Starting /dee2/code/volunteer_pipeline.sh SRR7170879 current disk space = 3088220078080 free memory = 1449927672 SRR7170879 SRAfilesize 728a2bbbba5caa2826183461bc3d5fe6 SRR7170879.sra SRR7170879.sra file validated SRR7170879 is paired end SRR7170879 is conventional basespace SRR7170879 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170879_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.60525 34.0 33.0 34.0 32.0 34.0 2 33.073 34.0 33.0 34.0 32.0 34.0 3 33.1075 34.0 33.0 34.0 32.0 34.0 4 33.1835 34.0 33.0 34.0 32.0 34.0 5 33.1505 34.0 33.0 34.0 32.0 34.0 6 36.58625 38.0 37.0 38.0 34.0 38.0 7 37.06975 38.0 38.0 38.0 36.0 38.0 8 37.28325 38.0 38.0 38.0 36.0 38.0 9 37.27375 38.0 38.0 38.0 36.0 38.0 10-14 37.2504 38.0 38.0 38.0 36.4 38.0 15-19 37.16455 38.0 38.0 38.0 36.0 38.0 20-24 37.1049 38.0 38.0 38.0 36.0 38.0 25-29 37.144999999999996 38.0 38.0 38.0 36.0 38.0 30-34 37.0456 38.0 38.0 38.0 36.0 38.0 35-39 36.985 38.0 38.0 38.0 35.8 38.0 40-44 36.86895 38.0 38.0 38.0 35.0 38.0 45-49 36.8266 38.0 38.0 38.0 35.0 38.0 50-54 36.63605 38.0 38.0 38.0 34.0 38.0 55-59 36.574349999999995 38.0 38.0 38.0 34.0 38.0 60-64 36.4927 38.0 38.0 38.0 34.0 38.0 65-69 36.431650000000005 38.0 37.6 38.0 34.0 38.0 70-74 36.2728 38.0 37.2 38.0 33.4 38.0 75-79 36.129549999999995 38.0 37.0 38.0 33.0 38.0 80-84 35.86659999999999 38.0 37.0 38.0 31.6 38.0 85-89 35.989250000000006 38.0 37.0 38.0 32.2 38.0 90-94 35.6074 38.0 36.6 38.0 29.8 38.0 95-99 35.40325 38.0 36.0 38.0 29.0 38.0 100-104 35.282650000000004 38.0 36.0 38.0 28.8 38.0 105-109 34.9901 38.0 35.4 38.0 27.8 38.0 110-114 34.68485 38.0 35.0 38.0 25.8 38.0 115-119 34.3624 38.0 34.0 38.0 24.4 38.0 120-124 33.8395 38.0 33.0 38.0 21.6 38.0 125-129 33.275349999999996 38.0 32.6 38.0 18.4 38.0 130-134 32.563399999999994 37.6 31.4 38.0 15.6 38.0 135-139 31.792650000000002 36.8 30.0 38.0 13.6 38.0 140-144 30.9387 36.2 28.6 38.0 12.6 38.0 145-149 29.143649999999997 36.0 26.6 38.0 3.8 38.0 150-151 23.425125 30.5 11.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 2.0 17 5.0 18 5.0 19 6.0 20 12.0 21 7.0 22 17.0 23 16.0 24 17.0 25 22.0 26 35.0 27 45.0 28 57.0 29 74.0 30 98.0 31 119.0 32 128.0 33 204.0 34 304.0 35 503.0 36 1062.0 37 1259.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.047934727180014 17.516573176950537 8.796532381438043 27.63895971443141 2 20.849999999999998 19.025 36.35 23.775 3 16.75 28.299999999999997 29.799999999999997 25.15 4 21.15 33.575 25.3 19.975 5 20.125 36.125 25.6 18.15 6 17.549999999999997 37.3 25.15 20.0 7 13.725000000000001 22.05 44.5 19.725 8 17.724999999999998 23.825 30.2 28.249999999999996 9 17.125 24.3 32.175 26.400000000000002 10-14 20.275000000000002 28.84 26.979999999999997 23.905 15-19 19.21 28.74 28.110000000000003 23.94 20-24 19.405 28.74 28.315 23.54 25-29 19.885 29.365000000000002 27.865000000000002 22.884999999999998 30-34 19.77 29.085 27.650000000000002 23.494999999999997 35-39 19.869999999999997 29.07 27.555000000000003 23.505000000000003 40-44 19.97 29.189999999999998 27.615000000000002 23.225 45-49 19.994999999999997 28.68 27.935 23.39 50-54 20.29 29.65 27.229999999999997 22.830000000000002 55-59 19.945 28.7 27.744999999999997 23.61 60-64 19.85 29.235 27.855 23.06 65-69 20.645 28.134999999999998 28.189999999999998 23.03 70-74 