Starting /dee2/code/volunteer_pipeline.sh SRR7170877 current disk space = 3088445235200 free memory = 1582334044 SRR7170877 SRAfilesize 392496e1f89bdb4ab72ecd466efb4176 SRR7170877.sra SRR7170877.sra file validated SRR7170877 is paired end SRR7170877 is conventional basespace SRR7170877 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170877_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.518 34.0 33.0 34.0 32.0 34.0 2 33.27975 34.0 33.0 34.0 32.0 34.0 3 33.24375 34.0 33.0 34.0 31.0 34.0 4 33.31475 34.0 33.0 34.0 33.0 34.0 5 33.272 34.0 33.0 34.0 33.0 34.0 6 36.8305 38.0 37.0 38.0 35.0 38.0 7 37.25975 38.0 38.0 38.0 36.0 38.0 8 37.4055 38.0 38.0 38.0 37.0 38.0 9 37.45725 38.0 38.0 38.0 37.0 38.0 10-14 37.4789 38.0 38.0 38.0 37.0 38.0 15-19 37.366200000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.3369 38.0 38.0 38.0 37.0 38.0 25-29 37.263099999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.2252 38.0 38.0 38.0 36.8 38.0 35-39 37.1657 38.0 38.0 38.0 36.4 38.0 40-44 37.071799999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.972449999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.883449999999996 38.0 38.0 38.0 35.8 38.0 55-59 36.873000000000005 38.0 38.0 38.0 35.6 38.0 60-64 36.86675 38.0 38.0 38.0 35.6 38.0 65-69 36.75625 38.0 38.0 38.0 34.8 38.0 70-74 36.65365 38.0 38.0 38.0 34.6 38.0 75-79 36.3097 38.0 38.0 38.0 34.0 38.0 80-84 36.228899999999996 38.0 38.0 38.0 33.8 38.0 85-89 36.178399999999996 38.0 37.8 38.0 33.8 38.0 90-94 36.0685 38.0 37.6 38.0 33.8 38.0 95-99 36.00565 38.0 37.2 38.0 33.4 38.0 100-104 35.655199999999994 38.0 37.0 38.0 31.2 38.0 105-109 35.5603 38.0 37.0 38.0 31.0 38.0 110-114 35.3701 38.0 36.6 38.0 30.0 38.0 115-119 35.06474999999999 38.0 36.0 38.0 28.0 38.0 120-124 34.6075 38.0 35.0 38.0 26.4 38.0 125-129 34.4797 38.0 34.8 38.0 25.0 38.0 130-134 34.05315 38.0 34.2 38.0 23.4 38.0 135-139 33.7972 38.0 33.6 38.0 22.6 38.0 140-144 33.13629999999999 38.0 33.2 38.0 19.0 38.0 145-149 32.0558 37.8 31.8 38.0 10.8 38.0 150-151 26.909375 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 3.0 8 1.0 9 2.0 10 3.0 11 1.0 12 1.0 13 0.0 14 1.0 15 2.0 16 7.0 17 8.0 18 7.0 19 18.0 20 5.0 21 4.0 22 8.0 23 16.0 24 19.0 25 10.0 26 15.0 27 23.0 28 32.0 29 36.0 30 61.0 31 65.0 32 92.0 33 119.0 34 202.0 35 364.0 36 877.0 37 1997.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.82398353062275 16.2892434379825 10.602161605764282 29.28461142563047 2 20.474999999999998 19.55 35.099999999999994 24.875 3 19.025 26.825 30.225 23.925 4 21.05 32.800000000000004 24.925 21.224999999999998 5 21.224999999999998 36.05 24.55 18.175 6 18.075 35.8 26.174999999999997 19.950000000000003 7 14.374999999999998 23.5 43.725 18.4 8 17.275 23.674999999999997 31.55 27.500000000000004 9 18.175 24.224999999999998 31.574999999999996 26.025 10-14 20.03 29.89 26.31 23.77 15-19 19.67 28.865000000000002 28.1 23.365 20-24 20.29 28.810000000000002 27.97 22.93 25-29 19.900000000000002 28.79 27.98 23.330000000000002 30-34 19.42 29.160000000000004 