Starting /dee2/code/volunteer_pipeline.sh SRR7170872 current disk space = 3088218120192 free memory = 1506193988 SRR7170872 SRAfilesize 2496ddfb1c38a81fbb9750668bd814c2 SRR7170872.sra SRR7170872.sra file validated SRR7170872 is paired end SRR7170872 is conventional basespace SRR7170872 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170872_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.476 34.0 33.0 34.0 33.0 34.0 2 33.33175 34.0 34.0 34.0 33.0 34.0 3 33.307 34.0 34.0 34.0 33.0 34.0 4 33.4515 34.0 34.0 34.0 33.0 34.0 5 33.48125 34.0 34.0 34.0 33.0 34.0 6 37.11725 38.0 37.0 38.0 36.0 38.0 7 37.42525 38.0 38.0 38.0 37.0 38.0 8 37.41775 38.0 38.0 38.0 37.0 38.0 9 37.56925 38.0 38.0 38.0 38.0 38.0 10-14 37.53475 38.0 38.0 38.0 37.8 38.0 15-19 37.521550000000005 38.0 38.0 38.0 37.8 38.0 20-24 37.4533 38.0 38.0 38.0 37.4 38.0 25-29 37.42215 38.0 38.0 38.0 37.0 38.0 30-34 37.35510000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.2675 38.0 38.0 38.0 37.0 38.0 40-44 37.19135 38.0 38.0 38.0 36.8 38.0 45-49 37.14425 38.0 38.0 38.0 36.8 38.0 50-54 37.0445 38.0 38.0 38.0 36.2 38.0 55-59 36.9601 38.0 38.0 38.0 36.2 38.0 60-64 36.8717 38.0 38.0 38.0 36.0 38.0 65-69 36.88415 38.0 38.0 38.0 36.0 38.0 70-74 36.81445 38.0 38.0 38.0 35.6 38.0 75-79 36.672000000000004 38.0 38.0 38.0 35.2 38.0 80-84 36.51685 38.0 38.0 38.0 34.2 38.0 85-89 36.376850000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.28175 38.0 38.0 38.0 33.8 38.0 95-99 36.1693 38.0 37.8 38.0 33.8 38.0 100-104 36.06465 38.0 37.2 38.0 33.2 38.0 105-109 35.96275 38.0 37.2 38.0 33.0 38.0 110-114 35.77145 38.0 37.0 38.0 31.6 38.0 115-119 35.48094999999999 38.0 36.4 38.0 31.0 38.0 120-124 35.302800000000005 38.0 36.0 38.0 29.6 38.0 125-129 34.8822 38.0 35.6 38.0 27.6 38.0 130-134 34.5104 38.0 34.6 38.0 26.4 38.0 135-139 34.1416 38.0 34.6 38.0 24.4 38.0 140-144 33.5658 38.0 33.0 38.0 21.4 38.0 145-149 32.777 38.0 33.0 38.0 15.4 38.0 150-151 28.164375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 2.0 8 3.0 9 2.0 10 4.0 11 1.0 12 2.0 13 1.0 14 2.0 15 2.0 16 0.0 17 0.0 18 4.0 19 9.0 20 3.0 21 6.0 22 10.0 23 8.0 24 11.0 25 15.0 26 26.0 27 17.0 28 31.0 29 30.0 30 46.0 31 63.0 32 84.0 33 100.0 34 174.0 35 326.0 36 743.0 37 2274.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.6903592659602 18.014990953734817 13.000775394158698 27.29387438614629 2 20.200000000000003 19.2 35.199999999999996 25.4 3 17.675 27.6 31.674999999999997 23.05 4 19.85 32.300000000000004 26.5 21.349999999999998 5 20.25 37.025000000000006 25.424999999999997 17.299999999999997 6 18.05 34.975 26.674999999999997 20.3 7 14.299999999999999 23.549999999999997 42.3 19.85 8 17.525 22.25 29.975 30.25 9 16.45 23.974999999999998 31.85 27.725 10-14 19.435 29.45 26.674999999999997 24.44 15-19 19.220000000000002 28.03 28.865000000000002 23.885 20-24 19.564999999999998 29.005 28.15 23.28 25-29 19.865 28.58 28.325 23.23 30-34 19.400000000000002 28.53 28.249999999999996 23.82 35-39 19.410970548527427 28.871443572178606 27.891394569728483 23.826191309565477 40-44 19.97 28.349999999999998 28.095 23.585 45-49 19.400000000000002 28.74 28.09 23.77 50-54 19.64 27.794999999999998 28.765 23.799999999999997 55-59 19.245 28.615000000000002 28.389999999999997 23.75 60-64 19.54 28.865000000000002 27.92 23.674999999999997 65-69 19.545 28.87 28.050000000000004 23.535 70-74 19.375 28.595 28.395 23.635 75-79 19.535 28.315 28.249999999999996 23.9 80-84 19.29 28.515 28.044999999999998 24.15 85-89 19.794999999999998 28.560000000000002 27.925 23.72 90-94 20.064999999999998 