20.115 28.945 27.755000000000003 23.185 75-79 20.3 29.435 27.275 22.99 80-84 19.595000000000002 28.335 27.810000000000002 24.26 85-89 19.7 29.385 27.735 23.18 90-94 20.19 29.01 27.565 23.235 95-99 19.8 29.595 27.29 23.315 100-104 20.035 28.64 27.38 23.945 105-109 19.84 28.884999999999998 27.939999999999998 23.335 110-114 20.925 28.854999999999997 27.305 22.915 115-119 20.965 29.49 26.795 22.75 120-124 20.8 29.21 26.505000000000003 23.485 125-129 20.155 29.15 27.084999999999997 23.61 130-134 20.555 28.46 26.995 23.990000000000002 135-139 20.27 29.005 26.915 23.810000000000002 140-144 20.605 28.16 27.11 24.125 145-149 20.785 28.945 26.055 24.215 150-151 20.3625 29.075 26.137500000000003 24.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 1.5 22 3.5 23 3.5 24 4.0 25 4.0 26 8.0 27 12.0 28 15.0 29 20.0 30 22.0 31 25.0 32 38.0 33 50.0 34 59.5 35 83.0 36 107.0 37 118.0 38 143.5 39 179.5 40 208.5 41 243.5 42 259.0 43 269.5 44 276.5 45 269.5 46 249.0 47 222.0 48 206.0 49 174.5 50 147.5 51 143.5 52 115.5 53 78.0 54 52.0 55 39.0 56 41.5 57 34.0 58 21.5 59 14.5 60 11.5 61 7.5 62 3.0 63 1.5 64 2.0 65 1.0 66 1.5 67 2.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64815280221161 99.125 2 0.2764513696908771 0.5499999999999999 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.050263885398341285 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 5 0.125 TruSeq Adapter, Index 3 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.9624999999999999 0.0 0.0 0.0 0.0 96-97 1.25 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.6125 0.0 0.0 0.0 0.0 102-103 1.85 0.0 0.0 0.0 0.0 104-105 2.25 0.0 0.0 0.0 0.0 106-107 2.625 0.0 0.0 0.0 0.0 108-109 2.8625 0.0 0.0 0.0 0.0 110-111 3.1875 0.0 0.0 0.0 0.0 112-113 3.5625 0.0 0.0 0.0 0.0 114-115 3.9625000000000004 0.0 0.0 0.0 0.0 116-117 4.5 0.0 0.0 0.0 0.0 118-119 4.975 0.0 0.0 0.0 0.0 120-121 5.387499999999999 0.0 0.0 0.0 0.0 122-123 5.737500000000001 0.0 0.0 0.0 0.0 124-125 6.2375 0.0 0.0 0.0 0.0 126-127 6.737500000000001 0.0 0.0 0.0 0.0 128-129 7.300000000000001 0.0 0.0 0.0 0.0 130-131 7.975 0.0 0.0 0.0 0.0 132-133 8.6375 0.0 0.0 0.0 0.0 134-135 9.475 0.0 0.0 0.0 0.0 136-137 10.375 0.0 0.0 0.0 0.0 138-139 11.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACGTCTG 30 0.0014445208 24.164585 140-144 CGTCTGA 30 0.0014445208 24.164585 140-144 GAAGAGC 40 0.0076588374 18.123438 130-134 AGCACAC 40 0.0076588374 18.123438 135-139 GCACACG 40 0.0076588374 18.123438 135-139 >>END_MODULE SRR7170879 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170879_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.69225 33.0 33.0 34.0 32.0 34.0 2 32.82325 33.0 33.0 34.0 32.0 34.0 3 32.9015 33.0 33.0 34.0 32.0 34.0 4 32.91425 34.0 33.0 34.0 32.0 34.0 5 32.93825 33.0 33.0 34.0 32.0 34.0 6 37.1455 38.0 38.0 38.0 36.0 38.0 7 37.14325 38.0 38.0 38.0 37.0 38.0 8 36.917 38.0 38.0 38.0 36.0 38.0 9 37.08725 38.0 38.0 38.0 36.0 38.0 10-14 37.071799999999996 38.0 38.0 38.0 36.2 38.0 15-19 37.1011 38.0 38.0 38.0 36.4 38.0 20-24 37.01365 38.0 38.0 38.0 36.0 38.0 25-29 36.97375 38.0 38.0 38.0 36.0 38.0 30-34 36.9321 38.0 38.0 38.0 36.0 38.0 35-39 36.91695 38.0 38.0 38.0 35.8 38.0 40-44 36.89005 38.0 38.0 38.0 36.0 38.0 45-49 36.787549999999996 38.0 38.0 38.0 35.8 38.0 50-54 36.789049999999996 38.0 38.0 