Starting /dee2/code/volunteer_pipeline.sh SRR7170870 current disk space = 3088212328448 free memory = 1582460036 SRR7170870 SRAfilesize 4a29c77ebb544b6aaeead33ac005ded2 SRR7170870.sra SRR7170870.sra file validated SRR7170870 is paired end SRR7170870 is conventional basespace SRR7170870 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170870_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82375 34.0 33.0 34.0 32.0 34.0 2 33.224 34.0 33.0 34.0 32.0 34.0 3 33.0855 34.0 33.0 34.0 31.0 34.0 4 33.21075 34.0 33.0 34.0 32.0 34.0 5 33.21675 34.0 33.0 34.0 33.0 34.0 6 36.637 38.0 37.0 38.0 34.0 38.0 7 37.065 38.0 38.0 38.0 36.0 38.0 8 37.32475 38.0 38.0 38.0 37.0 38.0 9 37.31325 38.0 38.0 38.0 37.0 38.0 10-14 37.377050000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.23715 38.0 38.0 38.0 37.0 38.0 20-24 37.2449 38.0 38.0 38.0 36.6 38.0 25-29 37.13415 38.0 38.0 38.0 36.0 38.0 30-34 37.1144 38.0 38.0 38.0 36.2 38.0 35-39 36.95945 38.0 38.0 38.0 35.8 38.0 40-44 36.935449999999996 38.0 38.0 38.0 35.6 38.0 45-49 36.897499999999994 38.0 38.0 38.0 35.2 38.0 50-54 36.619749999999996 38.0 38.0 38.0 34.2 38.0 55-59 36.5796 38.0 38.0 38.0 34.2 38.0 60-64 36.51555 38.0 38.0 38.0 34.0 38.0 65-69 36.47425 38.0 37.8 38.0 33.8 38.0 70-74 36.4622 38.0 37.8 38.0 34.0 38.0 75-79 36.2293 38.0 37.0 38.0 33.4 38.0 80-84 36.164550000000006 38.0 37.2 38.0 33.4 38.0 85-89 35.830650000000006 38.0 37.0 38.0 32.0 38.0 90-94 35.69155000000001 38.0 36.6 38.0 30.6 38.0 95-99 35.52735 38.0 36.4 38.0 29.8 38.0 100-104 34.932050000000004 38.0 35.4 38.0 27.4 38.0 105-109 34.7423 38.0 34.8 38.0 25.8 38.0 110-114 34.587599999999995 38.0 34.4 38.0 25.8 38.0 115-119 34.160399999999996 38.0 33.8 38.0 23.8 38.0 120-124 33.4322 38.0 33.0 38.0 19.4 38.0 125-129 32.56075 38.0 32.2 38.0 14.8 38.0 130-134 31.925400000000003 37.2 30.8 38.0 13.8 38.0 135-139 30.8825 36.2 28.6 38.0 12.6 38.0 140-144 30.737099999999998 36.4 28.2 38.0 11.8 38.0 145-149 28.823649999999997 35.8 24.6 38.0 2.0 38.0 150-151 21.867375000000003 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 2.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 3.0 15 1.0 16 2.0 17 5.0 18 7.0 19 7.0 20 15.0 21 18.0 22 15.0 23 17.0 24 32.0 25 29.0 26 38.0 27 38.0 28 60.0 29 67.0 30 79.0 31 98.0 32 126.0 33 211.0 34 303.0 35 515.0 36 1058.0 37 1250.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.42871613066599 15.370979994935427 9.496074955684984 31.7042289187136 2 21.15 19.575 35.449999999999996 23.825 3 18.41841841841842 26.601601601601605 29.754754754754753 25.225225225225223 4 21.349999999999998 31.95 26.200000000000003 20.5 5 21.375 36.075 24.85 17.7 6 18.275 35.099999999999994 26.150000000000002 20.474999999999998 7 14.124999999999998 23.75 43.974999999999994 18.15 8 18.575 23.425 30.8 27.200000000000003 9 17.724999999999998 22.725 33.25 26.3 10-14 19.74 30.314999999999998 26.155 23.79 15-19 19.535 28.765 28.425 23.275000000000002 20-24 20.16 28.985 28.13 22.725 25-29 20.044999999999998 29.25 27.675 23.03 