27.565 23.855 35-39 19.7 28.749999999999996 27.700000000000003 23.849999999999998 40-44 19.85 29.2 27.415 23.535 45-49 19.689999999999998 28.689999999999998 27.495000000000005 24.125 50-54 19.56 28.610000000000003 28.075 23.755000000000003 55-59 20.405 28.32 27.925 23.35 60-64 20.185 28.48 27.655 23.68 65-69 20.23 28.785 27.689999999999998 23.294999999999998 70-74 20.09 29.17 27.27 23.47 75-79 19.6 28.970000000000002 27.400000000000002 24.03 80-84 20.365 29.054999999999996 27.065 23.515 85-89 20.369999999999997 28.689999999999998 27.229999999999997 23.71 90-94 20.424999999999997 28.544999999999998 27.735 23.294999999999998 95-99 20.635 28.860000000000003 27.01 23.494999999999997 100-104 21.04 28.68 26.685 23.595 105-109 21.099999999999998 27.805000000000003 27.689999999999998 23.405 110-114 21.415 28.255000000000003 26.275 24.055 115-119 20.585 29.015 26.27 24.13 120-124 20.95 28.52 26.55 23.98 125-129 20.560000000000002 28.945 25.695 24.8 130-134 21.0 29.205 25.715 24.08 135-139 20.925 28.335 26.055 24.685000000000002 140-144 21.04 28.42 25.795 24.745 145-149 20.46 28.655 26.14 24.745 150-151 21.025 29.1375 25.224999999999998 24.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 3.5 2 2.5 3 0.5 4 0.0 5 0.5 6 1.0 7 2.0 8 1.5 9 0.5 10 0.5 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 1.0 23 1.5 24 1.5 25 3.0 26 5.0 27 6.5 28 12.5 29 20.0 30 28.0 31 35.5 32 44.0 33 57.0 34 74.0 35 88.5 36 99.0 37 133.0 38 157.0 39 164.5 40 168.0 41 182.5 42 218.5 43 237.5 44 241.0 45 236.5 46 230.5 47 236.5 48 224.0 49 215.0 50 186.5 51 137.0 52 114.5 53 100.5 54 83.0 55 59.5 56 50.5 57 41.5 58 29.5 59 21.0 60 16.0 61 9.5 62 3.5 63 2.5 64 2.0 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.85 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08443540183113 97.39999999999999 2 0.686673448626653 1.35 3 0.10172939979654119 0.3 4 0.025432349949135298 0.1 5 0.025432349949135298 0.125 6 0.025432349949135298 0.15 7 0.025432349949135298 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025432349949135298 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 16 0.4 TruSeq Adapter, Index 27 (97% over 39bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 6 0.15 No Hit GCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.48750000000000004 0.0 0.0 0.0 0.0 82-83 0.6625 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.8125 0.0 0.0 0.0 0.0 88-89 0.9875 0.0 0.0 0.0 0.0 90-91 1.275 0.0 0.0 0.0 0.0 92-93 1.5125000000000002 0.0 0.0 0.0 0.0 94-95 1.6875 0.0 0.0 0.0 0.0 96-97 1.9625000000000001 0.0 0.0 0.0 0.0 98-99 2.4125 0.0 0.0 0.0 0.0 100-101 2.725 0.0 0.0 0.0 0.0 102-103 3.175 0.0 0.0 0.0 0.0 104-105 3.725 0.0 0.0 0.0 0.0 106-107 4.4 0.0 0.0 0.0 0.0 108-109 4.875 0.0 0.0 0.0 0.0 110-111 5.5 0.0 0.0 0.0 0.0 112-113 6.012499999999999 0.0 0.0 0.0 0.0 114-115 6.637499999999999 0.0 0.0 0.0 0.0 116-117 7.387499999999999 0.0 0.0 0.0 0.0 118-119 8.175 0.0 0.0 0.0 0.0 120-121 8.8375 0.0 0.0 0.0 0.0 122-123 9.65 0.0 0.0 0.0 0.0 124-125 10.4875 0.0 0.0 0.0 