Starting /dee2/code/volunteer_pipeline.sh SRR7170875 current disk space = 3087878955008 free memory = 1419968620 SRR7170875 SRAfilesize e815ba4359c82ccf72d0e279db3d8e77 SRR7170875.sra SRR7170875.sra file validated SRR7170875 is paired end SRR7170875 is conventional basespace SRR7170875 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170875_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6575 34.0 33.0 34.0 32.0 34.0 2 33.16725 34.0 33.0 34.0 32.0 34.0 3 33.1275 34.0 33.0 34.0 31.0 34.0 4 33.24225 34.0 33.0 34.0 32.0 34.0 5 33.2625 34.0 33.0 34.0 33.0 34.0 6 36.536 38.0 37.0 38.0 34.0 38.0 7 37.018 38.0 38.0 38.0 36.0 38.0 8 37.299 38.0 38.0 38.0 36.0 38.0 9 37.34125 38.0 38.0 38.0 37.0 38.0 10-14 37.33905 38.0 38.0 38.0 37.0 38.0 15-19 37.210950000000004 38.0 38.0 38.0 36.2 38.0 20-24 37.22695 38.0 38.0 38.0 36.4 38.0 25-29 37.2139 38.0 38.0 38.0 36.0 38.0 30-34 37.08774999999999 38.0 38.0 38.0 36.0 38.0 35-39 36.934850000000004 38.0 38.0 38.0 35.6 38.0 40-44 36.8942 38.0 38.0 38.0 35.2 38.0 45-49 36.82745 38.0 38.0 38.0 34.8 38.0 50-54 36.60455 38.0 38.0 38.0 34.2 38.0 55-59 36.5284 38.0 38.0 38.0 34.0 38.0 60-64 36.5141 38.0 38.0 38.0 33.8 38.0 65-69 36.46145 38.0 37.8 38.0 33.8 38.0 70-74 36.3443 38.0 37.6 38.0 33.6 38.0 75-79 35.8399 38.0 37.0 38.0 32.2 38.0 80-84 35.74055 38.0 37.0 38.0 32.2 38.0 85-89 35.396699999999996 38.0 36.8 38.0 29.8 38.0 90-94 35.19375 38.0 36.2 38.0 29.0 38.0 95-99 35.05585 38.0 36.0 38.0 28.4 38.0 100-104 34.4735 38.0 35.2 38.0 25.2 38.0 105-109 34.26375 38.0 34.4 38.0 24.4 38.0 110-114 33.9813 38.0 34.0 38.0 23.0 38.0 115-119 33.6114 38.0 33.2 38.0 21.0 38.0 120-124 32.882999999999996 38.0 32.6 38.0 15.6 38.0 125-129 31.8214 37.2 30.2 38.0 13.4 38.0 130-134 31.1603 36.8 28.4 38.0 12.8 38.0 135-139 29.9346 35.8 26.6 38.0 12.2 38.0 140-144 29.9001 36.0 27.8 38.0 5.6 38.0 145-149 27.82855 34.2 20.2 38.0 2.0 38.0 150-151 20.972 25.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 2.0 14 3.0 15 4.0 16 7.0 17 7.0 18 12.0 19 36.0 20 4.0 21 16.0 22 24.0 23 17.0 24 31.0 25 31.0 26 52.0 27 47.0 28 68.0 29 68.0 30 76.0 31 100.0 32 141.0 33 210.0 34 336.0 35 576.0 36 1069.0 37 1061.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.731856378915204 15.32976827094474 11.306340718105425 34.63203463203463 2 20.225 21.175 35.225 23.375 3 17.91343507630723 28.221165874405806 28.546409807355516 25.31898924193145 4 21.4 33.95 22.675 21.975 5 21.975 37.125 24.325 16.575 6 19.375 35.3 25.35 19.975 7 13.475000000000001 24.25 43.475 18.8 8 17.349999999999998 24.575 32.35 25.724999999999998 9 18.825 23.275000000000002 32.875 25.025 10-14 19.785 30.009999999999998 26.484999999999996 23.72 15-19 20.05 28.815 27.584999999999997 23.549999999999997 20-24 19.38 29.425 27.85 23.345 25-29 19.189999999999998 29.959999999999997 26.995 23.855 30-34 19.71 29.23 27.935 23.125 35-39 19.175 29.325000000000003 27.565 23.935000000000002 40-44 19.605 29.635 27.555000000000003 23.205000000000002 45-49 20.36 27.894999999999996 