Starting /dee2/code/volunteer_pipeline.sh SRR7170869 current disk space = 3087822368768 free memory = 1580068648 SRR7170869 SRAfilesize 1326dab3dd64b401e562fe87814233e6 SRR7170869.sra SRR7170869.sra file validated SRR7170869 is paired end SRR7170869 is conventional basespace SRR7170869 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170869_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.34575 34.0 33.0 34.0 32.0 34.0 2 33.17375 34.0 33.0 34.0 32.0 34.0 3 33.16975 34.0 33.0 34.0 32.0 34.0 4 33.2035 34.0 33.0 34.0 31.0 34.0 5 33.26925 34.0 33.0 34.0 33.0 34.0 6 36.829 38.0 37.0 38.0 35.0 38.0 7 37.22125 38.0 38.0 38.0 36.0 38.0 8 37.3275 38.0 38.0 38.0 37.0 38.0 9 37.42625 38.0 38.0 38.0 37.0 38.0 10-14 37.412850000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.33299999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.232 38.0 38.0 38.0 36.4 38.0 25-29 37.30715 38.0 38.0 38.0 36.8 38.0 30-34 37.154450000000004 38.0 38.0 38.0 36.0 38.0 35-39 37.07615 38.0 38.0 38.0 36.0 38.0 40-44 37.0481 38.0 38.0 38.0 36.0 38.0 45-49 36.93325 38.0 38.0 38.0 35.6 38.0 50-54 36.74525 38.0 38.0 38.0 34.8 38.0 55-59 36.583600000000004 38.0 38.0 38.0 34.2 38.0 60-64 36.47155 38.0 37.8 38.0 34.2 38.0 65-69 36.51715 38.0 38.0 38.0 34.0 38.0 70-74 36.4144 38.0 38.0 38.0 34.0 38.0 75-79 36.41760000000001 38.0 37.8 38.0 34.0 38.0 80-84 35.9976 38.0 37.0 38.0 32.4 38.0 85-89 36.04745 38.0 37.0 38.0 33.0 38.0 90-94 35.82809999999999 38.0 37.0 38.0 31.4 38.0 95-99 35.608999999999995 38.0 36.6 38.0 31.0 38.0 100-104 35.17925 38.0 36.0 38.0 28.6 38.0 105-109 34.7869 38.0 35.4 38.0 26.2 38.0 110-114 34.2999 38.0 34.2 38.0 24.0 38.0 115-119 33.974399999999996 38.0 33.4 38.0 22.8 38.0 120-124 33.72735 38.0 33.0 38.0 22.2 38.0 125-129 32.884049999999995 38.0 32.6 38.0 16.6 38.0 130-134 32.3247 37.4 31.0 38.0 14.4 38.0 135-139 31.34925 36.6 29.0 38.0 13.0 38.0 140-144 30.768099999999997 36.0 28.2 38.0 12.2 38.0 145-149 28.82345 35.8 25.2 38.0 2.0 38.0 150-151 21.92825 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 2.0 11 0.0 12 2.0 13 0.0 14 2.0 15 2.0 16 3.0 17 4.0 18 7.0 19 14.0 20 7.0 21 14.0 22 15.0 23 20.0 24 21.0 25 31.0 26 31.0 27 36.0 28 40.0 29 67.0 30 69.0 31 87.0 32 164.0 33 222.0 34 272.0 35 568.0 36 1076.0 37 1223.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.25186903841196 16.447538025264244 8.662026295436968 37.63856664088683 2 18.725 20.325 39.475 21.475 3 16.700050075112667 25.43815723585378 30.796194291437157 27.065598397596396 4 20.5 32.675 24.6 22.225 5 20.1 35.15 26.174999999999997 18.575 6 16.975 37.275000000000006 26.174999999999997 19.575 7 14.674999999999999 23.549999999999997 44.125 17.65 8 17.075000000000003 22.625 31.075000000000003 29.225 9 17.275 23.05 32.9 26.775 10-14 19.49 29.425 26.765 24.32 15-19 19.634999999999998 27.99 28.49 23.885 20-24 19.81 28.754999999999995 28.1 23.335 25-29 19.975 28.444999999999997 28.055000000000003 23.525 30-34 19.81 28.884999999999998 27.73 23.575 35-39 19.650000000000002 28.62 27.965 23.765 40-44 19.605 29.435 27.54 23.419999999999998 45-49 19.625 28.349999999999998 27.994999999999997 24.03 50-54 19.71 28.355000000000004 28.175 23.76 55-59 19.985 28.689999999999998 27.665 