30-34 19.515 29.2 27.79 23.494999999999997 35-39 19.86 28.470000000000002 28.33 23.34 40-44 20.02 28.915000000000003 27.665 23.400000000000002 45-49 19.63 29.244999999999997 27.534999999999997 23.59 50-54 20.125 28.645 28.15 23.080000000000002 55-59 19.215 28.73 28.27 23.785 60-64 20.055 29.005 27.644999999999996 23.294999999999998 65-69 19.855 28.53 27.98 23.635 70-74 20.215 28.42 28.249999999999996 23.115 75-79 20.544999999999998 28.185 28.09 23.18 80-84 19.935 28.335 28.565 23.165 85-89 20.674999999999997 28.465 27.915 22.945 90-94 19.955000000000002 28.904999999999998 27.935 23.205000000000002 95-99 20.385 28.970000000000002 27.395000000000003 23.25 100-104 20.465 29.054999999999996 27.544999999999998 22.935 105-109 20.244999999999997 28.439999999999998 27.79 23.525 110-114 20.794999999999998 28.025 27.685 23.494999999999997 115-119 20.96 28.835 26.645000000000003 23.56 120-124 21.215 28.715000000000003 26.805 23.265 125-129 20.375 27.779999999999998 27.839999999999996 24.005000000000003 130-134 20.7 28.884999999999998 26.815 23.599999999999998 135-139 20.57 28.88 26.450000000000003 24.099999999999998 140-144 20.72310846626994 27.954193128969347 27.014052107816173 24.30864629694454 145-149 21.237123712371236 28.54785478547855 26.567656765676567 23.647364736473648 150-151 21.45 28.712500000000002 26.1125 23.724999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 1.5 17 2.0 18 1.0 19 1.0 20 2.0 21 2.5 22 2.0 23 1.5 24 3.5 25 8.5 26 12.0 27 13.5 28 18.5 29 22.5 30 29.0 31 36.0 32 46.0 33 62.5 34 76.0 35 91.5 36 109.0 37 117.5 38 132.5 39 168.5 40 201.0 41 206.5 42 229.5 43 257.0 44 245.0 45 226.5 46 226.5 47 228.5 48 216.5 49 199.5 50 172.5 51 146.0 52 104.5 53 78.0 54 74.0 55 61.5 56 54.0 57 35.5 58 19.0 59 15.0 60 11.5 61 11.0 62 8.0 63 2.5 64 1.5 65 2.0 66 0.5 67 1.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 0.0 3 0.1 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37027707808565 98.625 2 0.5289672544080605 1.05 3 0.07556675062972291 0.22499999999999998 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.45 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.2625 0.0 0.0 0.0 0.0 98-99 1.4625 0.0 0.0 0.0 0.0 100-101 1.6625 0.0 0.0 0.0 0.0 102-103 2.0 0.0 0.0 0.0 0.0 104-105 2.25 0.0 0.0 0.0 0.0 106-107 2.425 0.0 0.0 0.0 0.0 108-109 2.7375 0.0 0.0 0.0 0.0 110-111 3.1 0.0 0.0 0.0 0.0 112-113 3.4875 0.0 0.0 0.0 0.0 114-115 4.0 0.0 0.0 0.0 0.0 116-117 4.612500000000001 0.0 0.0 0.0 0.0 118-119 5.15 0.0 0.0 0.0 0.0 120-121 5.7125 0.0 0.0 0.0 0.0 122-123 6.074999999999999 0.0 0.0 0.0 0.0 124-125 6.6 0.0 0.0 0.0 0.0 126-127 7.050000000000001 0.0 0.0 0.0 0.0 128-129 7.65 0.0 0.0 0.0 0.0 130-131 8.225000000000001 0.0 0.0 0.0 0.0 132-133 8.7625 0.0 0.0 0.0 0.0 134-135 9.4375 0.0 0.0 0.0 0.0 136-137 10.05 0.0 0.0 0.0 0.0 138-139 10.