Starting /dee2/code/volunteer_pipeline.sh SRR7170876 current disk space = 3088055427072 free memory = 1464743740 SRR7170876 SRAfilesize 0104cbf41667294ba02129ec33437f28 SRR7170876.sra SRR7170876.sra file validated SRR7170876 is paired end SRR7170876 is conventional basespace SRR7170876 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170876_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.31975 34.0 33.0 34.0 32.0 34.0 2 33.134 34.0 33.0 34.0 32.0 34.0 3 33.1195 34.0 33.0 34.0 32.0 34.0 4 33.114 34.0 33.0 34.0 31.0 34.0 5 33.2535 34.0 33.0 34.0 32.0 34.0 6 36.7695 38.0 37.0 38.0 34.0 38.0 7 37.146 38.0 38.0 38.0 36.0 38.0 8 37.26025 38.0 38.0 38.0 36.0 38.0 9 37.39125 38.0 38.0 38.0 37.0 38.0 10-14 37.36415 38.0 38.0 38.0 37.0 38.0 15-19 37.3099 38.0 38.0 38.0 36.8 38.0 20-24 37.199349999999995 38.0 38.0 38.0 36.2 38.0 25-29 37.2793 38.0 38.0 38.0 36.6 38.0 30-34 37.124900000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.9941 38.0 38.0 38.0 36.0 38.0 40-44 37.03895 38.0 38.0 38.0 36.0 38.0 45-49 36.910199999999996 38.0 38.0 38.0 35.6 38.0 50-54 36.730000000000004 38.0 38.0 38.0 34.6 38.0 55-59 36.578649999999996 38.0 38.0 38.0 34.0 38.0 60-64 36.4397 38.0 37.8 38.0 33.8 38.0 65-69 36.40175000000001 38.0 37.6 38.0 33.6 38.0 70-74 36.40405 38.0 37.4 38.0 34.0 38.0 75-79 36.3347 38.0 37.2 38.0 33.6 38.0 80-84 36.03415 38.0 37.0 38.0 32.8 38.0 85-89 35.9759 38.0 37.0 38.0 33.0 38.0 90-94 35.78959999999999 38.0 37.0 38.0 31.4 38.0 95-99 35.551750000000006 38.0 36.0 38.0 30.4 38.0 100-104 34.978449999999995 38.0 35.8 38.0 28.0 38.0 105-109 34.5304 38.0 34.4 38.0 24.6 38.0 110-114 34.0298 38.0 33.8 38.0 23.4 38.0 115-119 33.7164 38.0 33.2 38.0 20.4 38.0 120-124 33.377500000000005 38.0 33.0 38.0 18.6 38.0 125-129 32.357 37.2 31.4 38.0 14.4 38.0 130-134 31.621799999999997 37.0 29.8 38.0 13.6 38.0 135-139 30.710500000000003 36.0 28.0 38.0 12.8 38.0 140-144 30.151599999999995 36.0 28.0 38.0 9.6 38.0 145-149 28.111700000000003 34.2 21.2 38.0 2.0 38.0 150-151 21.223125 25.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 3.0 16 5.0 17 5.0 18 5.0 19 14.0 20 13.0 21 6.0 22 21.0 23 23.0 24 20.0 25 38.0 26 36.0 27 36.0 28 51.0 29 73.0 30 80.0 31 120.0 32 163.0 33 202.0 34 333.0 35 533.0 36 1187.0 37 1031.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.50991501416431 14.75663147051249 9.889260880762297 34.844192634560905 2 20.974999999999998 19.575 35.625 23.825 3 18.377566349524287 26.589884827240862 27.891837756634953 27.1407110665999 4 20.8 34.475 23.400000000000002 21.325 5 20.325 36.825 24.05 18.8 6 17.45 37.15 27.675 17.724999999999998 7 13.65 22.575 45.375 18.4 8 17.7 22.575 32.15 27.575 9 17.474999999999998 24.575 32.525 25.424999999999997 10-14 19.64 30.159999999999997 26.71 23.49 15-19 19.755 28.975 28.16 23.11 20-24 19.96 29.335 27.894999999999996 22.81 25-29 19.305 28.804999999999996 28.384999999999998 23.505000000000003 30-34 19.475 29.7 27.655 23.169999999999998 35-39 19.685 29.165000000000003 27.400000000000002 23.75 40-44 19.53 29.73 27.33 23.41 45-49 19.37 29.32 27.445000000000004 23.865 50-54 19.470000000000002 29.475 27.52 23.535 55-59 20.215 28.415000000000003 27.860000000000003 23.51 60-64 19.625 28.849999999999998 27.665 23.86 65-69 20.115 