23.66 60-64 19.915 28.349999999999998 28.12 23.615 65-69 19.57 29.270000000000003 27.67 23.49 70-74 20.135 29.080000000000002 27.36 23.425 75-79 19.885 28.605000000000004 27.82 23.69 80-84 19.994999999999997 28.71 27.279999999999998 24.015 85-89 20.19 28.799999999999997 27.61 23.400000000000002 90-94 19.67 29.049999999999997 27.68 23.599999999999998 95-99 20.36 28.694999999999997 27.685 23.26 100-104 20.665 28.99 26.995 23.35 105-109 20.455000000000002 28.18 27.6 23.765 110-114 20.53 28.305000000000003 27.474999999999998 23.69 115-119 20.65 29.049999999999997 27.015 23.285 120-124 20.755000000000003 29.025000000000002 26.76 23.46 125-129 20.73 28.660000000000004 26.77 23.84 130-134 20.865000000000002 29.025000000000002 26.279999999999998 23.830000000000002 135-139 20.655 28.970000000000002 26.790000000000003 23.585 140-144 20.535 28.27 26.669999999999998 24.525 145-149 20.669999999999998 29.115000000000002 26.279999999999998 23.935000000000002 150-151 20.3 28.675 27.825 23.200000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 1.5 21 1.5 22 2.5 23 3.0 24 4.5 25 5.0 26 5.5 27 13.0 28 17.0 29 16.0 30 21.5 31 31.5 32 41.0 33 54.5 34 72.5 35 77.0 36 97.0 37 129.0 38 157.0 39 185.0 40 200.0 41 218.5 42 233.0 43 228.0 44 237.5 45 269.0 46 248.5 47 217.0 48 222.0 49 209.0 50 165.5 51 132.5 52 115.0 53 84.5 54 70.0 55 59.0 56 44.5 57 36.5 58 22.5 59 15.5 60 12.0 61 7.5 62 4.0 63 3.5 64 2.0 65 0.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.025 2 0.0 3 0.15 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.41992433795713 98.55000000000001 2 0.5044136191677175 1.0 3 0.05044136191677175 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025220680958385876 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 12 0.3 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.30000000000000004 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.44999999999999996 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 90-91 1.1375 0.0 0.0 0.0 0.0 92-93 1.3875000000000002 0.0 0.0 0.0 0.0 94-95 1.5625 0.0 0.0 0.0 0.0 96-97 1.8375 0.0 0.0 0.0 0.0 98-99 2.0250000000000004 0.0 0.0 0.0 0.0 100-101 2.3375 0.0 0.0 0.0 0.0 102-103 2.6500000000000004 0.0 0.0 0.0 0.0 104-105 3.0999999999999996 0.0 0.0 0.0 0.0 106-107 3.3125 0.0 0.0 0.0 0.0 108-109 3.7125000000000004 0.0 0.0 0.0 0.0 110-111 4.275 0.0 0.0 0.0 0.0 112-113 4.7875 0.0 0.0 0.0 0.0 114-115 5.35 0.0 0.0 0.0 0.0 116-117 6.2 0.0 0.0 0.0 0.0 118-119 6.725 0.0 0.0 0.0 0.0 120-121 7.25 0.0 0.0 0.0 0.0 122-123 7.9 0.0 0.0 0.0 0.0 124-125 8.55 0.0 0.0 0.0 0.0 126-127 9.2 0.0 0.0 0.0 0.0 128-129 9.9875 0.0 0.0 0.0 0.0 130-131 10.7625 0.0 0.0 0.0 0.0 132-133 11.525 0.0 0.0 0.0 0.0 134-135 11.962499999999999 0.0 0.0 0.0 0.0 136-137 12.7 0.0 0.0 0.0 0.0 138-139 13.462499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAGCT 10 0.006832588 144.9875 3 TTGGAAC 10 0.006832588 144.9875 7 >>END_MODULE SRR7170869 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170869_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.047 33.0 33.0 34.0 32.0 34.0 2 33.042 33.0 33.0 34.0 32.0 34.0 3 33.0795 34.0 33.0 34.0 32.0 34.0 4 33.0555 34.0 33.0 34.0 32.0 34.0 5 33.1335 34.0 33.0 34.0 33.0 34.0 6 37.32375 