Starting /dee2/code/volunteer_pipeline.sh SRR7170873 current disk space = 3087722012672 free memory = 1465007068 SRR7170873 SRAfilesize cfcf20064cfbcf4ec91d1b4b69c89b4e SRR7170873.sra SRR7170873.sra file validated SRR7170873 is paired end SRR7170873 is conventional basespace SRR7170873 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170873_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.929 34.0 33.0 34.0 33.0 34.0 2 33.37175 34.0 33.0 34.0 33.0 34.0 3 33.33475 34.0 33.0 34.0 33.0 34.0 4 33.35075 34.0 33.0 34.0 33.0 34.0 5 33.324 34.0 33.0 34.0 33.0 34.0 6 36.97175 38.0 37.0 38.0 36.0 38.0 7 37.2625 38.0 38.0 38.0 37.0 38.0 8 37.44725 38.0 38.0 38.0 37.0 38.0 9 37.48325 38.0 38.0 38.0 37.0 38.0 10-14 37.5548 38.0 38.0 38.0 37.8 38.0 15-19 37.435950000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.41245 38.0 38.0 38.0 37.0 38.0 25-29 37.3273 38.0 38.0 38.0 37.0 38.0 30-34 37.30355000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.22375 38.0 38.0 38.0 37.0 38.0 40-44 37.1545 38.0 38.0 38.0 36.6 38.0 45-49 37.0675 38.0 38.0 38.0 36.2 38.0 50-54 36.967499999999994 38.0 38.0 38.0 36.0 38.0 55-59 36.9405 38.0 38.0 38.0 36.0 38.0 60-64 36.866499999999995 38.0 38.0 38.0 35.6 38.0 65-69 36.82620000000001 38.0 38.0 38.0 35.8 38.0 70-74 36.719049999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.44365 38.0 38.0 38.0 34.0 38.0 80-84 36.41905 38.0 38.0 38.0 34.0 38.0 85-89 36.36505 38.0 38.0 38.0 34.2 38.0 90-94 36.28529999999999 38.0 38.0 38.0 34.0 38.0 95-99 36.10035 38.0 38.0 38.0 33.6 38.0 100-104 35.91775 38.0 37.2 38.0 32.8 38.0 105-109 35.725649999999995 38.0 37.0 38.0 31.4 38.0 110-114 35.54025 38.0 36.8 38.0 30.6 38.0 115-119 35.405150000000006 38.0 36.8 38.0 30.6 38.0 120-124 34.98805 38.0 36.0 38.0 27.8 38.0 125-129 35.01520000000001 38.0 35.8 38.0 28.2 38.0 130-134 34.286 38.0 34.8 38.0 24.0 38.0 135-139 34.174699999999994 38.0 34.2 38.0 24.0 38.0 140-144 33.7389 38.0 33.6 38.0 22.8 38.0 145-149 32.745900000000006 38.0 33.0 38.0 13.8 38.0 150-151 28.085124999999998 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 2.0 8 2.0 9 1.0 10 1.0 11 1.0 12 1.0 13 4.0 14 0.0 15 3.0 16 4.0 17 5.0 18 7.0 19 13.0 20 5.0 21 4.0 22 10.0 23 9.0 24 13.0 25 25.0 26 16.0 27 31.0 28 30.0 29 37.0 30 48.0 31 60.0 32 73.0 33 112.0 34 160.0 35 307.0 36 667.0 37 2348.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.974866717440975 17.18710332571719 11.043412033511043 30.794617923330797 2 20.5 20.05 36.475 22.975 3 16.925 28.675 29.275000000000002 25.124999999999996 4 19.650000000000002 34.5 24.975 20.875 5 20.825 37.65 24.525 17.0 6 18.625 37.425000000000004 25.25 18.7 7 14.924999999999999 23.925 42.925000000000004 18.224999999999998 8 17.525 23.5 30.8 28.175 9 17.45 25.575 32.300000000000004 24.675 10-14 19.400000000000002 30.930000000000003 26.365 23.305 15-19 19.38 29.685 27.715 23.22 20-24 18.89 30.095 27.66 23.355 25-29 19.475 29.335 27.88 23.31 30-34 19.165 30.240000000000002 27.689999999999998 22.905 35-39 19.33 30.0 27.305 23.365 40-44 20.080000000000002 30.049999999999997 26.784999999999997 23.085 45-49 19.865 29.845 26.77 23.52 50-54 19.814999999999998 29.635 27.525 23.025000000000002 55-59 20.044999999999998 29.315 27.365000000000002 23.275000000000002 60-64 20.135 29.215000000000003 27.200000000000003 23.45 65-69 19.835 29.709999999999997 27.32 23.135 70-74 19.455 30.020000000000003 27.465 23.06 75-79 19.445 28.975 27.865000000000002 23.715 80-84 19.515 29.395 26.765 24.325 85-89 19.655 28.860000000000003 27.88 23.605 90-94 19.785 28.775000000000002 