Starting /dee2/code/volunteer_pipeline.sh SRR7170878 current disk space = 3088228573184 free memory = 1575634712 SRR7170878 SRAfilesize 15af4666cdd235bd80dd7dc97d619bc1 SRR7170878.sra SRR7170878.sra file validated SRR7170878 is paired end SRR7170878 is conventional basespace SRR7170878 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170878_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.43425 34.0 33.0 34.0 33.0 34.0 2 33.25175 34.0 33.0 34.0 32.0 34.0 3 33.22175 34.0 33.0 34.0 31.0 34.0 4 33.39175 34.0 33.0 34.0 33.0 34.0 5 33.437 34.0 33.0 34.0 33.0 34.0 6 36.77825 38.0 37.0 38.0 35.0 38.0 7 37.278 38.0 38.0 38.0 36.0 38.0 8 37.406 38.0 38.0 38.0 37.0 38.0 9 37.44275 38.0 38.0 38.0 37.0 38.0 10-14 37.490899999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.4448 38.0 38.0 38.0 37.0 38.0 20-24 37.39525 38.0 38.0 38.0 37.0 38.0 25-29 37.3503 38.0 38.0 38.0 37.0 38.0 30-34 37.24625 38.0 38.0 38.0 36.6 38.0 35-39 37.2035 38.0 38.0 38.0 36.6 38.0 40-44 37.15454999999999 38.0 38.0 38.0 36.0 38.0 45-49 36.986250000000005 38.0 38.0 38.0 36.0 38.0 50-54 36.9414 38.0 38.0 38.0 35.8 38.0 55-59 36.8879 38.0 38.0 38.0 35.2 38.0 60-64 36.782050000000005 38.0 38.0 38.0 35.2 38.0 65-69 36.806 38.0 38.0 38.0 35.2 38.0 70-74 36.7334 38.0 38.0 38.0 35.0 38.0 75-79 36.52935 38.0 38.0 38.0 34.0 38.0 80-84 36.3029 38.0 37.4 38.0 33.8 38.0 85-89 36.335449999999994 38.0 37.6 38.0 33.8 38.0 90-94 36.07705 38.0 37.0 38.0 33.0 38.0 95-99 36.0898 38.0 37.0 38.0 33.4 38.0 100-104 35.79945 38.0 36.8 38.0 31.6 38.0 105-109 35.727199999999996 38.0 37.0 38.0 31.0 38.0 110-114 35.35845 38.0 36.0 38.0 29.4 38.0 115-119 35.07645 38.0 35.8 38.0 28.6 38.0 120-124 34.7491 38.0 34.8 38.0 27.2 38.0 125-129 34.256350000000005 38.0 33.6 38.0 24.4 38.0 130-134 33.68875 38.0 33.0 38.0 22.0 38.0 135-139 32.809000000000005 38.0 33.0 38.0 16.2 38.0 140-144 32.05425 37.6 31.4 38.0 13.4 38.0 145-149 30.86025 36.6 30.0 38.0 8.0 38.0 150-151 24.530749999999998 31.5 15.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 2.0 10 0.0 11 1.0 12 1.0 13 2.0 14 0.0 15 0.0 16 3.0 17 2.0 18 3.0 19 9.0 20 3.0 21 15.0 22 3.0 23 6.0 24 14.0 25 21.0 26 25.0 27 33.0 28 39.0 29 60.0 30 57.0 31 68.0 32 101.0 33 151.0 34 224.0 35 441.0 36 1053.0 37 1662.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.148387096774194 17.083870967741934 7.767741935483871 28.000000000000004 2 20.5 19.275000000000002 37.425000000000004 22.8 3 17.299999999999997 27.200000000000003 31.125000000000004 24.375 4 22.425 32.2 24.825 20.549999999999997 5 20.8 37.05 24.175 17.974999999999998 6 18.925 36.775000000000006 25.275 19.025 7 15.825 22.2 43.1 18.875 8 17.05 22.55 30.85 29.549999999999997 9 17.474999999999998 23.625 32.5 26.400000000000002 10-14 20.765 28.625 26.21 24.4 15-19 19.625 28.405 27.689999999999998 24.279999999999998 20-24 20.36 28.444999999999997 27.389999999999997 23.805 25-29 19.78 28.405 27.88 23.935000000000002 30-34 19.705000000000002 28.925 27.755000000000003 23.615 35-39 20.355 28.57 27.534999999999997 23.54 40-44 20.455000000000002 28.34 27.839999999999996 23.365 45-49 20.54 28.310000000000002 27.765 23.385 50-54 19.975 28.27 27.675 24.08 55-59 20.11 28.405 28.03 23.455000000000002 60-64 20.165 27.939999999999998 28.095 23.799999999999997 65-69 19.905 28.185 27.900000000000002 24.01 70-74 20.474999999999998 28.275 27.655 23.595 75-79 20.45 28.804999999999996 27.425 23.32 80-84 20.544999999999998 