Starting /dee2/code/volunteer_pipeline.sh SRR7170871 current disk space = 3088073617408 free memory = 1508465288 SRR7170871 SRAfilesize 4483b098c993df445e48622835bcbf71 SRR7170871.sra SRR7170871.sra file validated SRR7170871 is paired end SRR7170871 is conventional basespace SRR7170871 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170871_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.46275 34.0 33.0 34.0 32.0 34.0 2 33.25875 34.0 33.0 34.0 32.0 34.0 3 33.251 34.0 33.0 34.0 33.0 34.0 4 33.44 34.0 33.0 34.0 33.0 34.0 5 33.39225 34.0 33.0 34.0 33.0 34.0 6 36.8285 38.0 37.0 38.0 35.0 38.0 7 37.31675 38.0 38.0 38.0 36.0 38.0 8 37.433 38.0 38.0 38.0 37.0 38.0 9 37.46975 38.0 38.0 38.0 37.0 38.0 10-14 37.511300000000006 38.0 38.0 38.0 37.6 38.0 15-19 37.45935 38.0 38.0 38.0 37.0 38.0 20-24 37.45119999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.39605 38.0 38.0 38.0 37.0 38.0 30-34 37.330650000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.29045 38.0 38.0 38.0 37.0 38.0 40-44 37.2556 38.0 38.0 38.0 36.8 38.0 45-49 37.16330000000001 38.0 38.0 38.0 36.0 38.0 50-54 37.0976 38.0 38.0 38.0 36.0 38.0 55-59 36.9666 38.0 38.0 38.0 35.6 38.0 60-64 36.8701 38.0 38.0 38.0 35.4 38.0 65-69 36.879200000000004 38.0 38.0 38.0 35.6 38.0 70-74 36.818799999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.7136 38.0 38.0 38.0 34.8 38.0 80-84 36.4152 38.0 37.6 38.0 34.0 38.0 85-89 36.44575 38.0 37.6 38.0 34.0 38.0 90-94 36.2699 38.0 37.0 38.0 33.6 38.0 95-99 36.19215 38.0 37.2 38.0 33.6 38.0 100-104 35.92545 38.0 37.0 38.0 32.0 38.0 105-109 35.8113 38.0 37.0 38.0 31.2 38.0 110-114 35.466699999999996 38.0 36.2 38.0 29.8 38.0 115-119 35.2201 38.0 36.0 38.0 29.4 38.0 120-124 34.88015 38.0 35.2 38.0 28.0 38.0 125-129 34.376099999999994 38.0 33.8 38.0 25.6 38.0 130-134 33.97165 38.0 33.0 38.0 24.0 38.0 135-139 33.15475 38.0 33.0 38.0 19.2 38.0 140-144 32.21810000000001 37.6 32.2 38.0 13.6 38.0 145-149 31.101800000000004 36.8 30.4 38.0 8.4 38.0 150-151 24.5715 31.5 15.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 3.0 12 0.0 13 0.0 14 2.0 15 3.0 16 2.0 17 1.0 18 4.0 19 5.0 20 2.0 21 7.0 22 7.0 23 5.0 24 15.0 25 29.0 26 20.0 27 24.0 28 34.0 29 45.0 30 54.0 31 68.0 32 74.0 33 141.0 34 231.0 35 439.0 36 1115.0 37 1669.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.883870967741935 14.941935483870969 10.348387096774193 36.825806451612905 2 21.099999999999998 19.025 36.925000000000004 22.95 3 17.424999999999997 26.325 26.55 29.7 4 21.8 33.025 22.875 22.3 5 21.675 36.95 23.9 17.474999999999998 6 17.05 35.85 26.974999999999998 20.125 7 14.7 21.224999999999998 45.425 18.65 8 18.05 23.474999999999998 30.425 28.050000000000004 9 17.974999999999998 22.675 33.5 25.85 10-14 20.14 29.99 26.5 23.369999999999997 15-19 19.89 28.904999999999998 27.465 23.74 20-24 19.24 28.849999999999998 28.015 23.895 25-29 19.919999999999998 28.685 27.97 23.425 30-34 20.385 28.875 27.63 23.11 35-39 19.869999999999997 28.46 28.24 23.43 40-44 19.634999999999998 29.15 27.445000000000004 23.77 45-49 20.185 28.99 27.26 23.565 50-54 19.895 28.52 27.875 23.71 55-59 20.095 28.53 27.584999999999997 23.79 60-64 19.655 28.994999999999997 27.93 23.419999999999998 65-69 20.200000000000003 28.58 27.935 23.285 70-74 20.335 28.42 27.91 23.335 75-79 20.669999999999998 28.975 