27.779999999999998 23.66 95-99 20.09 28.854999999999997 27.41 23.645 100-104 20.0 29.165000000000003 27.05 23.785 105-109 20.195 29.425 27.084999999999997 23.294999999999998 110-114 20.77 28.720000000000002 27.029999999999998 23.48 115-119 20.175 28.965000000000003 27.07 23.79 120-124 20.535 29.485 26.195 23.785 125-129 20.595 28.73 26.715 23.96 130-134 21.175 28.775000000000002 26.229999999999997 23.82 135-139 21.27 28.660000000000004 25.715 24.355 140-144 20.665 28.965000000000003 26.155 24.215 145-149 20.925 28.975 26.150000000000002 23.95 150-151 20.865108138517314 28.9536192024003 25.54069258657332 24.640580072509064 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 1.0 13 1.5 14 0.5 15 0.5 16 1.5 17 1.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 2.0 24 4.0 25 6.0 26 10.0 27 14.0 28 21.5 29 28.0 30 31.5 31 36.5 32 40.5 33 57.5 34 78.5 35 94.5 36 112.5 37 135.0 38 163.0 39 189.0 40 208.0 41 225.5 42 230.5 43 227.0 44 247.5 45 252.0 46 228.0 47 223.0 48 216.5 49 181.5 50 150.5 51 117.0 52 88.0 53 85.5 54 71.0 55 50.0 56 47.0 57 39.5 58 25.0 59 18.5 60 10.0 61 5.0 62 5.0 63 3.0 64 1.0 65 0.5 66 1.5 67 1.0 68 0.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.00788603408802 97.3 2 0.737725769524294 1.4500000000000002 3 0.10175527855507505 0.3 4 0.07631645891630628 0.3 5 0.02543881963876876 0.125 6 0.0 0.0 7 0.02543881963876876 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02543881963876876 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTAT 14 0.35000000000000003 TruSeq Adapter, Index 7 (97% over 38bp) GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 7 0.17500000000000002 No Hit CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.425 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.7124999999999999 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.3125 0.0 0.0 0.0 0.0 98-99 1.6124999999999998 0.0 0.0 0.0 0.0 100-101 1.8875 0.0 0.0 0.0 0.0 102-103 2.2625 0.0 0.0 0.0 0.0 104-105 2.6125 0.0 0.0 0.0 0.0 106-107 3.0875 0.0 0.0 0.0 0.0 108-109 3.6 0.0 0.0 0.0 0.0 110-111 4.0125 0.0 0.0 0.0 0.0 112-113 4.65 0.0 0.0 0.0 0.0 114-115 5.199999999999999 0.0 0.0 0.0 0.0 116-117 5.65 0.0 0.0 0.0 0.0 118-119 6.3375 0.0 0.0 0.0 0.0 120-121 6.9625 0.0 0.0 0.0 0.0 122-123 7.625 0.0 0.0 0.0 0.0 124-125 8.225 0.0 0.0 0.0 0.0 126-127 9.0375 0.0 0.0 0.0 0.0 128-129 9.725000000000001 0.0 0.0 0.0 0.0 130-131 10.45 0.0 0.0 0.0 0.0 132-133 11.25 0.0 0.0 0.0 0.0 134-135 12.275 0.0 0.0 0.0 0.0 136-137 13.3625 0.0 0.0 0.0 0.0 138-139 14.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGATC 10 0.006830828 145.0 2 ATCCTTG 10 0.006830828 145.0 6 >>END_MODULE SRR7170873 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170873_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00825 33.0 33.0 34.0 32.0 34.0 2 33.11375 34.0 33.0 34.0 32.0 34.0 3 33.134 34.0 33.0 34.0 33.0 34.0 4 33.05825 34.0 33.0 34.0 33.0 34.0 5 33.0575 34.0 33.0 34.0 33.0 34.0 6 37.1535 38.0 38.0 38.0 37.0 38.0 7 37.13175 38.0 38.0 38.0 37.0 38.0 8 37.1625 38.0 38.0 38.0 37.0 38.0 9 37.18425 38.0 38.0 38.0 37.0 38.0 10-14 37.10685 38.0 38.0 38.0 37.0 38.0 15-19 37.12415 38.0 38.0 38.0 37.0 38.0 20-24 37.04854999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.0007 38.0 38.0 38.0 37.0 38.0 30-34 36.9798 38.0 38.0 38.0 37.0 38.0 35-39 36.9848 38.0 38.0 38.0 37.0 38.0 40-44 36.929249999999996 38.0 38.0 38.0 36.8 38.0 45-49 36.932649999999995 38.0 38.0 38.0 36.6 38.0 50-54 36.913149999999995 38.0 38.0 38.0 37.0 38.0 55-59 36.83755 38.0 38.0 38.0 36.4 38.0 60-64 