27.985 23.76 50-54 20.345 28.265 27.315 24.075 55-59 19.34 28.82 27.99 23.849999999999998 60-64 19.845 28.694999999999997 27.515 23.945 65-69 20.235 29.609999999999996 26.674999999999997 23.48 70-74 20.255000000000003 30.255 26.35 23.14 75-79 19.86 29.270000000000003 27.389999999999997 23.48 80-84 19.869999999999997 28.88 27.355 23.895 85-89 20.49 28.84 27.805000000000003 22.865 90-94 19.86 29.020000000000003 27.415 23.705000000000002 95-99 20.51 28.87 27.175 23.445 100-104 20.685000000000002 28.155 27.750000000000004 23.41 105-109 20.979999999999997 29.395 26.765 22.86 110-114 20.845 28.655 26.479999999999997 24.02 115-119 20.585 28.53 26.650000000000002 24.235 120-124 21.32 28.34 26.235000000000003 24.104999999999997 125-129 20.865000000000002 28.345 26.51 24.279999999999998 130-134 21.349999999999998 29.03 26.06 23.56 135-139 20.669999999999998 28.83 26.055 24.445 140-144 21.2 28.305000000000003 26.355 24.14 145-149 20.560000000000002 28.54 26.174999999999997 24.725 150-151 20.825 27.85 27.625 23.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 2.5 22 2.0 23 2.5 24 3.5 25 4.0 26 8.0 27 13.0 28 19.5 29 25.5 30 32.5 31 36.5 32 41.0 33 56.5 34 76.0 35 91.5 36 115.5 37 136.0 38 142.5 39 159.5 40 175.5 41 195.5 42 220.5 43 238.5 44 235.0 45 233.0 46 239.0 47 241.5 48 236.5 49 199.5 50 169.0 51 141.5 52 119.0 53 95.0 54 72.0 55 63.0 56 50.0 57 33.5 58 18.5 59 16.0 60 13.0 61 9.0 62 5.0 63 2.5 64 2.5 65 1.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.825 2 0.0 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.82499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0799897776642 96.925 2 0.6644518272425249 1.3 3 0.1277791975466394 0.375 4 0.10222335803731153 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025555839509327882 1.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 40 1.0 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.2875 0.0 0.0 0.0 0.0 72-73 0.35 0.0 0.0 0.0 0.0 74-75 0.425 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.5625 0.0 0.0 0.0 0.0 80-81 0.6875 0.0 0.0 0.0 0.0 82-83 0.775 0.0 0.0 0.0 0.0 84-85 0.9750000000000001 0.0 0.0 0.0 0.0 86-87 1.1749999999999998 0.0 0.0 0.0 0.0 88-89 1.3250000000000002 0.0 0.0 0.0 0.0 90-91 1.4125 0.0 0.0 0.0 0.0 92-93 1.8125 0.0 0.0 0.0 0.0 94-95 2.1125 0.0 0.0 0.0 0.0 96-97 2.475 0.0 0.0 0.0 0.0 98-99 2.75 0.0 0.0 0.0 0.0 100-101 3.2125000000000004 0.0 0.0 0.0 0.0 102-103 3.7875 0.0 0.0 0.0 0.0 104-105 4.1875 0.0 0.0 0.0 0.0 106-107 4.824999999999999 0.0 0.0 0.0 0.0 108-109 5.4125 0.0 0.0 0.0 0.0 110-111 5.975 0.0 0.0 0.0 0.0 112-113 6.475 0.0 0.0 0.0 0.0 114-115 6.825 0.0 0.0 0.0 0.0 116-117 7.4 0.0 0.0 0.0 0.0 118-119 7.9125000000000005 0.0 0.0 0.0 0.0 120-121 8.45 0.0 0.0 0.0 0.0 122-123 9.087499999999999 0.0 0.0 0.0 0.0 124-125 9.825 0.0 0.0 0.0 0.0 126-127 10.5875 0.0 0.0 0.0 0.0 128-129 11.2375 0.0 0.0 0.0 0.0 130-131 12.15 0.0 0.0 0.0 0.0 132-133 12.912500000000001 0.0 0.0 0.0 0.0 134-135 13.675 0.0 0.0 0.0 0.0 136-137 14.525 0.0 0.0 0.0 0.0 138-139 15.