28.970000000000002 27.560000000000002 23.355 70-74 19.634999999999998 29.13 28.060000000000002 23.175 75-79 20.165 29.494999999999997 27.67 22.67 80-84 19.830000000000002 28.965000000000003 27.66 23.544999999999998 85-89 20.095 29.195 27.355 23.355 90-94 19.615 29.145 27.36 23.880000000000003 95-99 19.994999999999997 28.025 28.225 23.755000000000003 100-104 20.96 28.28 27.525 23.235 105-109 20.93 28.96 26.875 23.235 110-114 20.7 28.765 27.474999999999998 23.06 115-119 21.16 28.904999999999998 27.055 22.88 120-124 20.375 29.060000000000002 27.065 23.5 125-129 20.794999999999998 29.265 26.450000000000003 23.49 130-134 21.065 29.110000000000003 25.990000000000002 23.835 135-139 20.435 29.38 26.68 23.505000000000003 140-144 19.950000000000003 28.299999999999997 27.544999999999998 24.205 145-149 20.34 28.884999999999998 26.634999999999998 24.14 150-151 19.85 28.449999999999996 27.5875 24.1125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 1.0 19 1.0 20 3.0 21 3.0 22 2.0 23 4.0 24 3.5 25 4.5 26 8.5 27 9.0 28 13.5 29 21.0 30 26.0 31 36.5 32 48.0 33 51.0 34 62.5 35 86.5 36 103.0 37 120.5 38 156.0 39 197.5 40 197.5 41 216.5 42 234.5 43 248.5 44 276.0 45 276.5 46 262.5 47 222.5 48 198.0 49 179.0 50 162.0 51 126.0 52 88.5 53 80.0 54 68.0 55 54.5 56 43.5 57 37.0 58 26.0 59 14.5 60 7.5 61 4.5 62 5.5 63 3.5 64 1.5 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9250000000000003 2 0.0 3 0.15 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24184988627748 98.175 2 0.6065200909780136 1.2 3 0.0758150113722517 0.22499999999999998 4 0.050543340914834464 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025271670457417232 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 8 0.2 TruSeq Adapter, Index 27 (97% over 39bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.7125 0.0 0.0 0.0 0.0 84-85 0.85 0.0 0.0 0.0 0.0 86-87 0.9875 0.0 0.0 0.0 0.0 88-89 1.0625 0.0 0.0 0.0 0.0 90-91 1.275 0.0 0.0 0.0 0.0 92-93 1.4625 0.0 0.0 0.0 0.0 94-95 1.75 0.0 0.0 0.0 0.0 96-97 2.0125 0.0 0.0 0.0 0.0 98-99 2.2375 0.0 0.0 0.0 0.0 100-101 2.55 0.0 0.0 0.0 0.0 102-103 2.9124999999999996 0.0 0.0 0.0 0.0 104-105 3.325 0.0 0.0 0.0 0.0 106-107 3.775 0.0 0.0 0.0 0.0 108-109 4.3125 0.0 0.0 0.0 0.0 110-111 4.925000000000001 0.0 0.0 0.0 0.0 112-113 5.550000000000001 0.0 0.0 0.0 0.0 114-115 6.05 0.0 0.0 0.0 0.0 116-117 6.5375 0.0 0.0 0.0 0.0 118-119 7.25 0.0 0.0 0.0 0.0 120-121 7.7 0.0 0.0 0.0 0.0 122-123 8.2625 0.0 0.0 0.0 0.0 124-125 8.7875 0.0 0.0 0.0 0.0 126-127 9.45 0.0 0.0 0.0 0.0 128-129 10.325 0.0 0.0 0.0 0.0 130-131 10.925 0.0 0.0 0.0 0.0 132-133 11.4875 0.0 0.0 0.0 0.0 134-135 12.25 0.0 0.0 0.0 0.0 136-137 13.125 0.0 0.0 0.0 0.0 138-139 13.787500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCAGCT 10 0.0060887975 150.61038 1 CCAGCTT 10 0.006836113 144.9625 2 TCAGAAC 10 0.006836113 144.9625 2 >>END_MODULE SRR7170876 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170876_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96125 33.0 33.0 34.0 32.0 34.0 2 32.946 33.0 33.0 34.0 32.0 34.0 3 33.004 34.0 33.0 34.0 32.0 34.0 4 33.00125 34.0 33.0 34.0 32.0 34.0 5 33.0465 34.0 33.0 34.0 32.0 34.0 6 37.26425 38.0 38.0 38.0 37.0 38.0 7 37.13275 38.0 38.0 38.0 37.0 38.0 8 37.191 38.0 38.0 38.0 37.0 