38.0 38.0 38.0 37.0 38.0 7 37.31725 38.0 38.0 38.0 37.0 38.0 8 37.3675 38.0 38.0 38.0 37.0 38.0 9 37.2545 38.0 38.0 38.0 37.0 38.0 10-14 37.2772 38.0 38.0 38.0 37.0 38.0 15-19 37.274 38.0 38.0 38.0 37.0 38.0 20-24 37.1936 38.0 38.0 38.0 37.0 38.0 25-29 37.1513 38.0 38.0 38.0 37.0 38.0 30-34 37.1408 38.0 38.0 38.0 37.0 38.0 35-39 37.13215 38.0 38.0 38.0 37.0 38.0 40-44 37.1682 38.0 38.0 38.0 37.0 38.0 45-49 37.158699999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.0886 38.0 38.0 38.0 36.2 38.0 55-59 36.98524999999999 38.0 38.0 38.0 36.0 38.0 60-64 37.00625 38.0 38.0 38.0 36.0 38.0 65-69 36.94095 38.0 38.0 38.0 36.0 38.0 70-74 36.82365 38.0 38.0 38.0 35.4 38.0 75-79 36.792899999999996 38.0 38.0 38.0 35.4 38.0 80-84 36.58505 38.0 38.0 38.0 34.6 38.0 85-89 36.481550000000006 38.0 38.0 38.0 34.0 38.0 90-94 36.437 38.0 38.0 38.0 34.2 38.0 95-99 36.214 38.0 38.0 38.0 34.0 38.0 100-104 36.044399999999996 38.0 37.6 38.0 33.6 38.0 105-109 35.92495 38.0 37.2 38.0 33.0 38.0 110-114 35.652150000000006 38.0 37.0 38.0 31.4 38.0 115-119 35.3649 38.0 36.6 38.0 31.0 38.0 120-124 35.1384 38.0 36.2 38.0 28.8 38.0 125-129 34.44095 38.0 34.6 38.0 25.0 38.0 130-134 33.99955 38.0 34.0 38.0 22.8 38.0 135-139 33.5983 38.0 33.0 38.0 21.6 38.0 140-144 32.6945 38.0 33.0 38.0 14.6 38.0 145-149 31.68895 38.0 32.2 38.0 8.4 38.0 150-151 25.40625 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 1.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 2.0 13 0.0 14 4.0 15 2.0 16 3.0 17 6.0 18 4.0 19 7.0 20 12.0 21 12.0 22 12.0 23 13.0 24 22.0 25 17.0 26 20.0 27 33.0 28 32.0 29 35.0 30 36.0 31 52.0 32 92.0 33 118.0 34 195.0 35 293.0 36 788.0 37 2181.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.324999999999996 20.549999999999997 12.375 28.749999999999996 2 25.174999999999997 24.95 34.25 15.625 3 19.6 27.05 33.5 19.85 4 22.625 34.625 23.825 18.925 5 24.25 37.15 21.625 16.975 6 19.625 37.7 23.225 19.45 7 18.45 19.3 42.125 20.125 8 19.8 24.975 28.725 26.5 9 21.75 24.224999999999998 28.625 25.4 10-14 23.505000000000003 28.275 26.700000000000003 21.52 15-19 23.18 27.894999999999996 27.935 20.990000000000002 20-24 23.085 28.754999999999995 27.58 20.580000000000002 25-29 22.64 28.555000000000003 28.65 20.155 30-34 22.74 27.800000000000004 28.74 20.72 35-39 23.0 27.51 28.53 20.96 40-44 22.994999999999997 28.294999999999998 27.810000000000002 20.9 45-49 23.01 27.589999999999996 28.865000000000002 20.535 50-54 24.224999999999998 27.584999999999997 28.28 19.91 55-59 23.135 27.88 28.51 20.474999999999998 60-64 23.375 27.395000000000003 28.675 20.555 65-69 23.035 27.750000000000004 28.665000000000003 20.549999999999997 70-74 23.905 28.439999999999998 27.055 20.599999999999998 75-79 23.169999999999998 28.345 27.73 20.755000000000003 80-84 23.525 28.199999999999996 27.965 20.31 85-89 23.97 27.66 27.815 20.555 90-94 23.525 27.99 27.905 20.580000000000002 95-99 23.785 27.865000000000002 27.939999999999998 20.41 100-104 23.9 27.900000000000002 27.6 20.599999999999998 105-109 23.835 27.884999999999998 28.26 20.02 110-114 24.321216060803042 28.526426321316066 27.84639231961598 19.305965298264912 115-119 24.785 27.98 27.465 19.77 120-124 24.36 28.64 27.005000000000003 19.994999999999997 125-129 24.865000000000002 28.53 27.025 19.580000000000002 130-134 25.295 28.03 27.365000000000002 19.31 135-139 25.945 28.455000000000002 26.51 19.09 140-144 26.295 27.889999999999997 27.005000000000003 18.81 145-149 26.47 28.12 26.69 18.72 150-151 27.3875 27.287499999999998 26.474999999999998 18.