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTCTTC 10 0.006830828 145.0 8 GTCTTCC 10 0.006830828 145.0 9 >>END_MODULE SRR7170870 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170870_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8695 33.0 33.0 34.0 32.0 34.0 2 32.9565 33.0 33.0 34.0 32.0 34.0 3 33.00025 34.0 33.0 34.0 32.0 34.0 4 32.91625 34.0 33.0 34.0 32.0 34.0 5 32.87025 34.0 33.0 34.0 32.0 34.0 6 37.0775 38.0 38.0 38.0 36.0 38.0 7 37.13175 38.0 38.0 38.0 36.0 38.0 8 37.15225 38.0 38.0 38.0 37.0 38.0 9 37.103 38.0 38.0 38.0 36.0 38.0 10-14 37.09245 38.0 38.0 38.0 36.8 38.0 15-19 37.09485 38.0 38.0 38.0 37.0 38.0 20-24 37.020300000000006 38.0 38.0 38.0 36.2 38.0 25-29 36.95425 38.0 38.0 38.0 36.0 38.0 30-34 36.962149999999994 38.0 38.0 38.0 36.0 38.0 35-39 36.808800000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.8848 38.0 38.0 38.0 36.0 38.0 45-49 36.829049999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.76755 38.0 38.0 38.0 35.6 38.0 55-59 36.70895 38.0 38.0 38.0 35.0 38.0 60-64 36.6748 38.0 38.0 38.0 35.0 38.0 65-69 36.56125 38.0 38.0 38.0 34.2 38.0 70-74 36.574349999999995 38.0 38.0 38.0 34.6 38.0 75-79 36.43044999999999 38.0 38.0 38.0 34.2 38.0 80-84 36.210300000000004 38.0 38.0 38.0 33.8 38.0 85-89 36.13195 38.0 37.8 38.0 33.4 38.0 90-94 35.93375 38.0 37.2 38.0 32.6 38.0 95-99 35.88055 38.0 37.0 38.0 32.6 38.0 100-104 35.7354 38.0 37.0 38.0 31.4 38.0 105-109 35.63250000000001 38.0 37.0 38.0 31.0 38.0 110-114 35.4012 38.0 36.8 38.0 30.4 38.0 115-119 35.0173 38.0 36.0 38.0 28.0 38.0 120-124 34.55505 38.0 35.4 38.0 25.4 38.0 125-129 34.0173 38.0 33.6 38.0 23.0 38.0 130-134 33.33925 38.0 33.0 38.0 18.8 38.0 135-139 32.67015 38.0 33.0 38.0 14.6 38.0 140-144 31.560249999999996 37.8 31.0 38.0 12.4 38.0 145-149 29.913 36.0 28.0 38.0 3.8 38.0 150-151 23.973750000000003 31.0 13.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 5.0 4 2.0 5 1.0 6 1.0 7 3.0 8 0.0 9 0.0 10 1.0 11 2.0 12 1.0 13 5.0 14 4.0 15 3.0 16 7.0 17 6.0 18 5.0 19 5.0 20 11.0 21 12.0 22 14.0 23 18.0 24 16.0 25 23.0 26 32.0 27 38.0 28 47.0 29 53.0 30 52.0 31 82.0 32 105.0 33 130.0 34 195.0 35 348.0 36 914.0 37 1856.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.625 19.85 11.575000000000001 23.95 2 25.481370342585645 24.58114528632158 33.633408352088026 16.30407601900475 3 20.965724293219914 28.19614711033275 32.07405554165624 18.764073054791094 4 23.892919689767325 34.125594195646734 23.267450587940957 18.714035526644984 5 24.49337002752064 37.3530147610708 22.241681260945708 15.911933950462847 6 19.339504628471353 38.72904678508882 23.217413059794847 18.714035526644984 7 19.21441080810608 19.11433575181386 41.10582937202902 20.565424068051037 8 19.78984238178634 25.193895421566175 28.246184638478862 26.770077558168627 9 22.166624968726545 25.21891418563923 28.946710032524393 23.667750813109834 10-14 23.259770805184406 28.494220087074012 27.268177951258572 20.97783115648301 15-19 23.131975376607777 27.806416095290526 28.321905810519993 20.739702717581704 20-24 23.34834834834835 28.428428428428425 28.03803803803804 20.185185185185187 25-29 22.51251251251251 28.663663663663662 28.16816816816817 20.655655655655654 