38.0 9 37.18325 38.0 38.0 38.0 37.0 38.0 10-14 37.1243 38.0 38.0 38.0 37.0 38.0 15-19 37.1188 38.0 38.0 38.0 37.0 38.0 20-24 37.0759 38.0 38.0 38.0 37.0 38.0 25-29 37.00419999999999 38.0 38.0 38.0 37.0 38.0 30-34 36.964800000000004 38.0 38.0 38.0 36.2 38.0 35-39 36.982200000000006 38.0 38.0 38.0 36.2 38.0 40-44 37.052350000000004 38.0 38.0 38.0 36.8 38.0 45-49 37.000600000000006 38.0 38.0 38.0 36.8 38.0 50-54 36.95945 38.0 38.0 38.0 36.6 38.0 55-59 36.8602 38.0 38.0 38.0 36.0 38.0 60-64 36.83364999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.7734 38.0 38.0 38.0 35.8 38.0 70-74 36.6442 38.0 38.0 38.0 35.0 38.0 75-79 36.596799999999995 38.0 38.0 38.0 34.8 38.0 80-84 36.4189 38.0 38.0 38.0 34.6 38.0 85-89 36.36905 38.0 38.0 38.0 34.2 38.0 90-94 36.226549999999996 38.0 38.0 38.0 34.0 38.0 95-99 35.96595 38.0 38.0 38.0 33.4 38.0 100-104 35.932550000000006 38.0 37.8 38.0 33.6 38.0 105-109 35.769800000000004 38.0 37.0 38.0 33.0 38.0 110-114 35.510149999999996 38.0 37.0 38.0 30.6 38.0 115-119 35.2816 38.0 36.8 38.0 29.2 38.0 120-124 34.91055 38.0 36.2 38.0 27.8 38.0 125-129 34.397000000000006 38.0 35.0 38.0 24.2 38.0 130-134 33.971050000000005 38.0 33.8 38.0 23.0 38.0 135-139 33.55165 38.0 33.0 38.0 21.6 38.0 140-144 32.570449999999994 38.0 33.0 38.0 14.2 38.0 145-149 31.4844 38.0 32.2 38.0 8.4 38.0 150-151 25.799625 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 5.0 4 4.0 5 5.0 6 0.0 7 3.0 8 3.0 9 1.0 10 0.0 11 3.0 12 4.0 13 3.0 14 1.0 15 5.0 16 2.0 17 7.0 18 5.0 19 4.0 20 10.0 21 5.0 22 10.0 23 9.0 24 21.0 25 17.0 26 28.0 27 30.0 28 27.0 29 45.0 30 56.0 31 71.0 32 95.0 33 111.0 34 129.0 35 298.0 36 720.0 37 2258.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.05 20.599999999999998 13.125 25.224999999999998 2 26.025 24.925 32.824999999999996 16.225 3 20.375 27.500000000000004 32.875 19.25 4 23.150000000000002 35.6 22.45 18.8 5 25.5 36.75 21.099999999999998 16.650000000000002 6 20.275000000000002 37.974999999999994 23.599999999999998 18.15 7 18.375 20.5 41.275 19.85 8 20.825 25.25 28.249999999999996 25.674999999999997 9 23.125 23.400000000000002 30.25 23.225 10-14 23.485 28.49 26.784999999999997 21.240000000000002 15-19 23.01 27.55 29.12 20.32 20-24 22.775000000000002 28.605000000000004 28.155 20.465 25-29 23.165 27.515 29.18 20.14 30-34 22.884999999999998 27.805000000000003 28.405 20.905 35-39 22.785 28.605000000000004 28.32 20.29 40-44 22.955000000000002 28.53 27.944999999999997 20.57 45-49 23.380000000000003 28.395 28.155 20.07 50-54 22.845 27.839999999999996 28.285 21.029999999999998 55-59 22.965 27.825 28.515 20.695 60-64 23.005 27.18 28.599999999999998 21.215 65-69 23.185 28.07 28.125 20.62 70-74 22.935 28.065 28.04 20.96 75-79 23.119999999999997 28.694999999999997 27.779999999999998 20.405 80-84 23.015 27.98 28.515 20.49 85-89 23.849999999999998 27.72 27.865000000000002 20.565 90-94 22.955000000000002 28.244999999999997 28.189999999999998 20.61 95-99 23.625 27.435 28.4 20.54 100-104 24.26 28.244999999999997 27.375 20.119999999999997 105-109 24.279999999999998 27.51 28.18 20.03 110-114 24.709999999999997 28.225 27.51 19.555 115-119 24.19 28.785 27.525 19.5 120-124 24.52 28.09 27.595 19.794999999999998 125-129 25.03 28.125 27.22 19.625 130-134 25.330000000000002 27.98 27.87 18.82 135-139 25.845000000000002 27.889999999999997 27.965 18.3 140-144 25.374999999999996 28.060000000000002 27.700000000000003 18.865000000000002 145-149 25.69 28.810000000000002 27.52 17.98 150-151 25.025 27.9125 28.3875 18.