Starting /dee2/code/volunteer_pipeline.sh SRR7170874 current disk space = 3087916363776 free memory = 1456582812 SRR7170874 SRAfilesize d3fa8eb21826e2659e551abe72442ce8 SRR7170874.sra SRR7170874.sra file validated SRR7170874 is paired end SRR7170874 is conventional basespace SRR7170874 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170874_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.766 34.0 33.0 34.0 32.0 34.0 2 33.2925 34.0 33.0 34.0 32.0 34.0 3 33.2625 34.0 33.0 34.0 33.0 34.0 4 33.314 34.0 33.0 34.0 33.0 34.0 5 33.2465 34.0 33.0 34.0 33.0 34.0 6 36.82275 38.0 37.0 38.0 35.0 38.0 7 37.20975 38.0 38.0 38.0 36.0 38.0 8 37.35625 38.0 38.0 38.0 37.0 38.0 9 37.44875 38.0 38.0 38.0 37.0 38.0 10-14 37.3916 38.0 38.0 38.0 37.0 38.0 15-19 37.33515 38.0 38.0 38.0 37.0 38.0 20-24 37.2613 38.0 38.0 38.0 36.8 38.0 25-29 37.18835 38.0 38.0 38.0 36.2 38.0 30-34 37.236599999999996 38.0 38.0 38.0 36.6 38.0 35-39 37.16135 38.0 38.0 38.0 36.2 38.0 40-44 37.128400000000006 38.0 38.0 38.0 36.0 38.0 45-49 36.982749999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.8672 38.0 38.0 38.0 35.0 38.0 55-59 36.89325 38.0 38.0 38.0 35.6 38.0 60-64 36.78425 38.0 38.0 38.0 35.2 38.0 65-69 36.701800000000006 38.0 38.0 38.0 34.4 38.0 70-74 36.5997 38.0 38.0 38.0 34.4 38.0 75-79 36.4191 38.0 38.0 38.0 33.6 38.0 80-84 36.30395 38.0 37.8 38.0 33.6 38.0 85-89 36.28144999999999 38.0 37.8 38.0 33.8 38.0 90-94 36.2374 38.0 37.4 38.0 33.8 38.0 95-99 36.14505 38.0 37.0 38.0 33.2 38.0 100-104 35.802049999999994 38.0 37.0 38.0 31.4 38.0 105-109 35.6972 38.0 36.8 38.0 30.6 38.0 110-114 35.50925 38.0 36.4 38.0 30.4 38.0 115-119 35.140750000000004 38.0 36.0 38.0 28.2 38.0 120-124 34.700900000000004 38.0 35.0 38.0 26.4 38.0 125-129 34.70755 38.0 35.0 38.0 26.6 38.0 130-134 33.98795 38.0 34.0 38.0 23.0 38.0 135-139 33.8552 38.0 33.6 38.0 22.8 38.0 140-144 33.243849999999995 38.0 33.2 38.0 19.0 38.0 145-149 32.167649999999995 38.0 32.6 38.0 10.8 38.0 150-151 27.124875 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 2.0 13 0.0 14 0.0 15 0.0 16 2.0 17 2.0 18 5.0 19 10.0 20 7.0 21 3.0 22 4.0 23 10.0 24 21.0 25 21.0 26 29.0 27 39.0 28 35.0 29 37.0 30 74.0 31 65.0 32 114.0 33 124.0 34 211.0 35 302.0 36 883.0 37 1999.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.57342835327056 16.92542631712904 9.442606261135149 30.058539068465258 2 21.7 19.7 35.25 23.35 3 16.950000000000003 28.775000000000002 30.275000000000002 24.0 4 21.875 33.300000000000004 24.125 20.7 5 19.650000000000002 38.3 24.125 17.925 6 18.375 35.55 24.474999999999998 21.6 7 14.399999999999999 23.674999999999997 42.199999999999996 19.725 8 17.974999999999998 21.95 30.85 29.225 9 17.224999999999998 22.975 31.25 28.549999999999997 10-14 20.599999999999998 29.360000000000003 25.900000000000002 24.14 15-19 19.845 28.675 27.83 23.65 20-24 20.06 28.22 27.93 23.79 25-29 19.7 28.65 27.91 23.74 30-34 20.135 28.225 28.07 23.57 35-39 20.765 28.265 27.525 23.445 40-44 20.285 28.465 28.03 23.22 45-49 19.685 28.175 27.735 24.404999999999998 50-54 20.625 27.534999999999997 27.794999999999998 24.044999999999998 55-59 19.755 28.7 27.200000000000003 24.345 60-64 20.01 28.634999999999998 27.555000000000003 23.799999999999997 65-69 20.61 28.515 27.18 23.695 70-74 20.65 28.395 27.839999999999996 23.115 75-79 20.895 28.225 27.089999999999996 23.79 80-84 20.25 28.535 27.58 