30-34 22.347347347347345 27.8978978978979 28.41841841841842 21.336336336336338 35-39 23.433433433433436 28.603603603603606 27.60760760760761 20.355355355355357 40-44 22.28228228228228 28.388388388388385 28.143143143143146 21.186186186186188 45-49 22.67767767767768 28.138138138138135 28.3983983983984 20.785785785785784 50-54 22.902902902902902 27.692692692692695 28.22822822822823 21.176176176176178 55-59 22.992992992992995 28.273273273273276 27.93793793793794 20.795795795795797 60-64 22.82782782782783 27.2022022022022 28.743743743743742 21.226226226226228 65-69 23.16816816816817 28.153153153153156 28.423423423423422 20.255255255255257 70-74 23.273273273273272 27.732732732732735 28.338338338338335 20.655655655655654 75-79 23.52852852852853 27.627627627627625 28.123123123123122 20.72072072072072 80-84 23.053053053053052 28.103103103103106 27.872872872872872 20.97097097097097 85-89 23.443443443443442 27.74274274274274 28.138138138138135 20.675675675675677 90-94 23.513513513513516 27.42242242242242 28.56856856856857 20.495495495495494 95-99 23.70870870870871 27.6976976976977 28.033033033033032 20.56056056056056 100-104 23.30830830830831 28.083083083083082 28.24824824824825 20.36036036036036 105-109 23.45845845845846 27.762762762762762 28.15815815815816 20.62062062062062 110-114 23.63863863863864 28.61861861861862 27.28228228228228 20.46046046046046 115-119 24.38938938938939 27.90790790790791 27.60760760760761 20.095095095095093 120-124 24.61961961961962 28.153153153153156 27.842842842842842 19.384384384384383 125-129 24.534534534534536 28.45845845845846 26.54154154154154 20.465465465465467 130-134 24.38938938938939 27.872872872872872 27.807807807807805 19.92992992992993 135-139 24.834834834834833 28.483483483483486 26.901901901901905 19.77977977977978 140-144 25.292822104314745 27.955751326459104 26.699369306236857 20.05205726298929 145-149 26.116116116116117 27.922922922922922 26.62162162162162 19.33933933933934 150-151 26.326326326326328 28.603603603603606 26.363863863863862 18.706206206206204 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 2.0 23 1.5 24 2.0 25 3.5 26 4.0 27 6.5 28 7.0 29 12.0 30 19.0 31 21.0 32 34.5 33 41.0 34 43.0 35 67.5 36 94.0 37 120.5 38 145.5 39 165.0 40 201.5 41 235.5 42 249.5 43 266.5 44 278.5 45 275.0 46 256.5 47 245.0 48 228.5 49 185.5 50 159.0 51 130.5 52 105.0 53 86.5 54 76.0 55 72.5 56 45.5 57 31.0 58 24.5 59 15.5 60 12.0 61 7.0 62 4.5 63 4.0 64 2.0 65 0.5 66 0.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-14 0.08499999999999999 15-19 0.095 20-24 0.1 25-29 0.1 30-34 0.1 35-39 0.1 40-44 0.1 45-49 0.1 50-54 0.1 55-59 0.1 60-64 0.1 65-69 0.1 70-74 0.1 75-79 0.1 80-84 0.1 85-89 0.1 90-94 0.1 95-99 0.1 100-104 0.1 105-109 0.1 110-114 0.1 115-119 0.1 120-124 0.1 125-129 0.1 130-134 0.1 135-139 0.1 140-144 0.11 145-149 0.1 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08814589665653 97.8 2 0.7092198581560284 1.4000000000000001 3 0.12664640324214793 0.375 4 0.025329280648429587 0.1 5 0.025329280648429587 