38.0 35.8 38.0 55-59 36.69584999999999 38.0 38.0 38.0 35.0 38.0 60-64 36.72695 38.0 38.0 38.0 35.0 38.0 65-69 36.527 38.0 38.0 38.0 34.4 38.0 70-74 36.56735 38.0 38.0 38.0 34.4 38.0 75-79 36.516200000000005 38.0 38.0 38.0 34.2 38.0 80-84 36.24825 38.0 38.0 38.0 34.0 38.0 85-89 36.14875 38.0 38.0 38.0 33.6 38.0 90-94 35.979200000000006 38.0 37.4 38.0 33.2 38.0 95-99 35.82505 38.0 37.0 38.0 31.8 38.0 100-104 35.59525000000001 38.0 37.0 38.0 30.6 38.0 105-109 35.379450000000006 38.0 37.0 38.0 29.4 38.0 110-114 35.1834 38.0 36.4 38.0 29.2 38.0 115-119 34.8596 38.0 35.8 38.0 27.2 38.0 120-124 34.584050000000005 38.0 35.2 38.0 25.8 38.0 125-129 34.2075 38.0 34.8 38.0 23.6 38.0 130-134 33.5569 38.0 33.6 38.0 21.8 38.0 135-139 33.116099999999996 38.0 33.0 38.0 17.4 38.0 140-144 32.04575 38.0 32.0 38.0 13.0 38.0 145-149 30.528999999999996 37.0 29.4 38.0 6.0 38.0 150-151 24.546 32.0 14.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 2.0 5 0.0 6 2.0 7 2.0 8 3.0 9 1.0 10 2.0 11 2.0 12 4.0 13 1.0 14 5.0 15 3.0 16 3.0 17 7.0 18 4.0 19 12.0 20 9.0 21 8.0 22 14.0 23 14.0 24 24.0 25 17.0 26 23.0 27 35.0 28 34.0 29 52.0 30 70.0 31 89.0 32 119.0 33 127.0 34 192.0 35 352.0 36 840.0 37 1922.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.975 19.925 10.525 20.575 2 25.55 24.224999999999998 32.85 17.375 3 20.275000000000002 28.275 31.85 19.6 4 23.45 34.55 23.025000000000002 18.975 5 22.55563890972743 37.609402350587644 23.1807951987997 16.65416354088522 6 19.575 36.95 24.9 18.575 7 19.625 19.375 39.925 21.075 8 21.5 23.95 27.075 27.474999999999998 9 20.724999999999998 25.224999999999998 29.425 24.625 10-14 23.615 28.535 27.015 20.835 15-19 23.05 28.465 28.03 20.455000000000002 20-24 22.634999999999998 28.735 28.405 20.225 25-29 23.275000000000002 28.705000000000002 28.13 19.89 30-34 22.6 28.785 28.389999999999997 20.225 35-39 22.705000000000002 28.4 28.415000000000003 20.48 40-44 22.79 28.04 28.76 20.41 45-49 22.975 28.475 28.144999999999996 20.405 50-54 22.915 28.139999999999997 28.37 20.575 55-59 23.87 27.445000000000004 28.9 19.785 60-64 22.925 28.17 28.134999999999998 20.77 65-69 23.0 27.794999999999998 28.555000000000003 20.65 70-74 22.97 28.43 28.125 20.474999999999998 75-79 23.330000000000002 27.96 28.165000000000003 20.544999999999998 80-84 22.67 28.605000000000004 27.97 20.755000000000003 85-89 23.544999999999998 28.144999999999996 28.015 20.294999999999998 90-94 23.46 28.365000000000002 27.655 20.52 95-99 23.255 27.765 28.345 20.635 100-104 23.735 28.305000000000003 28.17 19.79 105-109 23.674999999999997 27.860000000000003 28.439999999999998 20.025000000000002 110-114 23.905 28.095 28.095 19.905 115-119 24.51 28.68 27.37 19.439999999999998 120-124 24.485 28.32 27.575 19.62 125-129 24.654999999999998 27.875 27.894999999999996 19.575 130-134 25.064999999999998 27.985 27.395000000000003 19.555 135-139 25.405 27.675 27.58 19.34 140-144 25.155 28.185 27.034999999999997 19.625 145-149 26.115 27.48 27.185 19.220000000000002 150-151 25.7625 26.875 27.425 19.