28.225 28.29 23.419999999999998 95-99 19.615 28.084999999999997 27.965 24.335 100-104 19.79 27.884999999999998 28.42 23.905 105-109 19.82 27.74 28.095 24.345 110-114 20.05 28.084999999999997 28.449999999999996 23.415 115-119 20.28 28.560000000000002 27.91 23.25 120-124 20.57 28.24 27.41 23.78 125-129 20.225 28.155 28.08 23.54 130-134 20.04 27.985 28.115000000000002 23.86 135-139 20.244999999999997 28.025 27.58 24.15 140-144 20.07 27.935 28.084999999999997 23.91 145-149 20.105 28.075 27.93 23.89 150-151 19.8 28.3625 28.275 23.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 3.0 2 2.0 3 1.0 4 1.5 5 2.0 6 0.5 7 0.0 8 1.5 9 1.5 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 1.5 16 2.0 17 1.5 18 0.5 19 0.0 20 1.0 21 2.0 22 1.5 23 1.0 24 3.0 25 5.0 26 7.0 27 8.5 28 11.5 29 17.5 30 22.0 31 25.5 32 40.5 33 55.0 34 55.5 35 74.0 36 108.0 37 124.0 38 133.5 39 167.5 40 199.5 41 218.0 42 245.0 43 266.0 44 287.5 45 273.0 46 235.5 47 236.0 48 229.5 49 190.5 50 161.0 51 144.5 52 111.0 53 72.0 54 59.5 55 54.5 56 40.0 57 28.0 58 18.5 59 15.5 60 11.5 61 5.5 62 4.0 63 3.5 64 1.0 65 0.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2750000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31749241658241 98.225 2 0.5055611729019212 1.0 3 0.10111223458038424 0.3 4 0.02527805864509606 0.1 5 0.0 0.0 6 0.02527805864509606 0.15 7 0.0 0.0 8 0.0 0.0 9 0.02527805864509606 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 9 0.22499999999999998 No Hit GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.7749999999999999 0.0 0.0 0.0 0.0 116-117 0.9 0.0 0.0 0.0 0.0 118-119 0.9874999999999999 0.0 0.0 0.0 0.0 120-121 1.1 0.0 0.0 0.0 0.0 122-123 1.2374999999999998 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.4125 0.0 0.0 0.0 0.0 128-129 1.4625 0.0 0.0 0.0 0.0 130-131 1.6 0.0 0.0 0.0 0.0 132-133 1.6749999999999998 0.0 0.0 0.0 0.0 134-135 1.775 0.0 0.0 0.0 0.0 136-137 1.9 0.0 0.0 0.0 0.0 138-139 2.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACGTTCT 10 0.006836113 144.9625 145 GTATTTA 10 0.006836113 144.9625 5 TGTATTT 10 0.006836113 144.9625 4 TATAGAA 10 0.006836113 144.9625 7 >>END_MODULE SRR7170872 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170872_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77225 33.0 33.0 34.0 32.0 34.0 2 32.8685 34.0 33.0 34.0 32.0 34.0 3 32.8235 34.0 33.0 34.0 32.0 34.0 4 32.74775 34.0 33.0 34.0 32.0 34.0 5 32.71825 34.0 33.0 34.0 32.0 34.0 6 36.91775 38.0 38.0 38.0 37.0 38.0 7 36.84425 38.0 38.0 38.0 37.0 38.0 8 36.889 38.0 38.0 38.0 36.0 38.0 9 36.83725 38.0 38.0 38.0 37.0 38.0 10-14 36.790049999999994 38.0 38.0 38.0 36.0 38.0 15-19 36.803799999999995 38.0 38.0 38.0 36.2 38.0 20-24 36.6874 38.0 38.0 38.0 36.0 38.0 25-29 36.71775 38.0 38.0 38.0 36.0 38.0 30-34 36.67515 38.0 38.0 38.0 36.0 38.0 35-39 36.601549999999996 38.0 38.0 38.0 35.8 38.0 40-44 36.5674 38.0 38.0 38.0 36.0 38.0 45-49 36.57985 38.0 38.0 38.0 36.0 38.0 50-54 36.50515 38.0 38.0 38.0 35.4 38.0 55-59 36.53655 38.0 38.0 38.0 35.6 38.0 60-64 36.4745 38.0 38.0 38.0 35.0 38.0 65-69 36.379200000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.32415 38.0 38.0 38.0 34.2 38.0 75-79 36.3046 38.0 38.0 38.0 34.0 38.0 80-84 36.124 38.0 38.0 38.0 34.0 38.0 85-89 36.020950000000006 38.0 38.0 38.0 34.0 38.0 90-94 35.944 38.0 38.0 38.0 33.8 38.0 95-99 35.80325 38.0 38.0 38.0 33.0 38.0 100-104 35.6421 38.0 37.8 38.0 32.2 38.0 105-109 35.4318 38.0 37.0 38.0 31.0 38.0 110-114 35.3378 38.0 37.0 38.0 30.2 38.0 115-119 35.09295 38.0 37.0 38.0 28.4 38.0 120-124 