36.791700000000006 38.0 38.0 38.0 36.0 38.0 65-69 36.7744 38.0 38.0 38.0 36.0 38.0 70-74 36.751149999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.59585 38.0 38.0 38.0 35.2 38.0 80-84 36.36035 38.0 38.0 38.0 34.8 38.0 85-89 36.291999999999994 38.0 38.0 38.0 34.6 38.0 90-94 36.27685 38.0 38.0 38.0 34.2 38.0 95-99 36.11575 38.0 38.0 38.0 34.4 38.0 100-104 35.93555 38.0 38.0 38.0 34.0 38.0 105-109 35.80989999999999 38.0 38.0 38.0 33.4 38.0 110-114 35.50915 38.0 37.6 38.0 32.0 38.0 115-119 35.3072 38.0 37.0 38.0 31.0 38.0 120-124 34.96894999999999 38.0 36.4 38.0 28.4 38.0 125-129 34.6428 38.0 36.0 38.0 26.6 38.0 130-134 34.48245 38.0 36.0 38.0 25.6 38.0 135-139 33.64465 38.0 34.2 38.0 19.8 38.0 140-144 33.2875 38.0 33.0 38.0 17.2 38.0 145-149 32.37415 38.0 33.0 38.0 8.4 38.0 150-151 27.0835 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 6.0 4 3.0 5 5.0 6 3.0 7 5.0 8 2.0 9 1.0 10 2.0 11 1.0 12 3.0 13 2.0 14 5.0 15 6.0 16 7.0 17 3.0 18 3.0 19 12.0 20 28.0 21 10.0 22 8.0 23 12.0 24 15.0 25 17.0 26 8.0 27 30.0 28 26.0 29 32.0 30 41.0 31 48.0 32 86.0 33 88.0 34 131.0 35 209.0 36 584.0 37 2549.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.925 20.325 13.275 21.475 2 27.500000000000004 24.15 30.75 17.599999999999998 3 22.25 26.900000000000002 32.4 18.45 4 24.2 34.050000000000004 22.425 19.325 5 23.375 38.85 21.099999999999998 16.675 6 23.0980980980981 37.23723723723724 22.6976976976977 16.966966966966968 7 20.08504252126063 20.38519259629815 39.469734867433715 20.060030015007506 8 22.086043021510758 24.312156078039017 27.41370685342671 26.18809404702351 9 22.311155577788895 24.16208104052026 30.06503251625813 23.461730865432717 10-14 23.96015816607438 28.184593823514692 26.45778066970319 21.397467340707742 15-19 23.489664147354723 28.189599079032984 27.739126082386505 20.581610691225787 20-24 23.285750062609566 27.508139243676432 28.55997996493864 20.646130728775358 25-29 23.499047809962914 27.92923724566503 28.380274631652803 20.191440312719255 30-34 22.849556635439107 27.578778618305694 29.23701217373879 20.334652572516408 35-39 23.43922236697064 27.643050405852286 28.635133780939974 20.282593446237097 40-44 23.423874912298288 28.18482509772477 28.104640673549163 20.286659316427784 45-49 23.101979453770983 28.39388624404911 28.253570533700827 20.250563768479076 50-54 23.418006914174054 27.95731249060574 28.393206072448518 20.23147452277168 55-59 23.83983161270923 27.553372757341887 27.874110454044303 20.73268517590458 60-64 23.119707370847323 27.44400460991131 28.511299293480985 20.924988725760386 65-69 23.70979056017637 27.76330293616595 28.01382904098607 20.51307746267161 70-74 23.003659331294802 28.1417614918041 27.87107123164068 20.983507945260413 75-79 23.685397764298962 27.184320016040903 28.507694621284273 20.62258759837586 80-84 22.75689223057644 27.152882205513784 29.14786967418546 20.94235588972431 85-89 23.93505061641776 27.70873007918212 28.47549363536133 19.88072566903879 90-94 23.549761845073952 27.641012785159187 28.90950112810228 19.899724241664575 95-99 23.324974924774324 28.09929789368104 28.766298896690067 19.80942828485456 100-104 24.317953861584755 27.256770310932797 28.044132397191575 20.381143430290873 105-109 23.796147672552166 27.783908507223114 28.3607544141252 20.059189406099517 110-114 24.090703857924044 27.84829177745447 28.51552701550193 19.54547734911955 115-119 25.183214536693104 27.938961951611287 27.216142957534384 19.66168055416123 120-124 24.269944806823883 28.650275965880585 27.48118414450577 19.598595082789764 125-129 