0.0 126-127 11.2625 0.0 0.0 0.0 0.0 128-129 12.1375 0.0 0.0 0.0 0.0 130-131 13.0 0.0 0.0 0.0 0.0 132-133 14.025 0.0 0.0 0.0 0.0 134-135 14.775 0.0 0.0 0.0 0.0 136-137 15.6 0.0 0.0 0.0 0.0 138-139 16.487499999999997 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170877 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170877_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91325 33.0 33.0 34.0 32.0 34.0 2 32.996 34.0 33.0 34.0 32.0 34.0 3 32.98425 34.0 33.0 34.0 32.0 34.0 4 32.97525 34.0 33.0 34.0 32.0 34.0 5 32.92025 34.0 33.0 34.0 32.0 34.0 6 37.01 38.0 38.0 38.0 37.0 38.0 7 36.99225 38.0 38.0 38.0 37.0 38.0 8 37.0585 38.0 38.0 38.0 37.0 38.0 9 37.01025 38.0 38.0 38.0 37.0 38.0 10-14 37.011100000000006 38.0 38.0 38.0 37.0 38.0 15-19 36.9457 38.0 38.0 38.0 36.8 38.0 20-24 36.9467 38.0 38.0 38.0 36.8 38.0 25-29 36.90005 38.0 38.0 38.0 36.6 38.0 30-34 36.83485 38.0 38.0 38.0 36.2 38.0 35-39 36.82965 38.0 38.0 38.0 36.4 38.0 40-44 36.83945 38.0 38.0 38.0 36.2 38.0 45-49 36.8158 38.0 38.0 38.0 36.0 38.0 50-54 36.864999999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.757250000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.682 38.0 38.0 38.0 36.0 38.0 65-69 36.6785 38.0 38.0 38.0 35.8 38.0 70-74 36.632099999999994 38.0 38.0 38.0 35.8 38.0 75-79 36.5262 38.0 38.0 38.0 35.2 38.0 80-84 36.2543 38.0 38.0 38.0 34.2 38.0 85-89 36.2105 38.0 38.0 38.0 34.0 38.0 90-94 36.1549 38.0 38.0 38.0 34.0 38.0 95-99 36.08055 38.0 38.0 38.0 34.0 38.0 100-104 35.89885 38.0 38.0 38.0 33.6 38.0 105-109 35.7911 38.0 38.0 38.0 33.0 38.0 110-114 35.3858 38.0 37.0 38.0 30.2 38.0 115-119 35.209649999999996 38.0 37.0 38.0 29.4 38.0 120-124 34.82245 38.0 36.2 38.0 28.2 38.0 125-129 34.4796 38.0 35.8 38.0 25.2 38.0 130-134 34.268950000000004 38.0 35.2 38.0 24.2 38.0 135-139 33.44325 38.0 34.0 38.0 18.6 38.0 140-144 33.09445 38.0 33.0 38.0 17.0 38.0 145-149 32.29965 38.0 33.0 38.0 10.8 38.0 150-151 27.04675 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 5.0 4 5.0 5 3.0 6 5.0 7 6.0 8 0.0 9 3.0 10 2.0 11 2.0 12 5.0 13 4.0 14 4.0 15 2.0 16 4.0 17 4.0 18 8.0 19 4.0 20 24.0 21 12.0 22 11.0 23 16.0 24 17.0 25 13.0 26 24.0 27 23.0 28 32.0 29 36.0 30 36.0 31 52.0 32 67.0 33 97.0 34 146.0 35 254.0 36 617.0 37 2447.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.199999999999996 19.950000000000003 11.700000000000001 20.150000000000002 2 26.700000000000003 22.85 30.8 19.650000000000002 3 21.4 25.825 33.15 19.625 4 24.775 33.5 23.275000000000002 18.45 5 24.275 35.85 22.975 16.900000000000002 6 21.1408556417313 37.20290217663248 23.817863397548162 17.838378784088064 7 20.16008004002001 19.734867433716857 40.09504752376188 20.01000500250125 8 23.575 22.85 26.55 27.025 9 22.26113056528264 25.212606303151574 28.8144072036018 23.71185592796398 10-14 24.208156117087814 27.68076057042782 26.454841130848134 21.656242181636227 15-19 24.2481861396047 28.03102326745059 27.08531398548912 20.63547660745559 20-24 23.727795846885165 27.955966975231423 27.910933199899922 