34.839800000000004 38.0 36.4 38.0 27.6 38.0 125-129 34.4861 38.0 36.0 38.0 25.2 38.0 130-134 34.0656 38.0 35.0 38.0 23.0 38.0 135-139 33.3508 38.0 33.6 38.0 17.4 38.0 140-144 32.818599999999996 38.0 33.0 38.0 13.4 38.0 145-149 31.98105 38.0 33.0 38.0 8.6 38.0 150-151 27.163125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 5.0 4 8.0 5 5.0 6 1.0 7 4.0 8 1.0 9 4.0 10 1.0 11 4.0 12 3.0 13 4.0 14 3.0 15 6.0 16 7.0 17 6.0 18 9.0 19 16.0 20 7.0 21 9.0 22 14.0 23 12.0 24 16.0 25 23.0 26 27.0 27 32.0 28 34.0 29 46.0 30 44.0 31 55.0 32 65.0 33 111.0 34 128.0 35 260.0 36 611.0 37 2399.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.125 21.825 14.674999999999999 20.375 2 25.25 24.45 31.225 19.075 3 22.900000000000002 26.875 31.424999999999997 18.8 4 24.15 34.300000000000004 22.025 19.525000000000002 5 23.3 37.724999999999994 21.3 17.675 6 20.775 36.3 23.5 19.425 7 19.525000000000002 20.7 37.8 21.975 8 19.45 26.8 28.249999999999996 25.5 9 20.150000000000002 26.950000000000003 28.825 24.075 10-14 22.98 27.92 26.505000000000003 22.595000000000002 15-19 22.49 28.199999999999996 28.405 20.905 20-24 22.575 28.225 27.93 21.27 25-29 22.67 28.754999999999995 28.305000000000003 20.27 30-34 22.759999999999998 28.315 27.725 21.2 35-39 22.945 28.07 28.21 20.775 40-44 23.315 27.994999999999997 28.275 20.415 45-49 22.36 28.43 27.950000000000003 21.26 50-54 23.14 27.765 28.4 20.695 55-59 23.7 27.43 27.97 20.9 60-64 23.330000000000002 27.245 28.575 20.849999999999998 65-69 22.905 27.27 28.7 21.125 70-74 23.064999999999998 28.244999999999997 27.245 21.445 75-79 23.294999999999998 27.355 28.194999999999997 21.154999999999998 80-84 23.21 27.655 27.725 21.41 85-89 23.145 27.325 28.13 21.4 90-94 23.9 27.52 27.935 20.645 95-99 23.369999999999997 27.87 28.389999999999997 20.369999999999997 100-104 23.24 28.000000000000004 27.935 20.825 105-109 22.96 28.025 28.4 20.615 110-114 23.41 27.375 28.785 20.43 115-119 24.13 28.58 27.095000000000002 20.195 120-124 23.02 28.444999999999997 27.685 20.849999999999998 125-129 23.98 28.715000000000003 27.02 20.285 130-134 23.9 27.955000000000002 27.32 20.825 135-139 23.985 28.04 27.51 20.465 140-144 24.104999999999997 28.58 27.139999999999997 20.175 145-149 24.34 28.24 27.29 20.13 150-151 24.5125 28.012500000000003 27.1125 20.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.0 18 0.5 19 2.0 20 1.5 21 0.0 22 0.5 23 2.0 24 3.5 25 2.5 26 2.0 27 3.5 28 9.5 29 15.5 30 15.5 31 20.0 32 27.0 33 34.5 34 47.5 35 60.5 36 91.0 37 120.5 38 128.5 39 152.0 40 179.5 41 213.5 42 256.0 43 262.5 44 262.0 45 275.0 46 287.5 47 274.5 48 243.5 49 206.0 50 167.0 51 136.5 52 106.0 53 92.0 54 75.0 55 59.5 56 45.5 57 31.5 58 25.0 59 14.5 60 10.0 61 10.5 62 7.5 63 3.5 64 3.0 65 3.0 66 2.0 67 1.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1139240506329 97.875 2 0.6582278481012658 1.3 3 0.12658227848101267 0.375 4 0.05063291139240507 0.2 5 0.05063291139240507 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.8625 0.0 0.0 0.0 0.0 118-119 0.925 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.3 0.0 0.0 0.0 0.0 126-127 1.3625 0.0 0.0 0.0 0.0 128-129 1.4125 0.0 0.0 0.0 0.0 130-131 1.6 0.0 0.0 0.0 0.0 132-133 1.6749999999999998 0.0 0.0 0.0 0.0 134-135 1.775 0.0 0.0 0.0 0.0 136-137 1.9125 0.0 0.0 0.0 0.0 138-139 2.