28.48 27.325 23.65 85-89 20.435 28.725 27.43 23.41 90-94 20.645 28.000000000000004 27.715 23.64 95-99 20.665 28.52 27.095000000000002 23.72 100-104 20.7 28.62 26.790000000000003 23.89 105-109 20.349999999999998 28.185 27.694999999999997 23.77 110-114 20.985 28.265 27.965 22.785 115-119 20.424999999999997 28.544999999999998 27.284999999999997 23.745 120-124 21.625 28.360000000000003 26.474999999999998 23.54 125-129 21.005 28.64 26.424999999999997 23.93 130-134 20.919999999999998 28.22 26.265 24.595 135-139 20.71 28.13 26.875 24.285 140-144 21.565 28.655 26.38 23.400000000000002 145-149 21.265 28.605000000000004 26.07 24.060000000000002 150-151 21.2375 28.3625 26.3 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 1.5 20 2.5 21 1.0 22 1.0 23 2.0 24 3.0 25 9.0 26 12.0 27 9.0 28 6.5 29 14.0 30 24.5 31 26.0 32 33.5 33 43.0 34 53.5 35 68.5 36 89.0 37 112.0 38 129.0 39 167.0 40 192.0 41 207.0 42 232.0 43 247.0 44 268.5 45 268.5 46 256.0 47 236.5 48 208.5 49 195.5 50 174.5 51 138.5 52 117.5 53 101.5 54 81.5 55 62.0 56 54.5 57 49.0 58 30.5 59 22.5 60 16.0 61 7.5 62 4.5 63 3.5 64 3.5 65 3.0 66 1.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34475806451613 98.55000000000001 2 0.5544354838709677 1.0999999999999999 3 0.07560483870967742 0.22499999999999998 4 0.0 0.0 5 0.025201612903225805 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTAT 5 0.125 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.44999999999999996 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.8999999999999999 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.325 0.0 0.0 0.0 0.0 98-99 1.4625 0.0 0.0 0.0 0.0 100-101 1.625 0.0 0.0 0.0 0.0 102-103 1.9749999999999999 0.0 0.0 0.0 0.0 104-105 2.3125 0.0 0.0 0.0 0.0 106-107 2.625 0.0 0.0 0.0 0.0 108-109 2.9875 0.0 0.0 0.0 0.0 110-111 3.2750000000000004 0.0 0.0 0.0 0.0 112-113 3.6500000000000004 0.0 0.0 0.0 0.0 114-115 3.9625 0.0 0.0 0.0 0.0 116-117 4.425 0.0 0.0 0.0 0.0 118-119 4.987500000000001 0.0 0.0 0.0 0.0 120-121 5.75 0.0 0.0 0.0 0.0 122-123 6.3125 0.0 0.0 0.0 0.0 124-125 6.887499999999999 0.0 0.0 0.0 0.0 126-127 7.325 0.0 0.0 0.0 0.0 128-129 7.7875 0.0 0.0 0.0 0.0 130-131 8.3125 0.0 0.0 0.0 0.0 132-133 8.95 0.0 0.0 0.0 0.0 134-135 9.9375 0.0 0.0 0.0 0.0 136-137 10.7125 0.0 0.0 0.0 0.0 138-139 11.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACTTT 10 0.006832588 144.9875 8 CTGTGTG 10 0.006832588 144.9875 9 CACTTTT 10 0.006832588 144.9875 9 >>END_MODULE SRR7170878 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170878_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01025 33.0 33.0 34.0 32.0 34.0 2 33.10925 34.0 33.0 34.0 32.0 34.0 3 33.18225 34.0 33.0 34.0 33.0 34.0 4 33.12275 34.0 33.0 34.0 33.0 34.0 5 33.09 34.0 33.0 34.0 33.0 34.0 6 37.33825 38.0 38.0 38.0 37.0 38.0 7 37.422 38.0 38.0 38.0 38.0 38.0 8 37.40775 38.0 38.0 38.0 37.0 38.0 9 37.45275 38.0 38.0 38.0 38.0 38.0 10-14 37.34505 38.0 38.0 38.0 37.6 38.0 15-19 37.3515 38.0 38.0 38.0 37.6 38.0 20-24 37.27555 38.0 38.0 38.0 37.2 38.0 25-29 37.1939 38.0 38.0 38.0 37.0 38.0 30-34 37.15895 38.0 38.0 38.0 37.0 38.0 35-39 37.145799999999994 38.0 38.0 38.0 37.0 38.0 40-44 37.11715 38.0 38.0 38.0 37.0 38.0 45-49 37.161249999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.08135 38.0 38.0 38.0 37.0 38.0 55-59 37.0619 38.0 38.0 38.0 37.0 38.0 60-64 36.9758 38.0 38.0 38.0 36.0 38.0 65-69 37.0073 38.0 38.0 38.0 36.4 38.0 70-74 36.9197 38.0 