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTCTT 10 0.006832588 144.9875 4 >>END_MODULE SRR7170875 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170875_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91375 33.0 33.0 34.0 32.0 34.0 2 32.98975 33.0 33.0 34.0 32.0 34.0 3 32.98375 34.0 33.0 34.0 32.0 34.0 4 32.9965 34.0 33.0 34.0 32.0 34.0 5 32.988 34.0 33.0 34.0 32.0 34.0 6 37.15275 38.0 38.0 38.0 37.0 38.0 7 37.2315 38.0 38.0 38.0 37.0 38.0 8 37.20125 38.0 38.0 38.0 37.0 38.0 9 37.24375 38.0 38.0 38.0 37.0 38.0 10-14 37.234 38.0 38.0 38.0 37.0 38.0 15-19 37.1854 38.0 38.0 38.0 37.0 38.0 20-24 37.12355000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.061400000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.0623 38.0 38.0 38.0 36.8 38.0 35-39 37.007999999999996 38.0 38.0 38.0 36.6 38.0 40-44 37.02025 38.0 38.0 38.0 36.8 38.0 45-49 37.01370000000001 38.0 38.0 38.0 37.0 38.0 50-54 36.9581 38.0 38.0 38.0 36.2 38.0 55-59 36.959199999999996 38.0 38.0 38.0 36.2 38.0 60-64 36.8603 38.0 38.0 38.0 36.0 38.0 65-69 36.8182 38.0 38.0 38.0 36.0 38.0 70-74 36.8149 38.0 38.0 38.0 36.0 38.0 75-79 36.7103 38.0 38.0 38.0 35.6 38.0 80-84 36.1147 38.0 38.0 38.0 34.0 38.0 85-89 36.100649999999995 38.0 38.0 38.0 34.0 38.0 90-94 36.0312 38.0 38.0 38.0 33.8 38.0 95-99 35.87795 38.0 38.0 38.0 34.0 38.0 100-104 35.799150000000004 38.0 37.8 38.0 33.2 38.0 105-109 35.63675 38.0 37.0 38.0 32.4 38.0 110-114 35.47565 38.0 37.0 38.0 30.6 38.0 115-119 35.13895 38.0 36.4 38.0 29.0 38.0 120-124 34.7404 38.0 36.0 38.0 27.4 38.0 125-129 34.23195 38.0 35.0 38.0 24.2 38.0 130-134 33.65415 38.0 33.4 38.0 21.8 38.0 135-139 33.019549999999995 38.0 33.0 38.0 16.6 38.0 140-144 31.920550000000002 38.0 32.2 38.0 12.8 38.0 145-149 30.8303 38.0 30.4 38.0 3.8 38.0 150-151 25.218625 32.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 3.0 4 1.0 5 2.0 6 2.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 8.0 15 1.0 16 6.0 17 3.0 18 5.0 19 16.0 20 34.0 21 11.0 22 12.0 23 6.0 24 16.0 25 19.0 26 24.0 27 29.0 28 25.0 29 42.0 30 45.0 31 58.0 32 77.0 33 128.0 34 172.0 35 301.0 36 745.0 37 2191.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.675000000000004 19.375 14.000000000000002 24.95 2 25.874999999999996 24.65 32.65 16.825000000000003 3 20.349999999999998 26.85 33.0 19.8 4 24.5 35.025 21.325 19.15 5 25.0 36.25 21.5 17.25 6 21.375 37.6 22.25 18.775 7 20.200000000000003 19.875 39.625 20.3 8 21.625 24.95 26.224999999999998 27.200000000000003 9 22.225 24.975 28.025 24.775 10-14 24.192419241924192 28.292829282928295 26.21762176217622 21.297129712971298 15-19 23.331999599879964 27.478243473041914 28.39351805541662 20.796238871661497 20-24 23.672754565924443 28.561421065799347 26.985238929196896 20.78058543907931 25-29 23.44758568926695 28.221165874405806 27.755816862646988 20.575431573680262 30-34 23.266286400480336 27.629340538376862 28.494946462523767 20.60942659861903 35-39 23.632724543407555 28.441330998248688 27.47060295221416 