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 534234 spots for SRR7170872.sra Written 534234 spots for SRR7170872.sra Read 534234 spots for SRR7170872.sra Written 534234 spots for SRR7170872.sra Read 534234 spots for SRR7170872.sra Written 534234 spots for SRR7170872.sra Read 534234 spots for SRR7170872.sra Written 534234 spots for SRR7170872.sra Read 534234 spots for SRR7170872.sra Written 534234 spots for SRR7170872.sra Read 534234 spots for SRR7170872.sra Written 534234 spots for SRR7170872.sra Read 534234 spots for SRR7170872.sra Written 534234 spots for SRR7170872.sra Read 534234 spots for SRR7170872.sra Written 534234 spots for SRR7170872.sra Read 534234 spots for SRR7170872.sra Written 534234 spots for SRR7170872.sra Read 534234 spots for SRR7170872.sra Written 534234 spots for SRR7170872.sra Read 534234 spots for SRR7170872.sra Written 534234 spots for SRR7170872.sra Read 534234 spots for SRR7170872.sra Written 534234 spots for SRR7170872.sra Read 534234 spots for SRR7170872.sra Written 534234 spots for SRR7170872.sra Read 534234 spots for SRR7170872.sra Written 534234 spots for SRR7170872.sra Read 534234 spots for SRR7170872.sra Written 534234 spots for SRR7170872.sra Read 534234 spots for SRR7170872.sra Written 534234 spots for SRR7170872.sra Read 534234 spots for SRR7170872.sra Written 534234 spots for SRR7170872.sra Read 534234 spots for SRR7170872.sra Written 534234 spots for SRR7170872.sra Read 534247 spots for SRR7170872.sra Written 534247 spots for SRR7170872.sra Read 534234 spots for SRR7170872.sra Written 534234 spots for SRR7170872.sra SRR ids: ['SRR7170872.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bao8kf_b SRR7170872.sra spots: 10684693 blocks: [[1, 534234], [534235, 1068468], [1068469, 1602702], [1602703, 2136936], [2136937, 2671170], [2671171, 3205404], [3205405, 3739638], [3739639, 4273872], [4273873, 4808106], [4808107, 5342340], [5342341, 5876574], [5876575, 6410808], [6410809, 6945042], [6945043, 7479276], [7479277, 8013510], [8013511, 8547744], [8547745, 9081978], [9081979, 9616212], [9616213, 10150446], [10150447, 10684693]] SRR7170872 file size 3598991 SRR7170872 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170872 SRR7170872_1.fastq SRR7170872_2.fastq Input file: SRR7170872_1.fastq Paired file: SRR7170872_2.fastq trimmed: SRR7170872-trimmed-pair1.fastq, SRR7170872-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:05:34 2025 >> started Thu Feb 13 21:05:52 2025 >> done (17.810s) 10684693 read pairs processed; of these: 34838 ( 0.33%) short read pairs filtered out after trimming by size control 45240 ( 0.42%) empty read pairs filtered out after trimming by size control 10604615 (99.25%) read pairs available; of these: 6346913 (59.85%) trimmed read pairs available after processing 4257702 (40.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 16 0.00% 20 20 0.00% 21 33 0.00% 22 34 0.00% 23 29 0.00% 24 45 0.00% 25 44 0.00% 26 47 0.00% 27 41 0.00% 28 47 0.00% 29 57 0.00% 30 52 0.00% 31 49 0.00% 32 67 0.00% 33 58 0.00% 34 54 0.00% 35 59 0.00% 36 62 0.00% 37 58 0.00% 38 63 0.00% 39 65 0.00% 40 73 0.00% 41 60 0.00% 42 61 0.00% 43 73 0.00% 44 81 0.00% 45 75 0.00% 46 75 0.00% 47 80 0.00% 48 99 0.00% 49 103 0.00% 50 116 0.00% 51 120 0.00% 52 151 0.00% 53 151 0.00% 54 153 0.00% 55 168 0.00% 56 195 0.00% 57 231 0.00% 58 244 0.00% 59 245 0.00% 60 299 0.00% 61 336 0.00% 62 329 0.00% 63 385 0.00% 64 396 0.00% 65 457 0.00% 66 481 0.00% 67 533 0.01% 68 518 0.00% 69 643 0.01% 70 690 0.01% 71 781 0.01% 72 852 0.01% 73 969 0.01% 74 1071 0.01% 75 1224 0.01% 76 1944 0.02% 77 2544 0.02% 78 1934 0.02% 79 1822 0.02% 80 1866 0.02% 81 2032 0.02% 82 2228 0.02% 83 2673 0.03% 84 4025 0.04% 85 4806 0.05% 86 5239 0.05% 87 5913 0.06% 88 6146 0.06% 89 6190 0.06% 90 6412 0.06% 91 6537 0.06% 92 6766 