38.0 38.0 36.0 38.0 75-79 36.790949999999995 38.0 38.0 38.0 35.6 38.0 80-84 36.678749999999994 38.0 38.0 38.0 35.6 38.0 85-89 36.64195 38.0 38.0 38.0 35.6 38.0 90-94 36.512350000000005 38.0 38.0 38.0 34.8 38.0 95-99 36.43390000000001 38.0 38.0 38.0 34.0 38.0 100-104 36.27115 38.0 38.0 38.0 33.8 38.0 105-109 36.1215 38.0 38.0 38.0 33.8 38.0 110-114 35.970600000000005 38.0 38.0 38.0 33.0 38.0 115-119 35.747550000000004 38.0 37.2 38.0 32.2 38.0 120-124 35.4725 38.0 37.0 38.0 31.4 38.0 125-129 35.1308 38.0 36.2 38.0 29.0 38.0 130-134 34.649950000000004 38.0 36.0 38.0 27.4 38.0 135-139 34.0552 38.0 34.0 38.0 23.6 38.0 140-144 33.367450000000005 38.0 33.2 38.0 18.8 38.0 145-149 32.31885 38.0 33.0 38.0 10.6 38.0 150-151 26.7295 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 5.0 4 0.0 5 2.0 6 2.0 7 1.0 8 2.0 9 3.0 10 1.0 11 0.0 12 1.0 13 0.0 14 2.0 15 1.0 16 9.0 17 5.0 18 2.0 19 5.0 20 13.0 21 7.0 22 10.0 23 16.0 24 12.0 25 18.0 26 23.0 27 23.0 28 28.0 29 31.0 30 38.0 31 54.0 32 66.0 33 96.0 34 151.0 35 190.0 36 631.0 37 2549.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.0 18.075 9.375 23.549999999999997 2 25.43815723585378 23.635453179769655 32.72408612919379 18.202303455182776 3 20.981472208312468 26.639959939909865 32.14822233350025 20.230345518277414 4 23.223223223223226 36.03603603603604 22.972972972972975 17.76776776776777 5 23.760640961442164 37.180771156735105 21.85778668002003 17.200801201802705 6 20.150000000000002 38.75 22.75 18.35 7 18.85 19.275000000000002 40.050000000000004 21.825 8 19.825 24.425 28.549999999999997 27.200000000000003 9 21.55 25.85 29.125 23.474999999999998 10-14 23.13615680784039 28.356417820891046 26.626331316565828 21.881094054702736 15-19 22.904580916183235 27.735547109421884 28.670734146829368 20.689137827565514 20-24 22.333400040024014 28.026816089653796 28.08184910946568 21.557934760856515 25-29 23.207849419303166 28.57929515418502 27.68822587104525 20.524629555466557 30-34 22.84827862289832 27.867293835068054 28.477782225780622 20.806645316253004 35-39 23.402871579368654 28.330581820001 28.005402971634396 20.26114362899595 40-44 23.38188917254843 27.62176502978425 27.937127696851377 21.059218100815936 45-49 22.943354683746996 27.34187349879904 28.54283426741393 21.17193755004003 50-54 23.113490792634106 27.281825460368292 28.76301040832666 20.841673338670937 55-59 23.22777527640202 28.00040022012107 28.05042773525439 20.721396768222522 60-64 23.72686343171586 27.41870935467734 28.009004502251127 20.845422711355678 65-69 22.808685211126676 28.01180708425055 28.086852111266758 21.092655593356014 70-74 22.572414828155484 28.450647856320977 27.850317674721097 21.126619640802442 75-79 22.861430715357677 27.85392696348174 28.394197098549274 20.890445222611305 80-84 23.038823293976385 27.456473884330602 28.146888132879727 21.35781468881329 85-89 23.652095628688606 27.568270481144342 27.938381514454335 20.841252375712713 90-94 23.405532489620327 27.922565154319447 27.98759441748787 20.684307938572356 95-99 23.251975592677805 27.938381514454335 27.97339201760528 20.83625087526258 100-104 23.91075984192887 28.362763243459554 27.172227502376067 20.554249412235507 105-109 23.92816048826855 27.485116814247835 27.895342438341086 20.691380259142527 110-114 24.047214164249276 28.15344603381014 27.238171451435434 20.561168350505152 115-119 24.20952571542926 27.78166900140084 27.641584950970582 20.36722033219932 120-124 