23.635 85-89 20.244999999999997 28.17 28.110000000000003 23.474999999999998 90-94 20.080000000000002 28.645 27.54 23.735 95-99 20.65 28.435 27.150000000000002 23.765 100-104 20.46 28.965000000000003 26.845000000000002 23.73 105-109 20.53 28.439999999999998 27.3 23.73 110-114 20.695 28.035 27.534999999999997 23.735 115-119 21.38 28.42 26.8 23.400000000000002 120-124 21.05 28.305000000000003 26.88 23.765 125-129 20.69 27.985 27.305 24.02 130-134 20.82 28.485 27.189999999999998 23.505000000000003 135-139 21.625 27.775 26.31 24.29 140-144 20.76 27.944999999999997 26.91 24.385 145-149 20.830000000000002 27.58 27.01 24.58 150-151 21.099999999999998 27.650000000000002 27.125 24.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.0 23 0.0 24 2.0 25 5.0 26 6.5 27 6.0 28 7.5 29 12.5 30 22.0 31 31.0 32 37.5 33 51.5 34 63.5 35 85.0 36 97.0 37 104.0 38 134.0 39 166.0 40 178.0 41 194.5 42 230.0 43 229.0 44 218.0 45 260.0 46 288.0 47 262.5 48 228.5 49 207.5 50 181.5 51 155.5 52 134.5 53 99.5 54 75.5 55 57.0 56 41.0 57 35.5 58 30.5 59 22.5 60 12.5 61 6.5 62 6.5 63 3.5 64 1.0 65 1.5 66 1.0 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29328621908127 98.35000000000001 2 0.5805148914689551 1.15 3 0.0757193336698637 0.22499999999999998 4 0.0 0.0 5 0.025239777889954566 0.125 6 0.025239777889954566 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 6 0.15 TruSeq Adapter, Index 2 (97% over 37bp) GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5875 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.5875 0.0 0.0 0.0 0.0 98-99 1.925 0.0 0.0 0.0 0.0 100-101 2.2750000000000004 0.0 0.0 0.0 0.0 102-103 2.625 0.0 0.0 0.0 0.0 104-105 2.9125 0.0 0.0 0.0 0.0 106-107 3.275 0.0 0.0 0.0 0.0 108-109 3.6125 0.0 0.0 0.0 0.0 110-111 3.925 0.0 0.0 0.0 0.0 112-113 4.324999999999999 0.0 0.0 0.0 0.0 114-115 4.85 0.0 0.0 0.0 0.0 116-117 5.475 0.0 0.0 0.0 0.0 118-119 6.137499999999999 0.0 0.0 0.0 0.0 120-121 6.725 0.0 0.0 0.0 0.0 122-123 7.2375 0.0 0.0 0.0 0.0 124-125 7.825 0.0 0.0 0.0 0.0 126-127 8.3375 0.0 0.0 0.0 0.0 128-129 8.7375 0.0 0.0 0.0 0.0 130-131 9.425 0.0 0.0 0.0 0.0 132-133 10.0625 0.0 0.0 0.0 0.0 134-135 10.775 0.0 0.0 0.0 0.0 136-137 11.5875 0.0 0.0 0.0 0.0 138-139 12.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTAATG 10 0.006832588 144.9875 7 >>END_MODULE SRR7170874 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170874_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9575 33.0 33.0 34.0 32.0 34.0 2 33.0995 34.0 33.0 34.0 32.0 34.0 3 33.05125 34.0 33.0 34.0 32.0 34.0 4 33.06425 34.0 33.0 34.0 33.0 34.0 5 33.06525 34.0 33.0 34.0 33.0 34.0 6 37.22875 38.0 38.0 38.0 37.0 38.0 7 37.1675 38.0 38.0 38.0 37.0 38.0 8 37.189 38.0 38.0 38.0 37.0 38.0 9 37.28525 38.0 38.0 38.0 37.0 38.0 10-14 37.1953 38.0 38.0 38.0 37.0 38.0 15-19 37.17525 38.0 38.0 38.0 37.0 38.0 20-24 37.11245 38.0 38.0 38.0 36.8 38.0 25-29 37.083999999999996 38.0 38.0 38.0 36.8 38.0 30-34 37.0864 38.0 38.0 38.0 37.0 38.0 35-39 37.0733 38.0 38.0 38.0 36.8 38.0 40-44 37.03785 38.0 38.0 38.0 37.0 38.0 45-49 37.04985 38.0 38.0 38.0 36.6 38.0 50-54 36.98545 38.0 38.0 38.0 37.0 38.0 55-59 36.9332 38.0 38.0 38.0 36.2 38.0 60-64 36.8527 38.0 38.0 38.0 36.0 38.0 65-69 36.80175 38.0 38.0 38.0 36.0 38.0 70-74 36.75205000000001 38.0 38.0 38.0 36.0 38.0 75-79 36.6145 38.0 38.0 38.0 35.2 38.0 80-84 36.42 38.0 38.0 38.0 34.2 38.0 85-89 