25.79317269076305 27.876506024096386 27.23895582329317 19.09136546184739 130-134 25.07276924621098 28.535581652112818 27.24079092642778 19.15085817524842 135-139 26.566265060240962 27.630522088353416 27.279116465863453 18.52409638554217 140-144 26.552312167719933 28.036914434747718 27.008727053866988 18.40204634366536 145-149 26.951243980738365 27.954454253611555 26.835874799357946 18.258426966292134 150-151 26.6432513798294 28.80080280983442 27.032112393376817 17.52383341695936 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.5 5 0.5 6 0.5 7 1.0 8 1.0 9 0.5 10 1.0 11 1.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 1.0 18 2.5 19 2.5 20 1.0 21 1.0 22 1.5 23 1.5 24 3.5 25 5.0 26 6.5 27 6.5 28 9.0 29 16.5 30 19.5 31 22.5 32 31.5 33 43.5 34 56.0 35 75.5 36 86.5 37 101.0 38 133.5 39 167.0 40 186.0 41 210.5 42 251.0 43 270.0 44 273.0 45 264.5 46 250.0 47 228.0 48 216.0 49 221.5 50 184.0 51 131.5 52 105.0 53 88.0 54 83.5 55 67.0 56 46.5 57 35.0 58 23.5 59 20.0 60 14.5 61 6.5 62 5.0 63 4.0 64 2.0 65 2.5 66 2.5 67 1.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.05 8 0.05 9 0.05 10-14 0.105 15-19 0.105 20-24 0.17500000000000002 25-29 0.22999999999999998 30-34 0.19499999999999998 35-39 0.21 40-44 0.22999999999999998 45-49 0.22499999999999998 50-54 0.20500000000000002 55-59 0.22999999999999998 60-64 0.215 65-69 0.21 70-74 0.255 75-79 0.255 80-84 0.25 85-89 0.22999999999999998 90-94 0.27499999999999997 95-99 0.3 100-104 0.3 105-109 0.32 110-114 0.335 115-119 0.38999999999999996 120-124 0.35000000000000003 125-129 0.4 130-134 0.37 135-139 0.4 140-144 0.31 145-149 0.32 150-151 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.475 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26377253109926 97.75 2 0.456968773800457 0.8999999999999999 3 0.12693577050012694 0.375 4 0.10154861640010156 0.4 5 0.0 0.0 6 0.0 0.0 7 0.02538715410002539 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02538715410002539 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 16 0.4 Illumina Single End PCR Primer 1 (97% over 34bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.425 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.7124999999999999 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.35 0.0 0.0 0.0 0.0 98-99 1.6625 0.0 0.0 0.0 0.0 100-101 1.9874999999999998 0.0 0.0 0.0 0.0 102-103 2.3375000000000004 0.0 0.0 0.0 0.0 104-105 2.6875 0.0 0.0 0.0 0.0 106-107 3.1625 0.0 0.0 0.0 0.0 108-109 3.6500000000000004 0.0 0.0 0.0 0.0 110-111 4.0375 0.0 0.0 0.0 0.0 112-113 4.7125 0.0 0.0 0.0 0.0 114-115 5.225 0.0 0.0 0.0 0.0 116-117 5.65 0.0 0.0 0.0 0.0 118-119 6.3375 0.0 0.0 0.0 0.0 120-121 6.9625 0.0 0.0 0.0 0.0 122-123 7.65 0.0 0.0 0.0 0.0 124-125 8.3 0.0 0.0 0.0 0.0 126-127 9.1 0.0 0.0 0.0 0.0 128-129 9.7875 0.0 0.0 0.0 0.0 130-131 10.524999999999999 0.0 0.0 0.0 0.0 132-133 11.3375 0.0 0.0 0.0 0.0 134-135 12.412500000000001 0.0 0.0 0.0 0.0 136-137 13.4375 0.0 0.0 0.0 0.0 138-139 14.287500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGCCT 10 0.006908889 144.45001 8 GAGGCTG 10 0.006908889 144.45001 4 >>END_MODULE Read 553625 spots for SRR7170873.sra Written 553625 spots for SRR7170873.sra Read 553625 spots for SRR7170873.sra Written 553625 spots for SRR7170873.sra Read 553625 spots for SRR7170873.sra Written 553625 spots for SRR7170873.sra Read 553625 spots for SRR7170873.sra Written 553625 spots for SRR7170873.sra Read 553625 spots for SRR7170873.sra Written 553625 spots for SRR7170873.sra Read 553625 spots for SRR7170873.sra Written 553625 spots for SRR7170873.sra