27.42 22.935 80-84 20.115 28.51 27.68 23.695 85-89 20.335 28.549999999999997 27.229999999999997 23.885 90-94 20.105 29.185 27.279999999999998 23.43 95-99 20.23 27.889999999999997 28.335 23.544999999999998 100-104 20.715 28.825 27.735 22.725 105-109 20.705000000000002 29.2 27.084999999999997 23.01 110-114 20.665 28.610000000000003 27.345000000000002 23.380000000000003 115-119 21.025 29.03 26.900000000000002 23.044999999999998 120-124 20.974999999999998 28.585 27.375 23.064999999999998 125-129 21.035 28.89 26.384999999999998 23.69 130-134 20.9 28.98 26.295 23.825 135-139 21.15 28.57 26.6 23.68 140-144 21.355 28.515 26.58 23.549999999999997 145-149 21.044999999999998 28.48 26.605 23.87 150-151 21.762500000000003 28.175 26.0625 24.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 2.5 23 3.0 24 3.5 25 3.5 26 5.0 27 12.0 28 16.0 29 18.0 30 24.0 31 31.5 32 40.0 33 50.5 34 67.0 35 78.5 36 96.5 37 121.0 38 138.5 39 159.5 40 203.0 41 234.5 42 235.5 43 244.5 44 249.0 45 250.0 46 258.5 47 253.0 48 235.0 49 205.0 50 159.0 51 122.5 52 88.5 53 72.5 54 77.0 55 67.0 56 47.5 57 33.5 58 25.5 59 22.0 60 15.0 61 6.0 62 7.0 63 6.5 64 3.5 65 2.0 66 1.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.8999999999999999 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.2875 0.0 0.0 0.0 0.0 98-99 1.475 0.0 0.0 0.0 0.0 100-101 1.625 0.0 0.0 0.0 0.0 102-103 1.7625000000000002 0.0 0.0 0.0 0.0 104-105 2.1125 0.0 0.0 0.0 0.0 106-107 2.3499999999999996 0.0 0.0 0.0 0.0 108-109 2.6500000000000004 0.0 0.0 0.0 0.0 110-111 2.95 0.0 0.0 0.0 0.0 112-113 3.4124999999999996 0.0 0.0 0.0 0.0 114-115 3.8125 0.0 0.0 0.0 0.0 116-117 4.2875 0.0 0.0 0.0 0.0 118-119 4.7875 0.0 0.0 0.0 0.0 120-121 5.2875 0.0 0.0 0.0 0.0 122-123 5.825 0.0 0.0 0.0 0.0 124-125 6.262499999999999 0.0 0.0 0.0 0.0 126-127 6.8125 0.0 0.0 0.0 0.0 128-129 7.475 0.0 0.0 0.0 0.0 130-131 8.0875 0.0 0.0 0.0 0.0 132-133 8.6875 0.0 0.0 0.0 0.0 134-135 9.225000000000001 0.0 0.0 0.0 0.0 136-137 9.8625 0.0 0.0 0.0 0.0 138-139 10.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTGCC 10 0.006830828 145.0 4 >>END_MODULE SRR7170871 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170871_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.061 33.0 33.0 34.0 32.0 34.0 2 33.13675 34.0 33.0 34.0 33.0 34.0 3 33.186 34.0 33.0 34.0 33.0 34.0 4 33.17025 34.0 33.0 34.0 33.0 34.0 5 33.1155 34.0 33.0 34.0 33.0 34.0 6 37.36825 38.0 38.0 38.0 37.0 38.0 7 37.40225 38.0 38.0 38.0 37.0 38.0 8 37.383 38.0 38.0 38.0 37.0 38.0 9 37.40625 38.0 38.0 38.0 38.0 38.0 10-14 37.3808 38.0 38.0 38.0 37.4 38.0 15-19 37.3874 38.0 38.0 38.0 37.0 38.0 20-24 37.2861 38.0 38.0 38.0 37.0 38.0 25-29 37.1962 38.0 38.0 38.0 37.0 38.0 30-34 37.19905 38.0 38.0 38.0 37.0 38.0 35-39 37.14805 38.0 38.0 38.0 37.0 38.0 40-44 37.12205 38.0 38.0 38.0 37.0 38.0 45-49 37.12345 38.0 38.0 38.0 37.0 38.0 50-54 37.08595 38.0 38.0 38.0 36.6 38.0 55-59 37.01969999999999 38.0 38.0 38.0 36.0 38.0 60-64 36.99285 38.0 38.0 38.0 36.0 38.0 65-69 36.96075 38.0 38.0 38.0 36.0 38.0 70-74 36.838750000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.7205 38.0 38.0 38.0 35.0 38.0 80-84 36.63575 38.0 38.0 38.0 35.0 38.0 85-89 36.6289 38.0 38.0 38.0 35.0 38.0 90-94 36.432 38.0 38.0 38.0 34.0 38.0 95-99 36.385000000000005 38.0 38.0 38.0 34.0 38.0 100-104 36.22515 