0.06% 93 6789 0.06% 94 6721 0.06% 95 6504 0.06% 96 6706 0.06% 97 6687 0.06% 98 6815 0.06% 99 6813 0.06% 100 6973 0.07% 101 7711 0.07% 102 8026 0.08% 103 8338 0.08% 104 8772 0.08% 105 9039 0.09% 106 9094 0.09% 107 9336 0.09% 108 9470 0.09% 109 9800 0.09% 110 10303 0.10% 111 11012 0.10% 112 11439 0.11% 113 12398 0.12% 114 13071 0.12% 115 13487 0.13% 116 14087 0.13% 117 14566 0.14% 118 15171 0.14% 119 15582 0.15% 120 16354 0.15% 121 17594 0.17% 122 18894 0.18% 123 20691 0.20% 124 21685 0.20% 125 23105 0.22% 126 24566 0.23% 127 25812 0.24% 128 27273 0.26% 129 29061 0.27% 130 30807 0.29% 131 32771 0.31% 132 35882 0.34% 133 39142 0.37% 134 42591 0.40% 135 46748 0.44% 136 50642 0.48% 137 55378 0.52% 138 59982 0.57% 139 65560 0.62% 140 73917 0.70% 141 83591 0.79% 142 95694 0.90% 143 112942 1.07% 144 134072 1.26% 145 164193 1.55% 146 210293 1.98% 147 287459 2.71% 148 435839 4.11% 149 828427 7.81% 150 2888620 27.24% 151 4257702 40.15% 10604615 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=20 prefix-density=0.66 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=299.89 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.99 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=23 prefix-density=0.99 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=44.44 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTTGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR7170872 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:06:37 Started mapping on | Feb 13 21:06:37 Finished on | Feb 13 21:07:55 Mapping speed, Million of reads per hour | 489.44 Number of input reads | 10604615 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 9890979 Uniquely mapped reads % | 93.27% Average mapped length | 293.10 Number of splices: Total | 10119980 Number of splices: Annotated (sjdb) | 9880187 Number of splices: GT/AG | 9925138 Number of splices: GC/AG | 155347 Number of splices: AT/AC | 6029 Number of splices: Non-canonical | 33466 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 268447 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 12390 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.02% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 489417 489417 489417 N_multimapping 268447 268447 268447 N_noFeature 327469 9707978 389251 N_ambiguous 207752 775 86094 UnstrandedReadsAssigned:9355758 PositiveStrandReadsAssigned:182226 NegativeStrandReadsAssigned:9415634 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170872 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170872-trimmed-pair1.fastq SRR7170872-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,604,615 reads, 9,342,594 reads pseudoaligned [quant] estimated average fragment length: 295.484 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,058 rounds 52401 SRR7170872.ke.tsv 34699 SRR7170872.se.tsv 87100 total ==> SRR7170872.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1723.52 383 19.4821 Potri.005G024800.1.v4.1 1035 740.516 263 31.1368 Potri.004G059700.1.v4.1 961 666.695 9 1.1835 Potri.007G009000.2.v4.1 1416 1121.52 0 0 Potri.003G141000.2.v4.1 2943 2648.52 702.503 23.254 Potri.016G087400.1.v4.1 270 68.0553 862 1110.45 Potri.015G069301.1.v4.1 564 282.909 0 0 Potri.010G195200.1.v4.1 1773 1478.52 59 3.49847 Potri.012G127500.1.v4.1 977 682.597 44 5.65121 ==> SRR7170872.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 269 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 200 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR7170872 completed mapping pipeline successfully