Read 553625 spots for SRR7170873.sra Written 553625 spots for SRR7170873.sra Read 553625 spots for SRR7170873.sra Written 553625 spots for SRR7170873.sra Read 553625 spots for SRR7170873.sra Written 553625 spots for SRR7170873.sra Read 553625 spots for SRR7170873.sra Written 553625 spots for SRR7170873.sra Read 553625 spots for SRR7170873.sra Written 553625 spots for SRR7170873.sra Read 553625 spots for SRR7170873.sra Written 553625 spots for SRR7170873.sra Read 553633 spots for SRR7170873.sra Written 553633 spots for SRR7170873.sra Read 553625 spots for SRR7170873.sra Written 553625 spots for SRR7170873.sra Read 553625 spots for SRR7170873.sra Written 553625 spots for SRR7170873.sra Read 553625 spots for SRR7170873.sra Written 553625 spots for SRR7170873.sra Read 553625 spots for SRR7170873.sra Written 553625 spots for SRR7170873.sra Read 553625 spots for SRR7170873.sra Written 553625 spots for SRR7170873.sra Read 553625 spots for SRR7170873.sra Written 553625 spots for SRR7170873.sra Read 553625 spots for SRR7170873.sra Written 553625 spots for SRR7170873.sra SRR ids: ['SRR7170873.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2r4vaoz4 SRR7170873.sra spots: 11072508 blocks: [[1, 553625], [553626, 1107250], [1107251, 1660875], [1660876, 2214500], [2214501, 2768125], [2768126, 3321750], [3321751, 3875375], [3875376, 4429000], [4429001, 4982625], [4982626, 5536250], [5536251, 6089875], [6089876, 6643500], [6643501, 7197125], [7197126, 7750750], [7750751, 8304375], [8304376, 8858000], [8858001, 9411625], [9411626, 9965250], [9965251, 10518875], [10518876, 11072508]] SRR7170873 file size 3730409 SRR7170873 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170873 SRR7170873_1.fastq SRR7170873_2.fastq Input file: SRR7170873_1.fastq Paired file: SRR7170873_2.fastq trimmed: SRR7170873-trimmed-pair1.fastq, SRR7170873-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:37:49 2025 >> started Thu Feb 13 20:38:02 2025 >> done (13.179s) 11072508 read pairs processed; of these: 20122 ( 0.18%) short read pairs filtered out after trimming by size control 69538 ( 0.63%) empty read pairs filtered out after trimming by size control 10982848 (99.19%) read pairs available; of these: 7064283 (64.32%) trimmed read pairs available after processing 3918565 (35.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 14 0.00% 20 11 0.00% 21 14 0.00% 22 22 0.00% 23 16 0.00% 24 18 0.00% 25 23 0.00% 26 30 0.00% 27 16 0.00% 28 22 0.00% 29 28 0.00% 30 24 0.00% 31 30 0.00% 32 45 0.00% 33 32 0.00% 34 43 0.00% 35 34 0.00% 36 32 0.00% 37 26 0.00% 38 31 0.00% 39 37 0.00% 40 52 0.00% 41 47 0.00% 42 52 0.00% 43 59 0.00% 44 54 0.00% 45 75 0.00% 46 83 0.00% 47 94 0.00% 48 112 0.00% 49 138 0.00% 50 159 0.00% 51 137 0.00% 52 185 0.00% 53 207 0.00% 54 217 0.00% 55 256 0.00% 56 275 0.00% 57 324 0.00% 58 336 0.00% 59 404 0.00% 60 468 0.00% 61 548 0.00% 62 606 0.01% 63 732 0.01% 64 702 0.01% 65 863 0.01% 66 854 0.01% 67 941 0.01% 68 1096 0.01% 69 1206 0.01% 70 1490 0.01% 71 1742 0.02% 72 2164 0.02% 73 2388 0.02% 74 2633 0.02% 75 3112 0.03% 76 5208 0.05% 77 4715 0.04% 78 3862 0.04% 79 4099 0.04% 80 4679 0.04% 81 5512 0.05% 82 6102 0.06% 83 7309 0.07% 84 9087 0.08% 85 9573 0.09% 86 9578 0.09% 87 10086 0.09% 88 10433 0.09% 89 10966 0.10% 90 12134 0.11% 91 13074 0.12% 92 14553 0.13% 93 16299 0.15% 94 17354 0.16% 95 18138 0.17% 96 18471 0.17% 97 18395 0.17% 98 18555 0.17% 99 19534 0.18% 100 20907 0.19% 101 21815 0.20% 102 24677 0.22% 103 26260 0.24% 104 28209 0.26% 105 29231 0.27% 106 29526 0.27% 107 29496 