20.40530397798349 25-29 23.97136850535589 27.86064671138252 27.930723796175794 20.237260987085794 30-34 23.14546000600661 27.60536590249274 28.070877965762335 21.178296125738314 35-39 23.33066373010311 28.211032135348884 27.330063069376315 21.12824106517169 40-44 23.37421777221527 27.83979974968711 27.92991239048811 20.856070087609513 45-49 23.383059671605928 27.86844213055667 28.123748498197838 20.624749699639565 50-54 23.661027129842825 27.51526679347282 28.256081689858846 20.567624386825507 55-59 24.005006257822277 27.294117647058826 27.774718397997493 20.926157697121404 60-64 23.217861433720465 27.723267921505805 27.447937525030035 21.61093311974369 65-69 23.777343945537368 27.111177854532713 28.257496120538622 20.8539820793913 70-74 23.76971214017522 27.5694618272841 27.349186483103882 21.311639549436794 75-79 23.6371827601742 27.872052860789907 27.801972268108326 20.68879211092757 80-84 22.78848560700876 27.88485607008761 27.849812265331664 21.476846057571965 85-89 23.81476846057572 27.76971214017522 27.789737171464328 20.625782227784732 90-94 24.225281602002504 27.524405506883603 27.71964956195244 20.530663329161452 95-99 23.894868585732166 28.02503128911139 27.619524405506883 20.46057571964956 100-104 24.20768036849747 27.777499624493068 28.017824062484355 19.99699594452511 105-109 23.718205487682756 27.778890446625276 27.87903064290006 20.62387342279191 110-114 24.871088861076345 27.63454317897372 27.128911138923655 20.36545682102628 115-119 24.94492289204887 28.45984378129381 27.012817945123174 19.582415381534148 120-124 25.99008661693286 27.887648325239073 26.906323536774646 19.215941521053423 125-129 25.32171648890892 27.71017976065295 27.004156026238046 19.96394772420009 130-134 26.44570169729134 27.311871025884944 26.79116807690382 19.451259199919892 135-139 26.68869861298883 27.064243152571226 26.899003555154977 19.348054679284964 140-144 26.518147684605758 27.35419274092616 26.76846057571965 19.359198998748436 145-149 26.222778473091363 27.594493116395498 26.893617021276594 19.289111389236545 150-151 27.684605757196497 27.396745932415516 27.008760951188986 17.909887359198997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 1.0 4 0.5 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 2.0 23 3.0 24 2.0 25 3.5 26 6.5 27 5.0 28 3.0 29 8.0 30 17.0 31 20.5 32 26.0 33 39.0 34 43.5 35 58.5 36 80.5 37 94.0 38 119.0 39 151.0 40 173.0 41 185.5 42 219.0 43 252.5 44 258.0 45 262.5 46 272.0 47 263.5 48 246.5 49 226.0 50 186.5 51 156.5 52 139.0 53 108.0 54 87.5 55 84.0 56 60.5 57 36.5 58 30.0 59 22.5 60 13.0 61 6.5 62 8.0 63 6.5 64 2.0 65 1.