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.5 14 1.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 3.5 21 3.0 22 1.0 23 1.0 24 4.0 25 5.0 26 6.5 27 10.5 28 12.0 29 17.5 30 20.0 31 22.5 32 32.5 33 41.5 34 50.5 35 65.5 36 80.5 37 112.5 38 137.5 39 155.0 40 187.5 41 224.5 42 258.0 43 276.5 44 282.0 45 285.0 46 264.5 47 243.0 48 226.0 49 192.0 50 170.5 51 145.0 52 114.5 53 84.5 54 68.5 55 54.0 56 36.0 57 27.5 58 21.5 59 18.0 60 14.0 61 9.0 62 4.5 63 2.0 64 1.0 65 1.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29006085192698 97.89999999999999 2 0.43103448275862066 0.8500000000000001 3 0.15212981744421905 0.44999999999999996 4 0.02535496957403651 0.1 5 0.05070993914807302 0.25 6 0.0 0.0 7 0.0 0.0 8 0.02535496957403651 0.2 9 0.0 0.0 >10 0.02535496957403651 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 10 0.25 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (96% over 32bp) CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.6625 0.0 0.0 0.0 0.0 84-85 0.8 0.0 0.0 0.0 0.0 86-87 0.9375 0.0 0.0 0.0 0.0 88-89 0.9875 0.0 0.0 0.0 0.0 90-91 1.2 0.0 0.0 0.0 0.0 92-93 1.4 0.0 0.0 0.0 0.0 94-95 1.7125 0.0 0.0 0.0 0.0 96-97 1.9625 0.0 0.0 0.0 0.0 98-99 2.2125 0.0 0.0 0.0 0.0 100-101 2.5625 0.0 0.0 0.0 0.0 102-103 2.9625000000000004 0.0 0.0 0.0 0.0 104-105 3.375 0.0 0.0 0.0 0.0 106-107 3.8375000000000004 0.0 0.0 0.0 0.0 108-109 4.4125 0.0 0.0 0.0 0.0 110-111 5.050000000000001 0.0 0.0 0.0 0.0 112-113 5.75 0.0 0.0 0.0 0.0 114-115 6.2375 0.0 0.0 0.0 0.0 116-117 6.6875 0.0 0.0 0.0 0.0 118-119 7.4375 0.0 0.0 0.0 0.0 120-121 7.9 0.0 0.0 0.0 0.0 122-123 8.475 0.0 0.0 0.0 0.0 124-125 9.05 0.0 0.0 0.0 0.0 126-127 9.6875 0.0 0.0 0.0 0.0 128-129 10.5375 0.0 0.0 0.0 0.0 130-131 11.1375 0.0 0.0 0.0 0.0 132-133 11.7 0.0 0.0 0.0 0.0 134-135 12.462499999999999 0.0 0.0 0.0 0.0 136-137 13.3375 0.0 0.0 0.0 0.0 138-139 14.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTGAA 10 0.006830828 145.0 9 >>END_MODULE Read 698723 spots for SRR7170876.sra Written 698723 spots for SRR7170876.sra Read 698723 spots for SRR7170876.sra Written 698723 spots for SRR7170876.sra Read 698723 spots for SRR7170876.sra Written 698723 spots for SRR7170876.sra Read 698723 spots for SRR7170876.sra Written 698723 spots for SRR7170876.sra Read 698723 spots for SRR7170876.sra Written 698723 spots for SRR7170876.sra Read 698723 spots for SRR7170876.sra Written 698723 spots for SRR7170876.sra Read 698723 spots for SRR7170876.sra Written 698723 spots for SRR7170876.sra Read 698723 spots for SRR7170876.sra Written 698723 spots for SRR7170876.sra Read 698723 spots for SRR7170876.sra Written 698723 spots for SRR7170876.sra Read 698723 spots for SRR7170876.sra Written 698723 spots for SRR7170876.sra Read 698723 spots for SRR7170876.sra Written 698723 spots for SRR7170876.sra Read 698723 spots for SRR7170876.sra Written 698723 spots for SRR7170876.sra Read 698723 spots for SRR7170876.sra Written 698723 spots for SRR7170876.sra Read 698723 spots for SRR7170876.sra