0.27% 108 29921 0.27% 109 30344 0.28% 110 31340 0.29% 111 33001 0.30% 112 35164 0.32% 113 37617 0.34% 114 39621 0.36% 115 41529 0.38% 116 42213 0.38% 117 42785 0.39% 118 42220 0.38% 119 42209 0.38% 120 42958 0.39% 121 44753 0.41% 122 46921 0.43% 123 50016 0.46% 124 52839 0.48% 125 54516 0.50% 126 55877 0.51% 127 56496 0.51% 128 57044 0.52% 129 57855 0.53% 130 57886 0.53% 131 60440 0.55% 132 62720 0.57% 133 66441 0.60% 134 70453 0.64% 135 74402 0.68% 136 78235 0.71% 137 81342 0.74% 138 83533 0.76% 139 88566 0.81% 140 92538 0.84% 141 98695 0.90% 142 107695 0.98% 143 120893 1.10% 144 139368 1.27% 145 163202 1.49% 146 201277 1.83% 147 260947 2.38% 148 376918 3.43% 149 692357 6.30% 150 2615933 23.82% 151 3918565 35.68% 10982848 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=25 prefix-density=0.50 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=48.68 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.5 sequence=AAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=29 prefix-density=0.44 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=15.51 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.3 sequence=CAATATTTTTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTATCATTGCCTTCTCTCCTTTATCCATGGCAGCTCGAGAATT SRR7170873 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:38:46 Started mapping on | Feb 13 20:38:46 Finished on | Feb 13 20:39:58 Mapping speed, Million of reads per hour | 549.14 Number of input reads | 10982848 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 10447910 Uniquely mapped reads % | 95.13% Average mapped length | 286.24 Number of splices: Total | 9300901 Number of splices: Annotated (sjdb) | 9074304 Number of splices: GT/AG | 9120720 Number of splices: GC/AG | 134878 Number of splices: AT/AC | 6503 Number of splices: Non-canonical | 38800 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 1.99 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 279590 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 29888 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.99% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 275061 275061 275061 N_multimapping 279590 279590 279590 N_noFeature 387726 10151310 505977 N_ambiguous 254449 895 75659 UnstrandedReadsAssigned:9805735 PositiveStrandReadsAssigned:295705 NegativeStrandReadsAssigned:9866274 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=141 echo kmer=137 SRR7170873 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170873-trimmed-pair1.fastq SRR7170873-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,982,848 reads, 9,827,923 reads pseudoaligned [quant] estimated average fragment length: 209.963 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,250 rounds 52401 SRR7170873.ke.tsv 34699 SRR7170873.se.tsv 87100 total ==> SRR7170873.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1809.04 411 16.3634 Potri.005G024800.1.v4.1 1035 826.037 293 25.5474 Potri.004G059700.1.v4.1 961 752.045 1 0.0957712 Potri.007G009000.2.v4.1 1416 1207.04 0 0 Potri.003G141000.2.v4.1 2943 2734.04 580 15.2793 Potri.016G087400.1.v4.1 270 97.2504 769 569.526 Potri.015G069301.1.v4.1 564 358.703 0 0 Potri.010G195200.1.v4.1 1773 1564.04 178 8.19694 Potri.012G127500.1.v4.1 977 768.045 323 30.2897 ==> SRR7170873.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 307 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 408 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 68 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR7170873 completed mapping pipeline successfully