20.4553415061296 40-44 23.600340221143743 28.403462250462802 27.577925651673592 20.418271876719867 45-49 23.087315486614962 28.256192144108084 27.850888166124594 20.805604203152363 50-54 23.35251438578934 27.660745559169374 28.32124093069802 20.665499124343256 55-59 23.425226397158152 26.57227197678491 28.578576074448392 21.423925551608544 60-64 23.102326745058793 28.071053289967473 27.910933199899922 20.915686765073804 65-69 23.132349261946462 28.081060795596695 28.261195896922693 20.52539404553415 70-74 23.367525644233176 28.416312234175635 27.955966975231423 20.26019514635977 75-79 23.262446835126344 28.461346009507132 27.47060295221416 20.805604203152363 80-84 23.090008505528594 28.09326061940261 28.318406964526943 20.498323910541853 85-89 24.000600390253666 27.40781507980187 28.46850452794316 20.123080002001302 90-94 23.77045079301546 28.128283384199733 27.65797768549557 20.443288137289237 95-99 23.607705779334502 27.970978233675257 27.87090317738304 20.550412809607206 100-104 24.702291604122887 28.009606724707297 27.364154908435907 19.923946762733912 105-109 24.583437578183638 27.565674255691768 27.535651738804102 20.31523642732049 110-114 24.3832874655992 28.45634225669252 27.32049036777583 19.83987990993245 115-119 25.293970477858394 27.87090317738304 26.659994996247182 20.175131348511382 120-124 25.399049286965226 28.361270953214913 26.659994996247182 19.57968476357268 125-129 24.768576432324245 28.391293470102575 27.450587940955717 19.389542156617463 130-134 24.973730297723293 28.786589942456843 27.140355266449838 19.099324493370027 135-139 26.144608456342254 27.60570427820866 27.32049036777583 18.929196897673258 140-144 26.134600950713033 28.541406054540907 26.62997247935952 18.69402051538654 145-149 26.279709782336752 28.501376032024016 26.830122591943955 18.388791593695274 150-151 26.607455591693768 29.221916437327994 25.856892669502123 18.313735301476108 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 1.0 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 1.0 23 3.0 24 4.5 25 5.5 26 8.5 27 8.0 28 7.5 29 9.5 30 17.5 31 26.5 32 31.5 33 43.0 34 53.5 35 70.0 36 81.5 37 100.5 38 134.5 39 154.0 40 171.5 41 197.0 42 237.0 43 274.5 44 280.0 45 282.5 46 266.5 47 239.5 48 209.0 49 182.5 50 178.0 51 151.5 52 117.0 53 101.0 54 92.5 55 73.0 56 48.5 57 37.5 58 32.5 59 24.0 60 14.5 61 7.5 62 4.5 63 3.0 64 5.0 65 3.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.03 20-24 0.075 25-29 0.075 30-34 0.06999999999999999 35-39 0.075 40-44 0.065 45-49 0.075 50-54 0.075 55-59 0.065 60-64 0.075 65-69 0.075 70-74 0.075 75-79 0.075 80-84 0.065 85-89 0.065 90-94 0.065 95-99 0.075 100-104 0.06999999999999999 105-109 0.075 110-114 0.075 115-119 0.075 120-124 0.075 125-129 0.075 130-134 0.075 135-139 0.075 140-144 0.075 145-149 0.075 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.79301489470981 96.175 2 0.847457627118644 1.6500000000000001 3 0.2054442732408834 0.6 4 0.07704160246533129 0.3 5 0.05136106831022085 