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.05 8 0.0 9 0.05 10-14 0.075 15-19 0.075 20-24 0.075 25-29 0.11 30-34 0.11 35-39 0.11 40-44 0.125 45-49 0.12 50-54 0.11 55-59 0.125 60-64 0.12 65-69 0.11499999999999999 70-74 0.125 75-79 0.11499999999999999 80-84 0.125 85-89 0.125 90-94 0.125 95-99 0.125 100-104 0.135 105-109 0.13999999999999999 110-114 0.125 115-119 0.13999999999999999 120-124 0.135 125-129 0.145 130-134 0.135 135-139 0.145 140-144 0.125 145-149 0.125 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93129770992365 97.2 2 0.7888040712468193 1.55 3 0.178117048346056 0.525 4 0.05089058524173028 0.2 5 0.02544529262086514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02544529262086514 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 16 0.4 Illumina Single End PCR Primer 1 (96% over 32bp) CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.42500000000000004 0.0 0.0 0.0 0.0 80-81 0.5625 0.0 0.0 0.0 0.0 82-83 0.7375 0.0 0.0 0.0 0.0 84-85 0.8125 0.0 0.0 0.0 0.0 86-87 0.8875 0.0 0.0 0.0 0.0 88-89 1.0875 0.0 0.0 0.0 0.0 90-91 1.3625 0.0 0.0 0.0 0.0 92-93 1.6125 0.0 0.0 0.0 0.0 94-95 1.8624999999999998 0.0 0.0 0.0 0.0 96-97 2.1875 0.0 0.0 0.0 0.0 98-99 2.6375 0.0 0.0 0.0 0.0 100-101 2.975 0.0 0.0 0.0 0.0 102-103 3.425 0.0 0.0 0.0 0.0 104-105 4.0 0.0 0.0 0.0 0.0 106-107 4.675 0.0 0.0 0.0 0.0 108-109 5.15 0.0 0.0 0.0 0.0 110-111 5.7625 0.0 0.0 0.0 0.0 112-113 6.262499999999999 0.0 0.0 0.0 0.0 114-115 6.875 0.0 0.0 0.0 0.0 116-117 7.5625 0.0 0.0 0.0 0.0 118-119 8.35 0.0 0.0 0.0 0.0 120-121 9.0 0.0 0.0 0.0 0.0 122-123 9.7875 0.0 0.0 0.0 0.0 124-125 10.65 0.0 0.0 0.0 0.0 126-127 11.4125 0.0 0.0 0.0 0.0 128-129 12.3125 0.0 0.0 0.0 0.0 130-131 13.1875 0.0 0.0 0.0 0.0 132-133 14.212499999999999 0.0 0.0 0.0 0.0 134-135 14.962499999999999 0.0 0.0 0.0 0.0 136-137 15.7625 0.0 0.0 0.0 0.0 138-139 16.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCACT 10 0.006830828 145.0 3 GGGGGGG 20 0.00593511 29.0 15-19 >>END_MODULE Read 976673 spots for SRR7170877.sra Written 976673 spots for SRR7170877.sra Read 976673 spots for SRR7170877.sra Written 976673 spots for SRR7170877.sra Read 976673 spots for SRR7170877.sra Written 976673 spots for SRR7170877.sra Read 976673 spots for SRR7170877.sra Written 976673 spots for SRR7170877.sra Read 976673 spots for SRR7170877.sra Written 976673 spots for SRR7170877.sra Read 976673 spots for SRR7170877.sra Written 976673 spots for SRR7170877.sra Read 976673 spots for SRR7170877.sra Written 976673 spots for SRR7170877.sra Read 976673 spots for SRR7170877.sra Written 976673 spots for SRR7170877.sra Read 976673 spots for SRR7170877.sra Written 976673 spots for SRR7170877.sra Read 976673 spots for SRR7170877.sra Written 976673 spots for SRR7170877.sra Read 976673 spots for SRR7170877.sra Written 976673 spots for SRR7170877.sra Read 976673 spots for SRR7170877.sra Written 976673 spots for SRR7170877.sra Read 976673 spots for SRR7170877.sra Written 976673 spots for SRR7170877.sra Read 976673 spots for SRR7170877.sra Written 976673 spots for SRR7170877.sra Read 976673 spots for SRR7170877.sra Written 976673 spots for SRR7170877.sra Read 976673 spots for SRR7170877.sra Written 976673 spots for SRR7170877.sra Read 976676 spots for SRR7170877.sra Written 976676 spots for SRR7170877.sra Read 976673 spots for SRR7170877.sra Written 976673 spots for SRR7170877.sra Read 976673 spots for SRR7170877.sra Written 976673 spots for SRR7170877.sra Read 976673 spots for SRR7170877.sra Written 976673 spots for SRR7170877.sra SRR ids: ['SRR7170877.