36.3882 38.0 38.0 38.0 34.4 38.0 90-94 36.319300000000005 38.0 38.0 38.0 34.0 38.0 95-99 36.25365 38.0 38.0 38.0 34.0 38.0 100-104 36.10205 38.0 38.0 38.0 34.0 38.0 105-109 35.8981 38.0 38.0 38.0 33.2 38.0 110-114 35.579 38.0 37.2 38.0 31.4 38.0 115-119 35.411449999999995 38.0 37.0 38.0 30.6 38.0 120-124 35.04494999999999 38.0 36.2 38.0 28.6 38.0 125-129 34.65145 38.0 35.8 38.0 26.6 38.0 130-134 34.44685 38.0 35.2 38.0 25.0 38.0 135-139 33.62525 38.0 34.0 38.0 18.6 38.0 140-144 33.40065 38.0 33.0 38.0 20.0 38.0 145-149 32.54344999999999 38.0 33.0 38.0 12.4 38.0 150-151 27.187625 34.0 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 2.0 5 1.0 6 0.0 7 3.0 8 2.0 9 3.0 10 2.0 11 5.0 12 0.0 13 4.0 14 3.0 15 5.0 16 2.0 17 4.0 18 7.0 19 9.0 20 12.0 21 7.0 22 15.0 23 13.0 24 17.0 25 21.0 26 24.0 27 21.0 28 38.0 29 32.0 30 49.0 31 54.0 32 76.0 33 91.0 34 139.0 35 240.0 36 592.0 37 2499.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.25 18.15 11.95 23.65 2 24.825 23.45 32.85 18.875 3 21.825 26.525 33.300000000000004 18.35 4 24.275 33.375 23.225 19.125 5 22.775000000000002 38.3 21.95 16.975 6 20.180045011252815 37.409352338084524 24.10602650662666 18.30457614403601 7 19.279819954988746 19.879969992498125 40.060015003750934 20.78019504876219 8 20.974999999999998 23.674999999999997 28.275 27.075 9 22.05551387846962 26.156539134783696 27.956989247311824 23.830957739434858 10-14 23.16079019754939 28.20205051262816 26.85671417854464 21.780445111277817 15-19 23.1807951987997 27.796949237309327 28.502125531382845 20.520130032508128 20-24 23.195798949737434 28.41210302575644 27.611902975743934 20.78019504876219 25-29 23.18238679009257 28.591443582687013 27.545659244433324 20.68051038278709 30-34 22.225001250562755 27.86754039317693 28.787954579560804 21.119503776699514 35-39 22.896448224112056 28.354177088544276 27.79889944972486 20.95047523761881 40-44 22.84985240406264 28.308400460299193 27.672987441837194 21.168759693800972 45-49 22.550785549884917 28.034624236965875 28.509956969878914 20.90463324327029 50-54 22.939175670268106 27.82112845138055 28.11124449779912 21.12845138055222 55-59 23.140041026667333 28.18832240956622 27.55290939110422 21.11872717266223 60-64 22.582420331182153 27.435089299114512 28.54570013507429 21.436790234629047 65-69 22.977637700735404 27.590174596027815 27.92535894742108 21.5068287558157 70-74 22.87944753040084 27.65350547965771 28.27403292798879 21.19301406195266 75-79 22.91791791791792 27.732732732732735 28.033033033033032 21.316316316316318 80-84 23.371033930537482 27.59483535181663 27.995195676108498 21.038935041537385 85-89 23.77045079301546 27.512883374193226 28.078250863060987 20.638414969730327 90-94 24.015215976775615 27.899294258971917 27.418789729215675 20.66670003503679 95-99 24.178850390546767 27.843981574203884 27.36330863208492 20.61385940316443 100-104 24.136377290477622 28.18664263542605 27.675978772404125 20.0010013016922 105-109 24.302808791869023 28.23311470485155 27.191708806889302 20.272367696390127 110-114 24.61446024434208 28.324654516322852 27.007810935309433 20.053074304025635 115-119 25.061363522516654 28.0869608776236 26.90477383158844 19.946901768271303 120-124 25.036309911353733 28.121400310512346 26.854309610857918 19.987980167276007 125-129 25.063874555383 27.458544161114173 27.759130304092984 19.718450979409848 130-134 25.430689102564102 