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025680534155110426 1.0250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 41 1.0250000000000001 Illumina Single End PCR Primer 1 (97% over 34bp) CTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATG 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.2875 0.0 0.0 0.0 0.0 72-73 0.35 0.0 0.0 0.0 0.0 74-75 0.425 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.55 0.0 0.0 0.0 0.0 80-81 0.675 0.0 0.0 0.0 0.0 82-83 0.775 0.0 0.0 0.0 0.0 84-85 0.9375 0.0 0.0 0.0 0.0 86-87 1.125 0.0 0.0 0.0 0.0 88-89 1.275 0.0 0.0 0.0 0.0 90-91 1.3625 0.0 0.0 0.0 0.0 92-93 1.725 0.0 0.0 0.0 0.0 94-95 2.0 0.0 0.0 0.0 0.0 96-97 2.325 0.0 0.0 0.0 0.0 98-99 2.5875 0.0 0.0 0.0 0.0 100-101 3.0125 0.0 0.0 0.0 0.0 102-103 3.6375 0.0 0.0 0.0 0.0 104-105 4.0375 0.0 0.0 0.0 0.0 106-107 4.65 0.0 0.0 0.0 0.0 108-109 5.2125 0.0 0.0 0.0 0.0 110-111 5.8 0.0 0.0 0.0 0.0 112-113 6.3125 0.0 0.0 0.0 0.0 114-115 6.675 0.0 0.0 0.0 0.0 116-117 7.25 0.0 0.0 0.0 0.0 118-119 7.825 0.0 0.0 0.0 0.0 120-121 8.45 0.0 0.0 0.0 0.0 122-123 9.125 0.0 0.0 0.0 0.0 124-125 9.9 0.0 0.0 0.0 0.0 126-127 10.75 0.0 0.0 0.0 0.0 128-129 11.425 0.0 0.0 0.0 0.0 130-131 12.3125 0.0 0.0 0.0 0.0 132-133 13.1125 0.0 0.0 0.0 0.0 134-135 14.0125 0.0 0.0 0.0 0.0 136-137 14.9375 0.0 0.0 0.0 0.0 138-139 15.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGAGC 10 0.006830828 145.0 6 AGTGTAG 30 0.0017973486 72.5 145 >>END_MODULE Read 722529 spots for SRR7170875.sra Written 722529 spots for SRR7170875.sra Read 722529 spots for SRR7170875.sra Written 722529 spots for SRR7170875.sra Read 722529 spots for SRR7170875.sra Written 722529 spots for SRR7170875.sra Read 722529 spots for SRR7170875.sra Written 722529 spots for SRR7170875.sra Read 722529 spots for SRR7170875.sra Written 722529 spots for SRR7170875.sra Read 722529 spots for SRR7170875.sra Written 722529 spots for SRR7170875.sra Read 722529 spots for SRR7170875.sra Written 722529 spots for SRR7170875.sra Read 722529 spots for SRR7170875.sra Written 722529 spots for SRR7170875.sra Read 722529 spots for SRR7170875.sra Written 722529 spots for SRR7170875.sra Read 722529 spots for SRR7170875.sra Written 722529 spots for SRR7170875.sra Read 722529 spots for SRR7170875.sra Written 722529 spots for SRR7170875.sra Read 722529 spots for SRR7170875.sra Written 722529 spots for SRR7170875.sra Read 722529 spots for SRR7170875.sra Written 722529 spots for SRR7170875.sra Read 722529 spots for SRR7170875.sra Written 722529 spots for SRR7170875.sra Read 722529 spots for SRR7170875.sra Written 722529 spots for SRR7170875.sra Read 722529 spots for SRR7170875.sra Written 722529 spots for SRR7170875.sra Read 722529 spots for SRR7170875.sra Written 722529 spots for SRR7170875.sra Read 722529 spots for SRR7170875.sra Written 722529 spots for SRR7170875.sra Read 722545 spots for SRR7170875.sra Written 722545 spots for SRR7170875.sra Read 722529 spots for SRR7170875.sra Written 722529 spots for SRR7170875.sra SRR ids: ['SRR7170875.