0.125 6 0.0 0.0 7 0.0 0.0 8 0.025329280648429587 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 8 0.2 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0125 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0125 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.05 0.0 0.0 0.025 0.0 70-71 0.0625 0.0 0.0 0.025 0.0 72-73 0.075 0.0 0.0 0.025 0.0 74-75 0.125 0.0 0.0 0.025 0.0 76-77 0.15 0.0 0.0 0.025 0.0 78-79 0.15 0.0 0.0 0.025 0.0 80-81 0.2 0.0 0.0 0.025 0.0 82-83 0.3125 0.0 0.0 0.025 0.0 84-85 0.425 0.0 0.0 0.025 0.0 86-87 0.475 0.0 0.0 0.025 0.0 88-89 0.6 0.0 0.0 0.025 0.0 90-91 0.7375 0.0 0.0 0.025 0.0 92-93 0.9125 0.0 0.0 0.025 0.0 94-95 1.1375000000000002 0.0 0.0 0.025 0.0 96-97 1.2375 0.0 0.0 0.025 0.0 98-99 1.4375 0.0 0.0 0.025 0.0 100-101 1.6375 0.0 0.0 0.025 0.0 102-103 1.9625 0.0 0.0 0.025 0.0 104-105 2.25 0.0 0.0 0.025 0.0 106-107 2.425 0.0 0.0 0.025 0.0 108-109 2.7125 0.0 0.0 0.025 0.0 110-111 3.075 0.0 0.0 0.025 0.0 112-113 3.425 0.0 0.0 0.025 0.0 114-115 3.9625000000000004 0.0 0.0 0.025 0.0 116-117 4.5625 0.0 0.0 0.025 0.0 118-119 5.0875 0.0 0.0 0.025 0.0 120-121 5.6125 0.0 0.0 0.025 0.0 122-123 5.975 0.0 0.0 0.025 0.0 124-125 6.55 0.0 0.0 0.025 0.0 126-127 7.0625 0.0 0.0 0.025 0.0 128-129 7.675000000000001 0.0 0.0 0.025 0.0 130-131 8.2375 0.0 0.0 0.025 0.0 132-133 8.787500000000001 0.0 0.0 0.025 0.0 134-135 9.5125 0.0 0.0 0.025 0.0 136-137 10.1 0.0 0.0 0.025 0.0 138-139 10.75 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACATTC 10 0.006830828 145.0 3 ACATTCA 10 0.006830828 145.0 4 >>END_MODULE Read 541696 spots for SRR7170870.sra Written 541696 spots for SRR7170870.sra Read 541696 spots for SRR7170870.sra Written 541696 spots for SRR7170870.sra Read 541696 spots for SRR7170870.sra Written 541696 spots for SRR7170870.sra Read 541696 spots for SRR7170870.sra Written 541696 spots for SRR7170870.sra Read 541696 spots for SRR7170870.sra Written 541696 spots for SRR7170870.sra Read 541696 spots for SRR7170870.sra Written 541696 spots for SRR7170870.sra Read 541696 spots for SRR7170870.sra Written 541696 spots for SRR7170870.sra Read 541696 spots for SRR7170870.sra Written 541696 spots for SRR7170870.sra Read 541696 spots for SRR7170870.sra Written 541696 spots for SRR7170870.sra Read 541696 spots for SRR7170870.sra Written 541696 spots for SRR7170870.sra Read 541696 spots for SRR7170870.sra Written 541696 spots for SRR7170870.sra Read 541696 spots for SRR7170870.sra Written 541696 spots for SRR7170870.sra Read 541696 spots for SRR7170870.sra Written 541696 spots for SRR7170870.sra Read 541696 spots for SRR7170870.sra Written 541696 spots for SRR7170870.sra Read 541696 spots for SRR7170870.sra Written 541696 spots for SRR7170870.sra Read 541696 spots for SRR7170870.sra Written 541696 spots for SRR7170870.sra Read 541696 spots for SRR7170870.sra Written 541696 spots for SRR7170870.sra Read 541696 spots for SRR7170870.sra Written 541696 spots for SRR7170870.sra Read 541703 spots for SRR7170870.sra Written 541703 spots for SRR7170870.sra Read 541696 spots for SRR7170870.sra Written 541696 spots for SRR7170870.sra SRR ids: ['SRR7170870.