28.22015224358974 26.61758814102564 19.73157051282051 135-139 25.881586856341414 27.569625325586056 26.943498296934482 19.605289521138047 140-144 25.489508738544743 28.389002954579603 26.626270719615402 19.495217587260253 145-149 25.917580491712982 28.306043763457012 26.62861148665565 19.14776425817435 150-151 26.62158777861257 26.79689456548961 27.1099423991986 19.47157525669922 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.5 19 2.0 20 1.5 21 0.5 22 1.5 23 2.5 24 1.5 25 1.5 26 5.0 27 7.0 28 9.0 29 12.5 30 14.5 31 21.0 32 33.0 33 38.5 34 40.5 35 64.0 36 87.0 37 101.0 38 122.0 39 150.5 40 186.5 41 227.0 42 264.5 43 276.0 44 265.5 45 246.5 46 261.0 47 256.5 48 225.0 49 203.5 50 170.5 51 149.0 52 124.5 53 102.5 54 84.0 55 63.5 56 47.0 57 33.0 58 24.5 59 22.0 60 17.0 61 9.0 62 6.5 63 3.0 64 0.5 65 2.0 66 1.5 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.0 9 0.025 10-14 0.025 15-19 0.025 20-24 0.025 25-29 0.075 30-34 0.045 35-39 0.05 40-44 0.065 45-49 0.06999999999999999 50-54 0.04 55-59 0.065 60-64 0.055 65-69 0.055 70-74 0.08499999999999999 75-79 0.1 80-84 0.09 85-89 0.065 90-94 0.105 95-99 0.13999999999999999 100-104 0.13 105-109 0.135 110-114 0.13999999999999999 115-119 0.185 120-124 0.165 125-129 0.19499999999999998 130-134 0.16 135-139 0.18 140-144 0.155 145-149 0.145 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36900555275113 98.425 2 0.47955577990913684 0.95 3 0.0757193336698637 0.22499999999999998 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.05047955577990913 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 6 0.15 Illumina Single End PCR Primer 1 (97% over 34bp) CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.23750000000000002 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.5875 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.9249999999999999 0.0 0.0 0.0 0.0 94-95 1.2 0.0 0.0 0.0 0.0 96-97 1.5875 0.0 0.0 0.0 0.0 98-99 1.925 0.0 0.0 0.0 0.0 100-101 2.2750000000000004 0.0 0.0 0.0 0.0 102-103 2.65 0.0 0.0 0.0 0.0 104-105 2.95 0.0 0.0 0.0 0.0 106-107 3.325 0.0 0.0 0.0 0.0 108-109 3.6624999999999996 0.0 0.0 0.0 0.0 110-111 3.9749999999999996 0.0 0.0 0.0 0.0 112-113 4.3625 0.0 0.0 0.0 0.0 114-115 4.875 0.0 0.0 0.0 0.0 116-117 5.449999999999999 0.0 0.0 0.0 0.0 118-119 6.0625 0.0 0.0 0.0 0.0 120-121 6.6625 0.0 0.0 0.0 0.0 122-123 7.175000000000001 0.0 0.0 0.0 0.0 124-125 7.8 0.0 0.0 0.0 0.0 126-127 8.325 0.0 0.0 0.0 0.0 128-129 8.7375 0.0 0.0 0.0 0.0 130-131 9.4375 0.0 0.0 0.0 0.0 132-133 10.075 0.0 0.0 0.0 0.0 134-135 10.7375 0.0 0.0 0.0 0.0 136-137 11.5125 0.0 0.0 0.0 0.0 138-139 12.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 685694 spots for SRR7170874.sra Written 685694 spots for SRR7170874.sra Read 685694 spots for SRR7170874.sra Written 685694 spots for SRR7170874.sra Read 685694 spots for SRR7170874.sra Written 685694 spots for SRR7170874.sra Read 685694 spots for SRR7170874.sra Written 685694 spots for SRR7170874.sra Read 685694 spots for SRR7170874.sra Written 685694 spots for SRR7170874.sra Read 685694 spots for SRR7170874.sra Written 685694 spots for SRR7170874.sra Read 685694 spots for SRR7170874.sra Written 685694 spots for SRR7170874.sra Read 685694 spots for SRR7170874.sra Written 685694 spots for SRR7170874.sra Read 685694 spots for SRR7170874.sra Written 685694 spots for SRR7170874.sra Read 685694 spots for