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pktz485k SRR7170877.sra spots: 19533463 blocks: [[1, 976673], [976674, 1953346], [1953347, 2930019], [2930020, 3906692], [3906693, 4883365], [4883366, 5860038], [5860039, 6836711], [6836712, 7813384], [7813385, 8790057], [8790058, 9766730], [9766731, 10743403], [10743404, 11720076], [11720077, 12696749], [12696750, 13673422], [13673423, 14650095], [14650096, 15626768], [15626769, 16603441], [16603442, 17580114], [17580115, 18556787], [18556788, 19533463]] SRR7170877 file size 6597549 SRR7170877 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170877 SRR7170877_1.fastq SRR7170877_2.fastq Input file: SRR7170877_1.fastq Paired file: SRR7170877_2.fastq trimmed: SRR7170877-trimmed-pair1.fastq, SRR7170877-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:55:02 2025 >> started Thu Feb 13 21:55:31 2025 >> done (29.501s) 19533463 read pairs processed; of these: 47136 ( 0.24%) short read pairs filtered out after trimming by size control 132993 ( 0.68%) empty read pairs filtered out after trimming by size control 19353334 (99.08%) read pairs available; of these: 13433921 (69.41%) trimmed read pairs available after processing 5919413 (30.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 28 0.00% 20 33 0.00% 21 28 0.00% 22 38 0.00% 23 45 0.00% 24 62 0.00% 25 62 0.00% 26 64 0.00% 27 80 0.00% 28 70 0.00% 29 71 0.00% 30 72 0.00% 31 58 0.00% 32 61 0.00% 33 74 0.00% 34 83 0.00% 35 77 0.00% 36 99 0.00% 37 97 0.00% 38 132 0.00% 39 114 0.00% 40 114 0.00% 41 147 0.00% 42 175 0.00% 43 139 0.00% 44 189 0.00% 45 188 0.00% 46 227 0.00% 47 274 0.00% 48 372 0.00% 49 391 0.00% 50 479 0.00% 51 518 0.00% 52 597 0.00% 53 631 0.00% 54 718 0.00% 55 743 0.00% 56 858 0.00% 57 918 0.00% 58 1123 0.01% 59 1258 0.01% 60 1480 0.01% 61 1707 0.01% 62 1935 0.01% 63 2178 0.01% 64 2316 0.01% 65 2488 0.01% 66 2745 0.01% 67 2905 0.02% 68 3441 0.02% 69 3818 0.02% 70 4475 0.02% 71 5161 0.03% 72 6225 0.03% 73 6776 0.04% 74 7485 0.04% 75 9413 0.05% 76 17325 0.09% 77 16366 0.08% 78 11956 0.06% 79 12137 0.06% 80 13068 0.07% 81 15083 0.08% 82 16704 0.09% 83 18647 0.10% 84 22822 0.12% 85 24344 0.13% 86 24121 0.12% 87 26196 0.14% 88 27341 0.14% 89 28585 0.15% 90 31007 0.16% 91 33239 0.17% 92 35323 0.18% 93 38504 0.20% 94 40418 0.21% 95 42230 0.22% 96 42806 0.22% 97 43302 0.22% 98 44041 0.23% 99 46362 0.24% 100 48505 0.25% 101 50716 0.26% 102 54539 0.28% 103 57149 0.30% 104 59187 0.31% 105 61465 0.32% 106 62761 0.32% 107 62864 0.32% 108 63317 0.33% 109 64783 0.33% 110 66179 0.34% 111 69243 0.36% 112 72728 0.38% 113 75430 0.39% 114 78624 0.41% 115 80565 0.42% 116 82483 0.43% 117 82902 0.43% 118 82907 0.43% 119 84942 0.44% 120 86137 0.45% 121 89032 0.46% 122 91229 0.47% 123 95876 0.50% 124 100167 0.52% 125 103219 0.53% 126 105817 0.55% 127 106129 0.55% 128 107919 0.56% 129 111395 0.58% 130 111910 0.58% 131 114498 0.59% 