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 1.5 24 2.0 25 2.5 26 5.5 27 9.5 28 13.5 29 17.0 30 17.0 31 25.5 32 31.5 33 39.0 34 50.0 35 74.5 36 90.0 37 104.5 38 133.0 39 156.0 40 180.0 41 214.5 42 259.5 43 273.0 44 276.0 45 263.5 46 261.0 47 253.5 48 226.0 49 205.5 50 167.5 51 137.5 52 119.0 53 97.0 54 80.0 55 68.0 56 46.5 57 28.5 58 19.0 59 12.0 60 10.5 61 8.5 62 5.0 63 4.0 64 2.0 65 0.5 66 0.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01090540197819 97.6 2 0.8369261983261477 1.6500000000000001 3 0.0760841998478316 0.22499999999999998 4 0.050722799898554397 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025361399949277198 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCT 13 0.325 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.30000000000000004 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.44999999999999996 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 90-91 1.1375 0.0 0.0 0.0 0.0 92-93 1.3875000000000002 0.0 0.0 0.0 0.0 94-95 1.5625 0.0 0.0 0.0 0.0 96-97 1.8375 0.0 0.0 0.0 0.0 98-99 2.0250000000000004 0.0 0.0 0.0 0.0 100-101 2.3375 0.0 0.0 0.0 0.0 102-103 2.6500000000000004 0.0 0.0 0.0 0.0 104-105 3.1375 0.0 0.0 0.0 0.0 106-107 3.4125 0.0 0.0 0.0 0.0 108-109 3.8375000000000004 0.0 0.0 0.0 0.0 110-111 4.375 0.0 0.0 0.0 0.0 112-113 4.8625 0.0 0.0 0.0 0.0 114-115 5.449999999999999 0.0 0.0 0.0 0.0 116-117 6.3125 0.0 0.0 0.0 0.0 118-119 6.824999999999999 0.0 0.0 0.0 0.0 120-121 7.325 0.0 0.0 0.0 0.0 122-123 7.9625 0.0 0.0 0.0 0.0 124-125 8.5625 0.0 0.0 0.0 0.0 126-127 9.1375 0.0 0.0 0.0 0.0 128-129 9.9625 0.0 0.0 0.0 0.0 130-131 10.675 0.0 0.0 0.0 0.0 132-133 11.45 0.0 0.0 0.0 0.0 134-135 11.925 0.0 0.0 0.0 0.0 136-137 12.675 0.0 0.0 0.0 0.0 138-139 13.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTTTT 10 0.006830828 145.0 3 CACCAGC 10 0.006830828 145.0 1 >>END_MODULE Read 751888 spots for SRR7170869.sra Written 751888 spots for SRR7170869.sra Read 751888 spots for SRR7170869.sra Written 751888 spots for SRR7170869.sra Read 751888 spots for SRR7170869.sra Written 751888 spots for SRR7170869.sra Read 751888 spots for SRR7170869.sra Written 751888 spots for SRR7170869.sra Read 751888 spots for SRR7170869.sra Written 751888 spots for SRR7170869.sra Read 751888 spots for SRR7170869.sra Written 751888 spots for SRR7170869.sra Read 751888 spots for SRR7170869.sra Written 751888 spots for SRR7170869.sra Read 751888 spots for SRR7170869.sra Written 751888 spots for SRR7170869.sra Read 751888 spots for SRR7170869.sra Written 751888 spots for SRR7170869.sra Read 751888 spots for SRR7170869.sra Written 751888 spots for SRR7170869.sra Read 751888 spots for SRR7170869.sra Written 751888 spots for SRR7170869.sra Read 751888 spots for SRR7170869.sra Written 751888 spots for SRR7170869.sra Read 751888 spots for SRR7170869.sra Written 751888 spots for SRR7170869.sra Read 751889 spots for