SRR7170874.sra Written 685694 spots for SRR7170874.sra Read 685694 spots for SRR7170874.sra Written 685694 spots for SRR7170874.sra Read 685694 spots for SRR7170874.sra Written 685694 spots for SRR7170874.sra Read 685694 spots for SRR7170874.sra Written 685694 spots for SRR7170874.sra Read 685694 spots for SRR7170874.sra Written 685694 spots for SRR7170874.sra Read 685694 spots for SRR7170874.sra Written 685694 spots for SRR7170874.sra Read 685694 spots for SRR7170874.sra Written 685694 spots for SRR7170874.sra Read 685694 spots for SRR7170874.sra Written 685694 spots for SRR7170874.sra Read 685694 spots for SRR7170874.sra Written 685694 spots for SRR7170874.sra Read 685694 spots for SRR7170874.sra Written 685694 spots for SRR7170874.sra Read 685694 spots for SRR7170874.sra Written 685694 spots for SRR7170874.sra SRR ids: ['SRR7170874.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_db_umdzt SRR7170874.sra spots: 13713880 blocks: [[1, 685694], [685695, 1371388], [1371389, 2057082], [2057083, 2742776], [2742777, 3428470], [3428471, 4114164], [4114165, 4799858], [4799859, 5485552], [5485553, 6171246], [6171247, 6856940], [6856941, 7542634], [7542635, 8228328], [8228329, 8914022], [8914023, 9599716], [9599717, 10285410], [10285411, 10971104], [10971105, 11656798], [11656799, 12342492], [12342493, 13028186], [13028187, 13713880]] SRR7170874 file size 4625483 SRR7170874 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170874 SRR7170874_1.fastq SRR7170874_2.fastq Input file: SRR7170874_1.fastq Paired file: SRR7170874_2.fastq trimmed: SRR7170874-trimmed-pair1.fastq, SRR7170874-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:49:02 2025 >> started Thu Feb 13 20:49:24 2025 >> done (22.215s) 13713880 read pairs processed; of these: 22348 ( 0.16%) short read pairs filtered out after trimming by size control 40437 ( 0.29%) empty read pairs filtered out after trimming by size control 13651095 (99.54%) read pairs available; of these: 9110480 (66.74%) trimmed read pairs available after processing 4540615 (33.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 22 0.00% 19 22 0.00% 20 19 0.00% 21 14 0.00% 22 20 0.00% 23 23 0.00% 24 33 0.00% 25 17 0.00% 26 39 0.00% 27 33 0.00% 28 39 0.00% 29 35 0.00% 30 42 0.00% 31 29 0.00% 32 36 0.00% 33 27 0.00% 34 52 0.00% 35 34 0.00% 36 31 0.00% 37 57 0.00% 38 42 0.00% 39 47 0.00% 40 67 0.00% 41 59 0.00% 42 66 0.00% 43 72 0.00% 44 85 0.00% 45 92 0.00% 46 92 0.00% 47 118 0.00% 48 140 0.00% 49 128 0.00% 50 159 0.00% 51 213 0.00% 52 225 0.00% 53 234 0.00% 54 285 0.00% 55 320 0.00% 56 324 0.00% 57 365 0.00% 58 404 0.00% 59 489 0.00% 60 571 0.00% 61 723 0.01% 62 776 0.01% 63 886 0.01% 64 984 0.01% 65 1004 0.01% 66 1113 0.01% 67 1151 0.01% 68 1369 0.01% 69 1642 0.01% 70 1872 0.01% 71 2232 0.02% 72 2744 0.02% 73 3087 0.02% 74 3359 0.02% 75 3712 0.03% 76 5003 0.04% 77 4910 0.04% 78 4626 0.03% 79 5141 0.04% 80 5691 0.04% 81 6830 0.05% 82 7669 0.06% 83 8916 0.07% 84 10995 0.08% 85 11499 0.08% 86 11230 0.08% 87 11932 0.09% 88 12348 0.09% 89 13127 0.10% 90 14338 0.11% 91 15627 0.11% 92 17518 0.13% 93 19069 0.14% 94 20075 0.15% 95 21258 0.16% 96 21361 0.16% 97 22039 0.16% 98 22471 0.16% 99 23158 0.17% 100 24851 0.18% 101 26551 0.19% 102 28875 0.21% 103 31279 0.23% 104 32359 0.24% 105 34142 0.25% 106 34612 0.25% 107 34656 0.25% 108 35218 0.26% 109 35957 0.26% 110 36635 