24.314725890356144 28.016206482593038 27.230892356942775 20.438175270108044 125-129 25.130078046828096 27.826696017610566 27.201320792475485 19.841905143085853 130-134 25.101275318829707 28.347086771692926 26.71167791947987 19.8399599899975 135-139 25.511480166074733 28.282727227252263 26.672002401080487 19.533790205592517 140-144 25.685274109643856 28.42637054821929 26.865746298519404 19.022609043617447 145-149 26.740696278511404 27.931172468987597 26.250500200080033 19.07763105242097 150-151 26.481620405101275 27.28182045511378 27.68192048012003 18.554638659664917 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 1.0 20 1.5 21 1.0 22 1.0 23 3.5 24 4.5 25 4.5 26 6.5 27 7.0 28 10.5 29 13.5 30 19.5 31 29.5 32 33.0 33 37.0 34 45.5 35 60.5 36 75.5 37 100.0 38 136.5 39 167.0 40 194.5 41 225.5 42 249.0 43 263.0 44 277.0 45 269.5 46 253.5 47 246.0 48 228.5 49 197.5 50 159.0 51 129.5 52 102.0 53 84.0 54 87.0 55 68.5 56 44.0 57 36.5 58 29.0 59 28.0 60 24.5 61 14.5 62 9.0 63 6.0 64 4.0 65 2.5 66 1.0 67 0.5 68 0.0 69 0.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.15 4 0.1 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.02 20-24 0.06 25-29 0.12 30-34 0.08 35-39 0.055 40-44 0.11499999999999999 45-49 0.08 50-54 0.08 55-59 0.055 60-64 0.05 65-69 0.06 70-74 0.055 75-79 0.05 80-84 0.06 85-89 0.03 90-94 0.045 95-99 0.03 100-104 0.045 105-109 0.055 110-114 0.03 115-119 0.06 120-124 0.04 125-129 0.06 130-134 0.025 135-139 0.045 140-144 0.04 145-149 0.04 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57254211717374 99.0 2 0.37716872014080965 0.75 3 0.0 0.0 4 0.0 0.0 5 0.050289162685441285 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (97% over 34bp) AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.725 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.275 0.0 0.0 0.0 0.0 98-99 1.3875000000000002 0.0 0.0 0.0 0.0 100-101 1.55 0.0 0.0 0.0 0.0 102-103 1.8875 0.0 0.0 0.0 0.0 104-105 2.2125 0.0 0.0 0.0 0.0 106-107 2.5250000000000004 0.0 0.0 0.0 0.0 108-109 2.9000000000000004 0.0 0.0 0.0 0.0 110-111 3.2249999999999996 0.0 0.0 0.0 0.0 112-113 3.5625 0.0 0.0 0.0 0.0 114-115 3.8875 0.0 0.0 0.0 0.0 116-117 4.3875 0.0 0.0 0.0 0.0 118-119 4.987500000000001 0.0 0.0 0.0 0.0 120-121 5.8 0.0 0.0 0.0 0.0 122-123 6.4 0.0 0.0 0.0 0.0 124-125 7.025 0.0 0.0 0.0 0.0 126-127 7.487500000000001 0.0 0.0 0.0 0.0 128-129 7.9875 0.0 0.0 0.0 0.0 130-131 8.5125 0.0 0.0 0.0 0.0 132-133 9.149999999999999 0.0 0.0 0.0 0.0 134-135 10.175 0.0 0.0 0.0 0.0 136-137 10.9625 0.0 0.0 0.0 0.0 138-139 11.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTCCC 10 0.006843168 144.91249 2 TGACAGC 10 0.006843168 144.91249 8 CCTCTCC 10 0.006843168 144.91249 1 GGTACCA 10 0.006843168 144.91249 7 >>END_MODULE Read 790971 spots for SRR7170878.sra Written 790971 spots for SRR7170878.sra Read 790971 spots for SRR7170878.sra Written 790971 spots for SRR7170878.sra Read 790971 spots for SRR7170878.sra Written 790971 spots for SRR7170878.sra Read 790971 spots for SRR7170878.sra Written 790971 spots for SRR7170878.sra Read 790971 spots for SRR7170878.sra Written 790971 spots for SRR7170878.sra Read 790971 spots for SRR7170878.sra Written 790971 spots for SRR7170878.sra Read 790971 spots for SRR7170878.sra Written 790971 spots for SRR7170878.sra Read 790971 spots for SRR7170878.sra Written 790971 spots for SRR7170878.sra Read 790971 spots for SRR7170878.sra Written 790971 spots