SRR7170869.sra Written 751889 spots for SRR7170869.sra Read 751888 spots for SRR7170869.sra Written 751888 spots for SRR7170869.sra Read 751888 spots for SRR7170869.sra Written 751888 spots for SRR7170869.sra Read 751888 spots for SRR7170869.sra Written 751888 spots for SRR7170869.sra Read 751888 spots for SRR7170869.sra Written 751888 spots for SRR7170869.sra Read 751888 spots for SRR7170869.sra Written 751888 spots for SRR7170869.sra Read 751888 spots for SRR7170869.sra Written 751888 spots for SRR7170869.sra SRR ids: ['SRR7170869.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t1cbqog0 SRR7170869.sra spots: 15037761 blocks: [[1, 751888], [751889, 1503776], [1503777, 2255664], [2255665, 3007552], [3007553, 3759440], [3759441, 4511328], [4511329, 5263216], [5263217, 6015104], [6015105, 6766992], [6766993, 7518880], [7518881, 8270768], [8270769, 9022656], [9022657, 9774544], [9774545, 10526432], [10526433, 11278320], [11278321, 12030208], [12030209, 12782096], [12782097, 13533984], [13533985, 14285872], [14285873, 15037761]] SRR7170869 file size 5074103 SRR7170869 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170869 SRR7170869_1.fastq SRR7170869_2.fastq Input file: SRR7170869_1.fastq Paired file: SRR7170869_2.fastq trimmed: SRR7170869-trimmed-pair1.fastq, SRR7170869-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:46:34 2025 >> started Thu Feb 13 20:46:51 2025 >> done (16.688s) 15037761 read pairs processed; of these: 15784 ( 0.10%) short read pairs filtered out after trimming by size control 42122 ( 0.28%) empty read pairs filtered out after trimming by size control 14979855 (99.61%) read pairs available; of these: 10729530 (71.63%) trimmed read pairs available after processing 4250325 (28.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 12 0.00% 20 13 0.00% 21 15 0.00% 22 20 0.00% 23 20 0.00% 24 15 0.00% 25 17 0.00% 26 14 0.00% 27 19 0.00% 28 22 0.00% 29 23 0.00% 30 32 0.00% 31 21 0.00% 32 30 0.00% 33 41 0.00% 34 40 0.00% 35 49 0.00% 36 42 0.00% 37 80 0.00% 38 70 0.00% 39 102 0.00% 40 120 0.00% 41 134 0.00% 42 159 0.00% 43 146 0.00% 44 152 0.00% 45 192 0.00% 46 211 0.00% 47 247 0.00% 48 270 0.00% 49 331 0.00% 50 391 0.00% 51 444 0.00% 52 489 0.00% 53 520 0.00% 54 555 0.00% 55 604 0.00% 56 677 0.00% 57 708 0.00% 58 807 0.01% 59 984 0.01% 60 1117 0.01% 61 1296 0.01% 62 1489 0.01% 63 1501 0.01% 64 1738 0.01% 65 1748 0.01% 66 1938 0.01% 67 2021 0.01% 68 2334 0.02% 69 2575 0.02% 70 3056 0.02% 71 3580 0.02% 72 4141 0.03% 73 4563 0.03% 74 4984 0.03% 75 5441 0.04% 76 7470 0.05% 77 8178 0.05% 78 6972 0.05% 79 7214 0.05% 80 7643 0.05% 81 8966 0.06% 82 9951 0.07% 83 11276 0.08% 84 12694 0.08% 85 13294 0.09% 86 13811 0.09% 87 14645 0.10% 88 15031 0.10% 89 16210 0.11% 90 17228 0.12% 91 18897 0.13% 92 20817 0.14% 93 22311 0.15% 94 23552 0.16% 95 24934 0.17% 96 25602 0.17% 97 26371 0.18% 98 26731 0.18% 99 27885 0.19% 100 29528 0.20% 101 30581 0.20% 102 33323 0.22% 103 35042 0.23% 104 36019 0.24% 105 37906 0.25% 106 38961 0.26% 107 39601 0.26% 108 40168 0.27% 109 41200 0.28% 110 42116 0.28% 111 44250 0.30% 112 45799 0.31% 113 48087 0.32% 114 50075 0.33% 115 52296 0.35% 116 53268 0.36% 117 54211 0.36% 118 55453 0.37% 119 55795 