Written 698723 spots for SRR7170876.sra Read 698723 spots for SRR7170876.sra Written 698723 spots for SRR7170876.sra Read 698723 spots for SRR7170876.sra Written 698723 spots for SRR7170876.sra Read 698723 spots for SRR7170876.sra Written 698723 spots for SRR7170876.sra Read 698723 spots for SRR7170876.sra Written 698723 spots for SRR7170876.sra Read 698723 spots for SRR7170876.sra Written 698723 spots for SRR7170876.sra Read 698724 spots for SRR7170876.sra Written 698724 spots for SRR7170876.sra SRR ids: ['SRR7170876.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vlhi7sli SRR7170876.sra spots: 13974461 blocks: [[1, 698723], [698724, 1397446], [1397447, 2096169], [2096170, 2794892], [2794893, 3493615], [3493616, 4192338], [4192339, 4891061], [4891062, 5589784], [5589785, 6288507], [6288508, 6987230], [6987231, 7685953], [7685954, 8384676], [8384677, 9083399], [9083400, 9782122], [9782123, 10480845], [10480846, 11179568], [11179569, 11878291], [11878292, 12577014], [12577015, 13275737], [13275738, 13974461]] SRR7170876 file size 4713785 SRR7170876 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170876 SRR7170876_1.fastq SRR7170876_2.fastq Input file: SRR7170876_1.fastq Paired file: SRR7170876_2.fastq trimmed: SRR7170876-trimmed-pair1.fastq, SRR7170876-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:59:31 2025 >> started Thu Feb 13 20:59:47 2025 >> done (15.862s) 13974461 read pairs processed; of these: 18622 ( 0.13%) short read pairs filtered out after trimming by size control 47646 ( 0.34%) empty read pairs filtered out after trimming by size control 13908193 (99.53%) read pairs available; of these: 10232020 (73.57%) trimmed read pairs available after processing 3676173 (26.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 14 0.00% 20 7 0.00% 21 13 0.00% 22 12 0.00% 23 8 0.00% 24 11 0.00% 25 17 0.00% 26 20 0.00% 27 11 0.00% 28 16 0.00% 29 29 0.00% 30 25 0.00% 31 31 0.00% 32 33 0.00% 33 42 0.00% 34 36 0.00% 35 41 0.00% 36 64 0.00% 37 74 0.00% 38 75 0.00% 39 108 0.00% 40 85 0.00% 41 129 0.00% 42 152 0.00% 43 154 0.00% 44 159 0.00% 45 187 0.00% 46 207 0.00% 47 219 0.00% 48 293 0.00% 49 312 0.00% 50 375 0.00% 51 438 0.00% 52 497 0.00% 53 495 0.00% 54 558 0.00% 55 527 0.00% 56 617 0.00% 57 691 0.00% 58 818 0.01% 59 910 0.01% 60 1063 0.01% 61 1226 0.01% 62 1480 0.01% 63 1519 0.01% 64 1534 0.01% 65 1629 0.01% 66 1855 0.01% 67 1953 0.01% 68 2129 0.02% 69 2374 0.02% 70 2897 0.02% 71 3324 0.02% 72 3905 0.03% 73 4342 0.03% 74 4830 0.03% 75 5699 0.04% 76 9380 0.07% 77 10210 0.07% 78 7261 0.05% 79 7106 0.05% 80 7935 0.06% 81 9051 0.07% 82 9900 0.07% 83 10831 0.08% 84 12408 0.09% 85 13069 0.09% 86 13465 0.10% 87 14377 0.10% 88 14921 0.11% 89 15817 0.11% 90 16706 0.12% 91 18330 0.13% 92 19821 0.14% 93 21775 0.16% 94 23006 0.17% 95 24220 0.17% 96 24491 0.18% 97 25555 0.18% 98 25817 0.19% 99 26815 0.19% 100 28601 0.21% 101 29653 0.21% 102 31882 0.23% 103 33711 0.24% 104 35243 0.25% 105 36547 0.26% 106 37713 0.27% 107 38207 0.27% 108 38848 0.28% 109 39554 0.28% 110 40523 0.29% 111 42316 0.30% 112 44560 0.32% 113 46366 0.33% 114 48651 0.35% 115 50203 0.36% 116 51450 0.37% 117 52869 0.38% 118 53345 0.38% 119 54039 0.39% 120 55209 0.40% 121 57652 0.41% 122 59419 0.43% 