38.0 38.0 38.0 33.8 38.0 105-109 35.97195 38.0 37.4 38.0 32.8 38.0 110-114 35.902049999999996 38.0 37.0 38.0 33.0 38.0 115-119 35.67235 38.0 37.0 38.0 31.6 38.0 120-124 35.3761 38.0 36.2 38.0 29.8 38.0 125-129 34.945949999999996 38.0 36.0 38.0 27.6 38.0 130-134 34.43005 38.0 34.6 38.0 25.8 38.0 135-139 33.81525 38.0 33.2 38.0 23.2 38.0 140-144 33.016000000000005 38.0 33.0 38.0 15.6 38.0 145-149 31.94735 38.0 33.0 38.0 10.4 38.0 150-151 26.873125 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 3.0 5 3.0 6 1.0 7 2.0 8 0.0 9 2.0 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 6.0 16 1.0 17 3.0 18 5.0 19 6.0 20 9.0 21 11.0 22 6.0 23 20.0 24 21.0 25 13.0 26 17.0 27 34.0 28 30.0 29 35.0 30 42.0 31 58.0 32 66.0 33 91.0 34 148.0 35 290.0 36 650.0 37 2421.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.7 18.525 13.975000000000001 27.800000000000004 2 25.825825825825827 23.5985985985986 33.30830830830831 17.26726726726727 3 20.645645645645647 26.901901901901905 32.63263263263263 19.81981981981982 4 23.54265699274456 35.57668251188391 23.492619464598448 17.38804103077308 5 24.374374374374376 36.63663663663664 21.546546546546548 17.442442442442445 6 18.275 39.550000000000004 23.0 19.175 7 18.125 18.2 42.3 21.375 8 21.075 23.025000000000002 28.449999999999996 27.450000000000003 9 21.95 23.3 30.275000000000002 24.474999999999998 10-14 23.04 28.415000000000003 27.105 21.44 15-19 22.3911195559778 28.376418820941048 28.206410320516024 21.026051302565126 20-24 22.60243133723548 29.091000050027517 27.840312171694432 20.466256441042574 25-29 23.201681934224357 28.617910597186764 27.7919607548681 20.38844671372078 30-34 22.098258955373222 28.276966179707824 28.62217330398239 21.00260156093656 35-39 23.05537491871342 27.717472862788256 28.217697964083836 21.009454254414486 40-44 22.80096067247073 27.799459621735213 28.72510757530271 20.674472130491345 45-49 22.681340670335167 28.52426213106553 27.878939469734863 20.915457728864432 50-54 22.90603422395677 28.024617232062443 28.53997798458921 20.529370559391573 55-59 23.30315610463662 28.229880458160356 28.079827939778923 20.3871354974241 60-64 23.056917075122538 27.773331999599883 28.43853155946784 20.731219365809743 65-69 23.420539242659196 26.8971036966635 28.75293882247011 20.92941823820719 70-74 22.327814735157308 27.694693142599906 28.67003451207923 21.307457610163556 75-79 22.948031811133898 27.78972640424148 27.96478767568649 21.297454108938126 80-84 22.936468234117058 27.813906953476735 27.943971985993 21.30565282641321 85-89 23.418512776916536 28.389258388758314 27.664149622443368 20.528079211881785 90-94 23.58707612283685 28.128438531559468 27.673301990597178 20.611183355006503 95-99 23.151157557877895 28.521426071303562 27.841392069603483 20.48602430121506 100-104 23.820955238809702 27.591897974493623 28.377094273568392 20.210052513128282 105-109 23.82452981192477 27.490996398559425 27.896158463385355 20.78831532613045 110-114 24.013602040306044 28.4742711406711 27.874181127169074 19.63794569185378 115-119 24.345955680056026 28.412785753589116 27.55239857936071 19.68885998699415 120-124 24.155870141563703 27.572407583412534 27.84753138912511 20.424190885898653 125-129 24.809923969587835 27.861144457783116 27.435974389755902 19.89295718287315 130-134 24.956239059764943 28.1470367591898 