132 120466 0.62% 133 126213 0.65% 134 132044 0.68% 135 140461 0.73% 136 144811 0.75% 137 152444 0.79% 138 158757 0.82% 139 169262 0.87% 140 179087 0.93% 141 193005 1.00% 142 212329 1.10% 143 239493 1.24% 144 273823 1.41% 145 324836 1.68% 146 405277 2.09% 147 532005 2.75% 148 767726 3.97% 149 1368596 7.07% 150 4460667 23.05% 151 5919413 30.59% 19353334 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=14 prefix-density=0.77 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=66.25 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAA criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=19 prefix-density=0.74 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.26 sequence-density-rank=22 fanout-score=13.98 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=5.8 sequence=AGCAATGGCAGCA SRR7170877 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:56:14 Started mapping on | Feb 13 21:56:14 Finished on | Feb 13 21:57:56 Mapping speed, Million of reads per hour | 683.06 Number of input reads | 19353334 Average input read length | 284 UNIQUE READS: Uniquely mapped reads number | 18373655 Uniquely mapped reads % | 94.94% Average mapped length | 283.35 Number of splices: Total | 16265279 Number of splices: Annotated (sjdb) | 15918850 Number of splices: GT/AG | 15924691 Number of splices: GC/AG | 276343 Number of splices: AT/AC | 9559 Number of splices: Non-canonical | 54686 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 461333 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 42354 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.41% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 564813 564813 564813 N_multimapping 461333 461333 461333 N_noFeature 613472 17962356 785735 N_ambiguous 361339 1322 121588 UnstrandedReadsAssigned:17398844 PositiveStrandReadsAssigned:409977 NegativeStrandReadsAssigned:17466332 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=137 echo kmer=133 SRR7170877 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170877-trimmed-pair1.fastq SRR7170877-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,353,334 reads, 17,487,588 reads pseudoaligned [quant] estimated average fragment length: 201.799 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,069 rounds 52401 SRR7170877.ke.tsv 34699 SRR7170877.se.tsv 87100 total ==> SRR7170877.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1817.2 668 17.537 Potri.005G024800.1.v4.1 1035 834.201 210 12.0096 Potri.004G059700.1.v4.1 961 760.201 12 0.753068 Potri.007G009000.2.v4.1 1416 1215.2 0 0 Potri.003G141000.2.v4.1 2943 2742.2 880 15.3096 Potri.016G087400.1.v4.1 270 101.042 732.35 345.779 Potri.015G069301.1.v4.1 564 366.227 0 0 Potri.010G195200.1.v4.1 1773 1572.2 42 1.27445 Potri.012G127500.1.v4.1 977 776.201 164 10.0798 ==> SRR7170877.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 313 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 461 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170877 completed mapping pipeline successfully