0.27% 111 39276 0.29% 112 41246 0.30% 113 43733 0.32% 114 46260 0.34% 115 48185 0.35% 116 48641 0.36% 117 48839 0.36% 118 49162 0.36% 119 49375 0.36% 120 51331 0.38% 121 53266 0.39% 122 55314 0.41% 123 58966 0.43% 124 61883 0.45% 125 64327 0.47% 126 66371 0.49% 127 66895 0.49% 128 67818 0.50% 129 68886 0.50% 130 70106 0.51% 131 73210 0.54% 132 76886 0.56% 133 81487 0.60% 134 86815 0.64% 135 92548 0.68% 136 96593 0.71% 137 101712 0.75% 138 107377 0.79% 139 113683 0.83% 140 121006 0.89% 141 131091 0.96% 142 145339 1.06% 143 164369 1.20% 144 190867 1.40% 145 227341 1.67% 146 283377 2.08% 147 374821 2.75% 148 544306 3.99% 149 980837 7.19% 150 3313094 24.27% 151 4540615 33.26% 13651095 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=14 prefix-density=0.61 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=43.75 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.0 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=21 prefix-density=0.82 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=42.87 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.3 sequence=GGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCG SRR7170874 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:50:09 Started mapping on | Feb 13 20:50:10 Finished on | Feb 13 20:52:32 Mapping speed, Million of reads per hour | 346.08 Number of input reads | 13651095 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 12779904 Uniquely mapped reads % | 93.62% Average mapped length | 286.56 Number of splices: Total | 11954935 Number of splices: Annotated (sjdb) | 11676343 Number of splices: GT/AG | 11716276 Number of splices: GC/AG | 189155 Number of splices: AT/AC | 7073 Number of splices: Non-canonical | 42431 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 376889 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 21674 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.42% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 513109 513109 513109 N_multimapping 376889 376889 376889 N_noFeature 452028 12486925 627198 N_ambiguous 206632 1304 87835 UnstrandedReadsAssigned:12121244 PositiveStrandReadsAssigned:291675 NegativeStrandReadsAssigned:12064871 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=142 echo kmer=137 SRR7170874 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170874-trimmed-pair1.fastq SRR7170874-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,651,095 reads, 12,080,883 reads pseudoaligned [quant] estimated average fragment length: 216.546 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR7170874.ke.tsv 34699 SRR7170874.se.tsv 87100 total ==> SRR7170874.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1802.45 571 25.0882 Potri.005G024800.1.v4.1 1035 819.454 209 20.1985 Potri.004G059700.1.v4.1 961 745.506 7 0.74361 Potri.007G009000.2.v4.1 1416 1200.45 0 0 Potri.003G141000.2.v4.1 2943 2727.45 713.049 20.7043 Potri.016G087400.1.v4.1 270 96.0154 726 598.817 Potri.015G069301.1.v4.1 564 354.34 0 0 Potri.010G195200.1.v4.1 1773 1557.45 105 5.33915 Potri.012G127500.1.v4.1 977 761.469 66 6.8642 ==> SRR7170874.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 475 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 230 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 44 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7170874 completed mapping pipeline successfully