27.24181045261315 19.654913728432106 135-139 24.782434730419126 27.908372511753527 27.163148944683407 20.146043813143944 140-144 25.546386596649164 27.84196049012253 27.191797949487373 19.419854963740935 145-149 25.789026159155704 27.679687890761766 27.149502325814034 19.381783624268493 150-151 25.465683210401302 27.86598324790599 26.978372296537067 19.689961245155644 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 3.5 24 3.5 25 5.0 26 6.0 27 7.5 28 11.0 29 14.0 30 20.0 31 28.5 32 32.0 33 38.5 34 54.0 35 64.5 36 83.5 37 114.0 38 149.0 39 179.5 40 195.5 41 231.5 42 259.0 43 260.5 44 275.0 45 275.0 46 267.5 47 243.0 48 204.5 49 179.5 50 157.5 51 133.0 52 112.5 53 93.5 54 75.0 55 59.5 56 46.5 57 34.0 58 21.5 59 19.5 60 13.0 61 6.0 62 4.5 63 6.0 64 4.5 65 2.0 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.1 4 0.075 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.055 25-29 0.11499999999999999 30-34 0.06 35-39 0.045 40-44 0.06999999999999999 45-49 0.05 50-54 0.06999999999999999 55-59 0.034999999999999996 60-64 0.03 65-69 0.045 70-74 0.034999999999999996 75-79 0.034999999999999996 80-84 0.05 85-89 0.015 90-94 0.03 95-99 0.005 100-104 0.025 105-109 0.04 110-114 0.015 115-119 0.045 120-124 0.045 125-129 0.04 130-134 0.025 135-139 0.03 140-144 0.025 145-149 0.034999999999999996 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24299772899319 98.32499999999999 2 0.6560686348725713 1.3 3 0.05046681806712087 0.15 4 0.025233409033560434 0.1 5 0.025233409033560434 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.6499999999999999 0.0 0.0 0.0 0.0 92-93 0.875 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.2625000000000002 0.0 0.0 0.0 0.0 98-99 1.45 0.0 0.0 0.0 0.0 100-101 1.6 0.0 0.0 0.0 0.0 102-103 1.7374999999999998 0.0 0.0 0.0 0.0 104-105 2.0875 0.0 0.0 0.0 0.0 106-107 2.3125 0.0 0.0 0.0 0.0 108-109 2.5875 0.0 0.0 0.0 0.0 110-111 2.9000000000000004 0.0 0.0 0.0 0.0 112-113 3.3375000000000004 0.0 0.0 0.0 0.0 114-115 3.7375 0.0 0.0 0.0 0.0 116-117 4.225 0.0 0.0 0.0 0.0 118-119 4.75 0.0 0.0 0.0 0.0 120-121 5.2625 0.0 0.0 0.0 0.0 122-123 5.75 0.0 0.0 0.0 0.0 124-125 6.137499999999999 0.0 0.0 0.0 0.0 126-127 6.7125 0.0 0.0 0.0 0.0 128-129 7.3375 0.0 0.0 0.0 0.0 130-131 7.925 0.0 0.0 0.0 0.0 132-133 8.5625 0.0 0.0 0.0 0.0 134-135 9.0875 0.0 0.0 0.0 0.0 136-137 9.65 0.0 0.0 0.0 0.0 138-139 10.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAGAA 10 0.006830828 145.0 7 TTCCAGA 10 0.006830828 145.0 6 >>END_MODULE Read 675854 spots for SRR7170871.sra Written 675854 spots for SRR7170871.sra Read 675854 spots for SRR7170871.sra Written 675854 spots for SRR7170871.sra Read 675854 spots for SRR7170871.sra Written 675854 spots for SRR7170871.sra Read 675854 spots for SRR7170871.sra Written 675854 spots for SRR7170871.sra Read 675854 spots for SRR7170871.sra Written 675854 spots for SRR7170871.sra Read 675854 spots for SRR7170871.sra Written 675854 spots for SRR7170871.sra Read 675854 spots for SRR7170871.sra Written 675854 spots for SRR7170871.sra Read 675854 spots for SRR7170871.sra Written 675854 spots for SRR7170871.sra Read 675854 spots for SRR7170871.sra Written 675854 spots for SRR7170871.sra Read 675854 spots for SRR7170871.sra Written 675854 spots for SRR7170871.sra Read 675854 spots for SRR7170871.sra Written 