for SRR7170878.sra Read 790971 spots for SRR7170878.sra Written 790971 spots for SRR7170878.sra Read 790971 spots for SRR7170878.sra Written 790971 spots for SRR7170878.sra Read 790971 spots for SRR7170878.sra Written 790971 spots for SRR7170878.sra Read 790971 spots for SRR7170878.sra Written 790971 spots for SRR7170878.sra Read 790971 spots for SRR7170878.sra Written 790971 spots for SRR7170878.sra Read 790971 spots for SRR7170878.sra Written 790971 spots for SRR7170878.sra Read 790971 spots for SRR7170878.sra Written 790971 spots for SRR7170878.sra Read 790971 spots for SRR7170878.sra Written 790971 spots for SRR7170878.sra Read 790971 spots for SRR7170878.sra Written 790971 spots for SRR7170878.sra Read 790971 spots for SRR7170878.sra Written 790971 spots for SRR7170878.sra Read 790982 spots for SRR7170878.sra Written 790982 spots for SRR7170878.sra SRR ids: ['SRR7170878.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sazca1lb SRR7170878.sra spots: 15819431 blocks: [[1, 790971], [790972, 1581942], [1581943, 2372913], [2372914, 3163884], [3163885, 3954855], [3954856, 4745826], [4745827, 5536797], [5536798, 6327768], [6327769, 7118739], [7118740, 7909710], [7909711, 8700681], [8700682, 9491652], [9491653, 10282623], [10282624, 11073594], [11073595, 11864565], [11864566, 12655536], [12655537, 13446507], [13446508, 14237478], [14237479, 15028449], [15028450, 15819431]] SRR7170878 file size 5338985 SRR7170878 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170878 SRR7170878_1.fastq SRR7170878_2.fastq Input file: SRR7170878_1.fastq Paired file: SRR7170878_2.fastq trimmed: SRR7170878-trimmed-pair1.fastq, SRR7170878-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:19:08 2025 >> started Thu Feb 13 21:19:25 2025 >> done (17.148s) 15819431 read pairs processed; of these: 24167 ( 0.15%) short read pairs filtered out after trimming by size control 24484 ( 0.15%) empty read pairs filtered out after trimming by size control 15770780 (99.69%) read pairs available; of these: 10825587 (68.64%) trimmed read pairs available after processing 4945193 (31.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 27 0.00% 19 24 0.00% 20 23 0.00% 21 35 0.00% 22 34 0.00% 23 52 0.00% 24 39 0.00% 25 36 0.00% 26 37 0.00% 27 48 0.00% 28 44 0.00% 29 41 0.00% 30 42 0.00% 31 42 0.00% 32 42 0.00% 33 54 0.00% 34 45 0.00% 35 60 0.00% 36 43 0.00% 37 51 0.00% 38 57 0.00% 39 55 0.00% 40 71 0.00% 41 75 0.00% 42 79 0.00% 43 85 0.00% 44 75 0.00% 45 98 0.00% 46 93 0.00% 47 100 0.00% 48 135 0.00% 49 171 0.00% 50 197 0.00% 51 190 0.00% 52 221 0.00% 53 232 0.00% 54 272 0.00% 55 275 0.00% 56 299 0.00% 57 339 0.00% 58 406 0.00% 59 448 0.00% 60 518 0.00% 61 665 0.00% 62 764 0.00% 63 840 0.01% 64 905 0.01% 65 987 0.01% 66 1124 0.01% 67 1264 0.01% 68 1344 0.01% 69 1516 0.01% 70 1788 0.01% 71 2060 0.01% 72 2422 0.02% 73 2752 0.02% 74 3101 0.02% 75 3286 0.02% 76 3992 0.03% 77 4083 0.03% 78 4219 0.03% 79 4531 0.03% 80 4989 0.03% 81 6071 0.04% 82 6915 0.04% 83 8468 0.05% 84 10401 0.07% 85 9929 0.06% 86 9947 0.06% 87 10672 0.07% 88 11239 0.07% 89 12056 0.08% 90 13537 0.09% 91 14518 0.09% 92 15691 0.10% 93 17506 0.11% 94 18863 0.12% 95 19781 0.13% 96 20357 0.13% 97 20659 0.13% 98 21278 0.13% 99 22324 0.14% 100 23983 0.15% 101 25558 0.16% 102 28224 0.18% 103 29980 0.19% 104 32182 0.20% 105 33564 0.21% 106 34415 0.22% 107 35083 0.22% 108 35398 0.22% 109 36426 0.23% 110 37612 0.24% 111 40415 