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7gh5mxq0 SRR7170875.sra spots: 14450596 blocks: [[1, 722529], [722530, 1445058], [1445059, 2167587], [2167588, 2890116], [2890117, 3612645], [3612646, 4335174], [4335175, 5057703], [5057704, 5780232], [5780233, 6502761], [6502762, 7225290], [7225291, 7947819], [7947820, 8670348], [8670349, 9392877], [9392878, 10115406], [10115407, 10837935], [10837936, 11560464], [11560465, 12282993], [12282994, 13005522], [13005523, 13728051], [13728052, 14450596]] SRR7170875 file size 4875132 SRR7170875 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170875 SRR7170875_1.fastq SRR7170875_2.fastq Input file: SRR7170875_1.fastq Paired file: SRR7170875_2.fastq trimmed: SRR7170875-trimmed-pair1.fastq, SRR7170875-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:48:00 2025 >> started Thu Feb 13 20:48:16 2025 >> done (15.835s) 14450596 read pairs processed; of these: 21370 ( 0.15%) short read pairs filtered out after trimming by size control 206296 ( 1.43%) empty read pairs filtered out after trimming by size control 14222930 (98.42%) read pairs available; of these: 10237742 (71.98%) trimmed read pairs available after processing 3985188 (28.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 22 0.00% 20 20 0.00% 21 21 0.00% 22 11 0.00% 23 27 0.00% 24 22 0.00% 25 23 0.00% 26 30 0.00% 27 41 0.00% 28 46 0.00% 29 28 0.00% 30 47 0.00% 31 52 0.00% 32 37 0.00% 33 48 0.00% 34 60 0.00% 35 60 0.00% 36 64 0.00% 37 77 0.00% 38 125 0.00% 39 133 0.00% 40 220 0.00% 41 200 0.00% 42 169 0.00% 43 213 0.00% 44 186 0.00% 45 256 0.00% 46 286 0.00% 47 332 0.00% 48 334 0.00% 49 479 0.00% 50 508 0.00% 51 582 0.00% 52 664 0.00% 53 729 0.01% 54 721 0.01% 55 773 0.01% 56 798 0.01% 57 980 0.01% 58 999 0.01% 59 1265 0.01% 60 1506 0.01% 61 1587 0.01% 62 1885 0.01% 63 2077 0.01% 64 2282 0.02% 65 2260 0.02% 66 2417 0.02% 67 2608 0.02% 68 2911 0.02% 69 3419 0.02% 70 3813 0.03% 71 4531 0.03% 72 5592 0.04% 73 6084 0.04% 74 6947 0.05% 75 8455 0.06% 76 16615 0.12% 77 13784 0.10% 78 8885 0.06% 79 9200 0.06% 80 9961 0.07% 81 11249 0.08% 82 12615 0.09% 83 14229 0.10% 84 16300 0.11% 85 16901 0.12% 86 17327 0.12% 87 17893 0.13% 88 18582 0.13% 89 19607 0.14% 90 20686 0.15% 91 22851 0.16% 92 24647 0.17% 93 27018 0.19% 94 29044 0.20% 95 30191 0.21% 96 30250 0.21% 97 30873 0.22% 98 31002 0.22% 99 31901 0.22% 100 33536 0.24% 101 35127 0.25% 102 37894 0.27% 103 40218 0.28% 104 41579 0.29% 105 43601 0.31% 106 44287 0.31% 107 44255 0.31% 108 44836 0.32% 109 45306 0.32% 110 45751 0.32% 111 47806 0.34% 112 50175 0.35% 113 52064 0.37% 114 54567 0.38% 115 57265 0.40% 116 57611 0.41% 117 58508 0.41% 118 58898 0.41% 119 59140 0.42% 120 60374 0.42% 121 62318 0.44% 122 63833 0.45% 123 67197 0.47% 124 70454 0.50% 125 73112 0.51% 126 75414 0.53% 127 76675 0.54% 128 78504 0.55% 129 80892 0.57% 130 82526 0.58% 131 85033 0.60% 132 88919 0.63% 133 93990 0.66% 134 100372 0.71% 135 106981 0.75% 136 112439 0.79% 137 118487 0.83% 138 124769 0.88% 