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__e1h8ese SRR7170870.sra spots: 10833927 blocks: [[1, 541696], [541697, 1083392], [1083393, 1625088], [1625089, 2166784], [2166785, 2708480], [2708481, 3250176], [3250177, 3791872], [3791873, 4333568], [4333569, 4875264], [4875265, 5416960], [5416961, 5958656], [5958657, 6500352], [6500353, 7042048], [7042049, 7583744], [7583745, 8125440], [8125441, 8667136], [8667137, 9208832], [9208833, 9750528], [9750529, 10292224], [10292225, 10833927]] SRR7170870 file size 3649561 SRR7170870 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170870 SRR7170870_1.fastq SRR7170870_2.fastq Input file: SRR7170870_1.fastq Paired file: SRR7170870_2.fastq trimmed: SRR7170870-trimmed-pair1.fastq, SRR7170870-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:23:53 2025 >> started Thu Feb 13 21:24:05 2025 >> done (12.037s) 10833927 read pairs processed; of these: 13448 ( 0.12%) short read pairs filtered out after trimming by size control 28640 ( 0.26%) empty read pairs filtered out after trimming by size control 10791839 (99.61%) read pairs available; of these: 7586094 (70.29%) trimmed read pairs available after processing 3205745 (29.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 9 0.00% 20 6 0.00% 21 9 0.00% 22 17 0.00% 23 13 0.00% 24 9 0.00% 25 14 0.00% 26 12 0.00% 27 10 0.00% 28 17 0.00% 29 12 0.00% 30 19 0.00% 31 19 0.00% 32 13 0.00% 33 17 0.00% 34 7 0.00% 35 24 0.00% 36 27 0.00% 37 24 0.00% 38 21 0.00% 39 34 0.00% 40 40 0.00% 41 46 0.00% 42 34 0.00% 43 40 0.00% 44 53 0.00% 45 55 0.00% 46 68 0.00% 47 94 0.00% 48 98 0.00% 49 115 0.00% 50 118 0.00% 51 141 0.00% 52 164 0.00% 53 175 0.00% 54 184 0.00% 55 210 0.00% 56 272 0.00% 57 292 0.00% 58 326 0.00% 59 352 0.00% 60 407 0.00% 61 518 0.00% 62 541 0.01% 63 611 0.01% 64 727 0.01% 65 708 0.01% 66 797 0.01% 67 886 0.01% 68 1060 0.01% 69 1213 0.01% 70 1297 0.01% 71 1545 0.01% 72 1914 0.02% 73 2033 0.02% 74 2339 0.02% 75 2560 0.02% 76 3239 0.03% 77 3649 0.03% 78 3497 0.03% 79 3676 0.03% 80 4031 0.04% 81 4723 0.04% 82 5253 0.05% 83 6155 0.06% 84 7327 0.07% 85 7662 0.07% 86 8129 0.08% 87 8590 0.08% 88 9131 0.08% 89 9412 0.09% 90 10193 0.09% 91 11425 0.11% 92 12033 0.11% 93 13416 0.12% 94 14249 0.13% 95 15152 0.14% 96 15562 0.14% 97 16227 0.15% 98 16874 0.16% 99 17573 0.16% 100 18592 0.17% 101 19321 0.18% 102 21076 0.20% 103 22131 0.21% 104 23158 0.21% 105 24519 0.23% 106 25686 0.24% 107 26330 0.24% 108 26648 0.25% 109 27507 0.25% 110 28315 0.26% 111 29436 0.27% 112 31043 0.29% 113 32222 0.30% 114 33880 0.31% 115 35371 0.33% 116 36611 0.34% 117 37594 0.35% 118 38638 0.36% 119 39102 0.36% 120 39880 0.37% 121 41755 0.39% 122 43048 0.40% 123 45769 0.42% 124 47736 0.44% 125 49573 0.46% 126 51941 0.48% 127 53370 0.49% 128 55180 0.51% 129 57384 0.53% 130 59704 0.55% 131 61755 0.57% 132 65068 0.60% 133 68657 0.64% 134 72743 0.67% 