675854 spots for SRR7170871.sra Read 675854 spots for SRR7170871.sra Written 675854 spots for SRR7170871.sra Read 675854 spots for SRR7170871.sra Written 675854 spots for SRR7170871.sra Read 675854 spots for SRR7170871.sra Written 675854 spots for SRR7170871.sra Read 675854 spots for SRR7170871.sra Written 675854 spots for SRR7170871.sra Read 675854 spots for SRR7170871.sra Written 675854 spots for SRR7170871.sra Read 675854 spots for SRR7170871.sra Written 675854 spots for SRR7170871.sra Read 675854 spots for SRR7170871.sra Written 675854 spots for SRR7170871.sra Read 675873 spots for SRR7170871.sra Written 675873 spots for SRR7170871.sra Read 675854 spots for SRR7170871.sra Written 675854 spots for SRR7170871.sra SRR ids: ['SRR7170871.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ukp5xu7y SRR7170871.sra spots: 13517099 blocks: [[1, 675854], [675855, 1351708], [1351709, 2027562], [2027563, 2703416], [2703417, 3379270], [3379271, 4055124], [4055125, 4730978], [4730979, 5406832], [5406833, 6082686], [6082687, 6758540], [6758541, 7434394], [7434395, 8110248], [8110249, 8786102], [8786103, 9461956], [9461957, 10137810], [10137811, 10813664], [10813665, 11489518], [11489519, 12165372], [12165373, 12841226], [12841227, 13517099]] SRR7170871 file size 4558800 SRR7170871 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170871 SRR7170871_1.fastq SRR7170871_2.fastq Input file: SRR7170871_1.fastq Paired file: SRR7170871_2.fastq trimmed: SRR7170871-trimmed-pair1.fastq, SRR7170871-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:59:40 2025 >> started Thu Feb 13 20:59:55 2025 >> done (15.013s) 13517099 read pairs processed; of these: 17207 ( 0.13%) short read pairs filtered out after trimming by size control 16326 ( 0.12%) empty read pairs filtered out after trimming by size control 13483566 (99.75%) read pairs available; of these: 9269977 (68.75%) trimmed read pairs available after processing 4213589 (31.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 7 0.00% 20 8 0.00% 21 9 0.00% 22 6 0.00% 23 12 0.00% 24 9 0.00% 25 9 0.00% 26 8 0.00% 27 13 0.00% 28 7 0.00% 29 11 0.00% 30 10 0.00% 31 15 0.00% 32 15 0.00% 33 15 0.00% 34 17 0.00% 35 20 0.00% 36 31 0.00% 37 19 0.00% 38 32 0.00% 39 40 0.00% 40 29 0.00% 41 56 0.00% 42 54 0.00% 43 50 0.00% 44 65 0.00% 45 51 0.00% 46 73 0.00% 47 75 0.00% 48 83 0.00% 49 129 0.00% 50 139 0.00% 51 159 0.00% 52 200 0.00% 53 202 0.00% 54 217 0.00% 55 227 0.00% 56 270 0.00% 57 290 0.00% 58 344 0.00% 59 394 0.00% 60 453 0.00% 61 503 0.00% 62 613 0.00% 63 692 0.01% 64 787 0.01% 65 814 0.01% 66 951 0.01% 67 1006 0.01% 68 1127 0.01% 69 1327 0.01% 70 1579 0.01% 71 1814 0.01% 72 1967 0.01% 73 2221 0.02% 74 2505 0.02% 75 2918 0.02% 76 3608 0.03% 77 3926 0.03% 78 3803 0.03% 79 3941 0.03% 80 4340 0.03% 81 5026 0.04% 82 5654 0.04% 83 6831 0.05% 84 8700 0.06% 85 7959 0.06% 86 8172 0.06% 87 8660 0.06% 88 9188 0.07% 89 10114 0.08% 90 10727 0.08% 91 11782 0.09% 92 12671 0.09% 93 14116 0.10% 94 15382 0.11% 95 16488 0.12% 96 16990 0.13% 97 17796 0.13% 98 18395 0.14% 99 19287 0.14% 100 20796 0.15% 101 22011 0.16% 102 23731 0.18% 103 25110 0.19% 104 26485 0.20% 105 27665 0.21% 106 28805 0.21% 107 29972 0.22% 108 30876 0.23% 109 31475 0.23% 110 32714 0.24% 111 34391 0.26% 112 36097 0.27% 113 37432 0.28% 114 39489 0.29% 115 