139 132457 0.93% 140 141541 1.00% 141 150626 1.06% 142 166062 1.17% 143 187612 1.32% 144 215906 1.52% 145 255900 1.80% 146 319069 2.24% 147 419086 2.95% 148 612019 4.30% 149 1110568 7.81% 150 3400490 23.91% 151 3985188 28.02% 14222930 reads passed initial QC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=17 prefix-density=0.80 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=102.70 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=11.0 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACAT criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=21 prefix-density=0.79 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=12.19 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT SRR7170875 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:48:57 Started mapping on | Feb 13 20:48:57 Finished on | Feb 13 20:50:13 Mapping speed, Million of reads per hour | 673.72 Number of input reads | 14222930 Average input read length | 284 UNIQUE READS: Uniquely mapped reads number | 13591219 Uniquely mapped reads % | 95.56% Average mapped length | 283.47 Number of splices: Total | 11870946 Number of splices: Annotated (sjdb) | 11591890 Number of splices: GT/AG | 11637999 Number of splices: GC/AG | 183291 Number of splices: AT/AC | 7948 Number of splices: Non-canonical | 41708 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 1.99 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 360397 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 20713 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.73% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 285348 285348 285348 N_multimapping 360397 360397 360397 N_noFeature 499702 13273909 626825 N_ambiguous 288197 1021 97406 UnstrandedReadsAssigned:12803320 PositiveStrandReadsAssigned:316289 NegativeStrandReadsAssigned:12866988 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=135 echo kmer=131 SRR7170875 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170875-trimmed-pair1.fastq SRR7170875-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,222,930 reads, 12,882,738 reads pseudoaligned [quant] estimated average fragment length: 210.704 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,020 rounds 52401 SRR7170875.ke.tsv 34699 SRR7170875.se.tsv 87100 total ==> SRR7170875.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1808.3 437 14.8432 Potri.005G024800.1.v4.1 1035 825.296 198 14.7357 Potri.004G059700.1.v4.1 961 751.302 8 0.654021 Potri.007G009000.2.v4.1 1416 1206.3 0 0 Potri.003G141000.2.v4.1 2943 2733.3 450 10.1121 Potri.016G087400.1.v4.1 270 99.6527 1059 652.714 Potri.015G069301.1.v4.1 564 357.673 0 0 Potri.010G195200.1.v4.1 1773 1563.3 20 0.785787 Potri.012G127500.1.v4.1 977 767.296 176 14.0885 ==> SRR7170875.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 802 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 340 Potri.001G212900.v4.1 117 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170875 completed mapping pipeline successfully