123 62645 0.45% 124 65534 0.47% 125 67822 0.49% 126 70624 0.51% 127 72419 0.52% 128 74543 0.54% 129 77754 0.56% 130 80330 0.58% 131 82494 0.59% 132 87878 0.63% 133 93356 0.67% 134 99096 0.71% 135 107001 0.77% 136 113269 0.81% 137 121860 0.88% 138 130539 0.94% 139 140386 1.01% 140 151996 1.09% 141 165370 1.19% 142 183826 1.32% 143 208298 1.50% 144 242623 1.74% 145 287431 2.07% 146 352928 2.54% 147 464679 3.34% 148 669279 4.81% 149 1176772 8.46% 150 3342159 24.03% 151 3676173 26.43% 13908193 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=22 prefix-density=0.42 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=26.93 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=7.6 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=1.10 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=22 prefix-density=1.09 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=31.75 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.9 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7170876 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:00:34 Started mapping on | Feb 13 21:00:35 Finished on | Feb 13 21:02:00 Mapping speed, Million of reads per hour | 589.05 Number of input reads | 13908193 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 13192204 Uniquely mapped reads % | 94.85% Average mapped length | 284.69 Number of splices: Total | 12277271 Number of splices: Annotated (sjdb) | 11981123 Number of splices: GT/AG | 12044320 Number of splices: GC/AG | 186454 Number of splices: AT/AC | 8073 Number of splices: Non-canonical | 38424 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 355361 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 19669 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.39% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 374543 374543 374543 N_multimapping 355361 355361 355361 N_noFeature 547211 12903710 677990 N_ambiguous 244571 1010 86273 UnstrandedReadsAssigned:12400422 PositiveStrandReadsAssigned:287484 NegativeStrandReadsAssigned:12427941 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=137 echo kmer=133 SRR7170876 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170876-trimmed-pair1.fastq SRR7170876-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,908,193 reads, 12,368,646 reads pseudoaligned [quant] estimated average fragment length: 220.519 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,196 rounds 52401 SRR7170876.ke.tsv 34699 SRR7170876.se.tsv 87100 total ==> SRR7170876.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798.48 1240.67 48.5329 Potri.005G024800.1.v4.1 1035 815.481 493 42.5323 Potri.004G059700.1.v4.1 961 741.525 17 1.61291 Potri.007G009000.2.v4.1 1416 1196.48 0 0 Potri.003G141000.2.v4.1 2943 2723.48 662.394 17.1111 Potri.016G087400.1.v4.1 270 97.0268 847 614.155 Potri.015G069301.1.v4.1 564 349.914 0 0 Potri.010G195200.1.v4.1 1773 1553.48 251.984 11.4118 Potri.012G127500.1.v4.1 977 757.501 65 6.03693 ==> SRR7170876.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 450 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 368 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 104 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7170876 completed mapping pipeline successfully