41143 0.31% 116 42431 0.31% 117 43498 0.32% 118 44647 0.33% 119 45636 0.34% 120 47386 0.35% 121 48824 0.36% 122 50708 0.38% 123 53312 0.40% 124 56054 0.42% 125 57772 0.43% 126 60618 0.45% 127 62554 0.46% 128 64756 0.48% 129 66733 0.49% 130 69199 0.51% 131 72260 0.54% 132 75710 0.56% 133 79652 0.59% 134 84771 0.63% 135 90257 0.67% 136 96520 0.72% 137 102622 0.76% 138 109884 0.81% 139 118004 0.88% 140 127688 0.95% 141 140115 1.04% 142 155868 1.16% 143 176929 1.31% 144 206901 1.53% 145 243265 1.80% 146 303831 2.25% 147 402101 2.98% 148 599184 4.44% 149 1099718 8.16% 150 3414115 25.32% 151 4213589 31.25% 13483566 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=18 prefix-density=0.60 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=32.08 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.0 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=20 prefix-density=0.75 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=28.32 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.7 sequence=ATTTTTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTACCATTGCCTTCTCTCCCTTATCCATGGCAGCTCGAGAATT SRR7170871 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:00:52 Started mapping on | Feb 13 21:00:53 Finished on | Feb 13 21:02:10 Mapping speed, Million of reads per hour | 630.40 Number of input reads | 13483566 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 11387452 Uniquely mapped reads % | 84.45% Average mapped length | 285.35 Number of splices: Total | 11141720 Number of splices: Annotated (sjdb) | 10859597 Number of splices: GT/AG | 10925598 Number of splices: GC/AG | 166851 Number of splices: AT/AC | 7369 Number of splices: Non-canonical | 41902 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306926 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 39037 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.92% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1801471 1801471 1801471 N_multimapping 306926 306926 306926 N_noFeature 493149 11190405 571663 N_ambiguous 260028 1983 139933 UnstrandedReadsAssigned:10634275 PositiveStrandReadsAssigned:195064 NegativeStrandReadsAssigned:10675856 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=142 echo kmer=137 SRR7170871 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170871-trimmed-pair1.fastq SRR7170871-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,483,566 reads, 11,950,897 reads pseudoaligned [quant] estimated average fragment length: 223.752 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 968 rounds 52401 SRR7170871.ke.tsv 34699 SRR7170871.se.tsv 87100 total ==> SRR7170871.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.25 618.517 26.6296 Potri.005G024800.1.v4.1 1035 812.248 215 20.4591 Potri.004G059700.1.v4.1 961 738.268 6 0.628165 Potri.007G009000.2.v4.1 1416 1193.25 0 0 Potri.003G141000.2.v4.1 2943 2720.25 763.449 21.6924 Potri.016G087400.1.v4.1 270 95.6556 904.773 731.081 Potri.015G069301.1.v4.1 564 347.069 0 0 Potri.010G195200.1.v4.1 1773 1550.25 98 4.88609 Potri.012G127500.1.v4.1 977 754.258 69 7.07075 ==> SRR7170871.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 403 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 166 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7170871 completed mapping pipeline successfully