0.26% 112 43004 0.27% 113 45539 0.29% 114 47887 0.30% 115 50209 0.32% 116 51317 0.33% 117 52580 0.33% 118 52586 0.33% 119 53866 0.34% 120 55517 0.35% 121 58206 0.37% 122 61033 0.39% 123 64871 0.41% 124 69064 0.44% 125 71521 0.45% 126 74238 0.47% 127 75288 0.48% 128 77324 0.49% 129 78974 0.50% 130 82156 0.52% 131 85408 0.54% 132 90795 0.58% 133 97333 0.62% 134 103517 0.66% 135 110969 0.70% 136 117009 0.74% 137 123968 0.79% 138 131046 0.83% 139 139934 0.89% 140 148784 0.94% 141 163123 1.03% 142 181803 1.15% 143 206010 1.31% 144 238958 1.52% 145 282561 1.79% 146 350095 2.22% 147 459432 2.91% 148 681556 4.32% 149 1252459 7.94% 150 3980653 25.24% 151 4945193 31.36% 15770780 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=11 prefix-density=0.48 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=44.64 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.7 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=19 prefix-density=0.60 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=19 fanout-score=7.88 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=4.8 sequence=TGGTTCAAGGCTGGAGC SRR7170878 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:20:11 Started mapping on | Feb 13 21:20:11 Finished on | Feb 13 21:21:43 Mapping speed, Million of reads per hour | 617.12 Number of input reads | 15770780 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 14711188 Uniquely mapped reads % | 93.28% Average mapped length | 287.42 Number of splices: Total | 13341446 Number of splices: Annotated (sjdb) | 12973167 Number of splices: GT/AG | 13086755 Number of splices: GC/AG | 192266 Number of splices: AT/AC | 8920 Number of splices: Non-canonical | 53505 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.03% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 443035 % of reads mapped to multiple loci | 2.81% Number of reads mapped to too many loci | 173424 % of reads mapped to too many loci | 1.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.62% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 636556 636556 636556 N_multimapping 443035 443035 443035 N_noFeature 754400 14381552 949349 N_ambiguous 245937 1789 109988 UnstrandedReadsAssigned:13710851 PositiveStrandReadsAssigned:327847 NegativeStrandReadsAssigned:13651851 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=141 echo kmer=137 SRR7170878 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170878-trimmed-pair1.fastq SRR7170878-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,770,780 reads, 13,693,910 reads pseudoaligned [quant] estimated average fragment length: 218.912 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52401 SRR7170878.ke.tsv 34699 SRR7170878.se.tsv 87100 total ==> SRR7170878.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.09 710 26.818 Potri.005G024800.1.v4.1 1035 817.088 340 28.2925 Potri.004G059700.1.v4.1 961 743.164 15 1.37236 Potri.007G009000.2.v4.1 1416 1198.09 0 0 Potri.003G141000.2.v4.1 2943 2725.09 835.148 20.8375 Potri.016G087400.1.v4.1 270 92.1838 980.745 723.376 Potri.015G069301.1.v4.1 564 351.563 0 0 Potri.010G195200.1.v4.1 1773 1555.09 110 4.8095 Potri.012G127500.1.v4.1 977 759.114 75 6.71763 ==> SRR7170878.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 842 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 275 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 9 SRR7170878 completed mapping pipeline successfully