135 77331 0.72% 136 81908 0.76% 137 86879 0.81% 138 93177 0.86% 139 99209 0.92% 140 106291 0.98% 141 115184 1.07% 142 128097 1.19% 143 145270 1.35% 144 167287 1.55% 145 198397 1.84% 146 247700 2.30% 147 327947 3.04% 148 481921 4.47% 149 882101 8.17% 150 2707099 25.08% 151 3205745 29.71% 10791839 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=16 prefix-density=0.50 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=53.52 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.7 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=25 prefix-density=0.64 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=17.65 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=1.5 sequence=CAGCATCCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTAGAATAAAAGGGGTGCTCGAGCATGTTTGAGCT SRR7170870 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:24:55 Started mapping on | Feb 13 21:24:55 Finished on | Feb 13 21:26:11 Mapping speed, Million of reads per hour | 511.19 Number of input reads | 10791839 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 10160066 Uniquely mapped reads % | 94.15% Average mapped length | 286.62 Number of splices: Total | 9434522 Number of splices: Annotated (sjdb) | 9196717 Number of splices: GT/AG | 9249100 Number of splices: GC/AG | 142703 Number of splices: AT/AC | 6250 Number of splices: Non-canonical | 36469 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 312796 % of reads mapped to multiple loci | 2.90% Number of reads mapped to too many loci | 13904 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.78% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 330019 330019 330019 N_multimapping 312796 312796 312796 N_noFeature 405964 9949862 507879 N_ambiguous 185518 848 76696 UnstrandedReadsAssigned:9568584 PositiveStrandReadsAssigned:209356 NegativeStrandReadsAssigned:9575491 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=140 echo kmer=135 SRR7170870 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170870-trimmed-pair1.fastq SRR7170870-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,791,839 reads, 9,564,095 reads pseudoaligned [quant] estimated average fragment length: 223 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,015 rounds 52401 SRR7170870.ke.tsv 34699 SRR7170870.se.tsv 87100 total ==> SRR7170870.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796 506 25.3132 Potri.005G024800.1.v4.1 1035 813 287 31.7171 Potri.004G059700.1.v4.1 961 739.015 19 2.30995 Potri.007G009000.2.v4.1 1416 1194 0 0 Potri.003G141000.2.v4.1 2943 2721 600 19.8119 Potri.016G087400.1.v4.1 270 93.4503 707 679.738 Potri.015G069301.1.v4.1 564 346.342 0 0 Potri.010G195200.1.v4.1 1773 1551 50 2.89642 Potri.012G127500.1.v4.1 977 755.015 121 14.399 ==> SRR7170870.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 579 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 253 Potri.001G212900.v4.1 200 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170870 completed mapping pipeline successfully