0.37% 120 57533 0.38% 121 59152 0.39% 122 61445 0.41% 123 64750 0.43% 124 67980 0.45% 125 70191 0.47% 126 73028 0.49% 127 74611 0.50% 128 77243 0.52% 129 79460 0.53% 130 82140 0.55% 131 85606 0.57% 132 90607 0.60% 133 96321 0.64% 134 101971 0.68% 135 108597 0.72% 136 116465 0.78% 137 123994 0.83% 138 131980 0.88% 139 142469 0.95% 140 153408 1.02% 141 167413 1.12% 142 185191 1.24% 143 207962 1.39% 144 244670 1.63% 145 288731 1.93% 146 353570 2.36% 147 468397 3.13% 148 681983 4.55% 149 1225298 8.18% 150 3683631 24.59% 151 4250325 28.37% 14979855 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=0.44 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=23.11 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.2 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=17 prefix-density=0.62 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=33.63 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.6 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7170869 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:47:34 Started mapping on | Feb 13 20:47:35 Finished on | Feb 13 20:49:07 Mapping speed, Million of reads per hour | 586.17 Number of input reads | 14979855 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 14092315 Uniquely mapped reads % | 94.08% Average mapped length | 285.40 Number of splices: Total | 12895355 Number of splices: Annotated (sjdb) | 12566883 Number of splices: GT/AG | 12645241 Number of splices: GC/AG | 193166 Number of splices: AT/AC | 8267 Number of splices: Non-canonical | 48681 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 386722 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 89788 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.60% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 511746 511746 511746 N_multimapping 386722 386722 386722 N_noFeature 640019 13806866 767571 N_ambiguous 273117 1199 114412 UnstrandedReadsAssigned:13179179 PositiveStrandReadsAssigned:284250 NegativeStrandReadsAssigned:13210332 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=139 echo kmer=135 SRR7170869 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170869-trimmed-pair1.fastq SRR7170869-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,979,855 reads, 13,215,188 reads pseudoaligned [quant] estimated average fragment length: 221.722 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52401 SRR7170869.ke.tsv 34699 SRR7170869.se.tsv 87100 total ==> SRR7170869.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.28 845 32.9627 Potri.005G024800.1.v4.1 1035 814.278 156 13.4318 Potri.004G059700.1.v4.1 961 740.309 18 1.70467 Potri.007G009000.2.v4.1 1416 1195.28 0 0 Potri.003G141000.2.v4.1 2943 2722.28 668 17.2039 Potri.016G087400.1.v4.1 270 95.6716 816 597.983 Potri.015G069301.1.v4.1 564 348.378 0 0 Potri.010G195200.1.v4.1 1773 1552.28 40.8352 1.84437 Potri.012G127500.1.v4.1 977 756.293 155 14.3689 ==> SRR7170869.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 886 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 320 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 47 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 35 SRR7170869 completed mapping pipeline successfully