0.78% 136 114038 0.82% 137 119949 0.86% 138 127314 0.91% 139 133471 0.96% 140 142031 1.02% 141 153982 1.11% 142 170481 1.22% 143 191667 1.38% 144 222955 1.60% 145 262057 1.88% 146 320875 2.30% 147 416275 2.99% 148 602969 4.33% 149 1086980 7.81% 150 3353409 24.08% 151 3972759 28.53% 13925429 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=19 prefix-density=0.44 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=11.58 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=3.0 sequence=TGCTTGCTTCTAATCTTAATGGCGCCCACAATTACGCTTGTAAGGATTTGGGCAACC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=23 prefix-density=0.61 prefix-fanout=2.3 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=25.92 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.7 sequence=CCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7170868 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:36:52 Started mapping on | Feb 13 20:36:52 Finished on | Feb 13 20:38:13 Mapping speed, Million of reads per hour | 618.91 Number of input reads | 13925429 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 13075969 Uniquely mapped reads % | 93.90% Average mapped length | 284.75 Number of splices: Total | 11848468 Number of splices: Annotated (sjdb) | 11561657 Number of splices: GT/AG | 11619928 Number of splices: GC/AG | 177331 Number of splices: AT/AC | 7669 Number of splices: Non-canonical | 43540 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 372180 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 116711 % of reads mapped to too many loci | 0.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.42% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 501630 501630 501630 N_multimapping 372180 372180 372180 N_noFeature 597363 12842917 705595 N_ambiguous 209426 1051 83890 UnstrandedReadsAssigned:12269180 PositiveStrandReadsAssigned:232001 NegativeStrandReadsAssigned:12286484 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=138 echo kmer=133 SRR7170868 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170868-trimmed-pair1.fastq SRR7170868-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,925,429 reads, 12,344,859 reads pseudoaligned [quant] estimated average fragment length: 215.079 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,026 rounds 52401 SRR7170868.ke.tsv 34699 SRR7170868.se.tsv 87100 total ==> SRR7170868.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1803.92 592 25.1419 Potri.005G024800.1.v4.1 1035 820.921 225 20.9978 Potri.004G059700.1.v4.1 961 746.969 15 1.53845 Potri.007G009000.2.v4.1 1416 1201.92 0 0 Potri.003G141000.2.v4.1 2943 2728.92 794 22.2906 Potri.016G087400.1.v4.1 270 97.6885 747 585.828 Potri.015G069301.1.v4.1 564 355.39 0 0 Potri.010G195200.1.v4.1 1773 1558.92 92 4.52123 Potri.012G127500.1.v4.1 977 762.943 403 40.4675 ==> SRR7170868.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1052 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 226 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR7170868 completed mapping pipeline successfully