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 2.0 21 0.0 22 0.5 23 1.0 24 1.5 25 4.5 26 6.5 27 7.5 28 8.0 29 9.5 30 17.0 31 24.5 32 33.5 33 43.0 34 58.0 35 68.5 36 84.0 37 122.0 38 159.0 39 180.0 40 196.5 41 229.5 42 257.0 43 287.5 44 294.5 45 279.0 46 272.5 47 245.5 48 216.0 49 192.5 50 154.0 51 117.5 52 88.5 53 71.0 54 67.5 55 52.0 56 38.5 57 29.0 58 21.0 59 20.0 60 15.0 61 7.5 62 5.0 63 3.0 64 1.0 65 1.0 66 1.0 67 0.5 68 0.0 69 1.0 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47143216712811 98.8 2 0.45305814246161585 0.8999999999999999 3 0.025169896803423106 0.075 4 0.025169896803423106 0.1 5 0.025169896803423106 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.2375 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.6125 0.0 0.0 0.0 0.0 102-103 1.8250000000000002 0.0 0.0 0.0 0.0 104-105 2.1875 0.0 0.0 0.0 0.0 106-107 2.575 0.0 0.0 0.0 0.0 108-109 2.825 0.0 0.0 0.0 0.0 110-111 3.2 0.0 0.0 0.0 0.0 112-113 3.6125 0.0 0.0 0.0 0.0 114-115 4.05 0.0 0.0 0.0 0.0 116-117 4.5875 0.0 0.0 0.0 0.0 118-119 5.05 0.0 0.0 0.0 0.0 120-121 5.487500000000001 0.0 0.0 0.0 0.0 122-123 5.825 0.0 0.0 0.0 0.0 124-125 6.3375 0.0 0.0 0.0 0.0 126-127 6.8625 0.0 0.0 0.0 0.0 128-129 7.475 0.0 0.0 0.0 0.0 130-131 8.2 0.0 0.0 0.0 0.0 132-133 8.837499999999999 0.0 0.0 0.0 0.0 134-135 9.6375 0.0 0.0 0.0 0.0 136-137 10.5125 0.0 0.0 0.0 0.0 138-139 11.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTAGG 30 0.0014437955 24.166668 140-144 GCGTCGT 30 0.0014437955 24.166668 135-139 AGCGTCG 30 0.0014437955 24.166668 135-139 GAAGAGC 40 0.0076550315 18.125 130-134 CGTGTAG 40 0.0076550315 18.125 140-144 >>END_MODULE Read 782689 spots for SRR7170879.sra Written 782689 spots for SRR7170879.sra Read 782689 spots for SRR7170879.sra Written 782689 spots for SRR7170879.sra Read 782689 spots for SRR7170879.sra Written 782689 spots for SRR7170879.sra Read 782689 spots for SRR7170879.sra Written 782689 spots for SRR7170879.sra Read 782689 spots for SRR7170879.sra Written 782689 spots for SRR7170879.sra Read 782689 spots for SRR7170879.sra Written 782689 spots for SRR7170879.sra Read 782689 spots for SRR7170879.sra Written 782689 spots for SRR7170879.sra Read 782689 spots for SRR7170879.sra Written 782689 spots for SRR7170879.sra Read 782689 spots for SRR7170879.sra Written 782689 spots for SRR7170879.sra Read 782689 spots for SRR7170879.sra Written 782689 spots for SRR7170879.sra Read 782689 spots for SRR7170879.sra Written 782689 spots for SRR7170879.sra Read 782689 spots for SRR7170879.sra Written 782689 spots for SRR7170879.sra Read 782689 spots for SRR7170879.sra Written 782689 spots for SRR7170879.sra Read 782703 spots for SRR7170879.sra Written 782703 spots for SRR7170879.sra Read 782689 spots for SRR7170879.sra Written 782689 spots for SRR7170879.sra Read 782689 spots for SRR7170879.sra Written 782689 spots for SRR7170879.sra Read 782689 spots for SRR7170879.sra Written 782689 spots for SRR7170879.sra Read 782689 spots for SRR7170879.sra Written 782689 spots for SRR7170879.sra Read 782689 spots for SRR7170879.sra Written 782689 spots for SRR7170879.sra Read 782689 spots for SRR7170879.sra Written 782689 spots for SRR7170879.sra SRR ids: ['SRR7170879.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3t6w32ew SRR7170879.sra spots: 15653794 blocks: [[1, 782689], [782690, 1565378], [1565379, 2348067], [2348068, 3130756], [3130757, 3913445], [3913446, 4696134], [4696135, 5478823], [5478824, 6261512], [6261513, 7044201], [7044202, 7826890], [7826891, 8609579], [8609580, 9392268], [9392269, 10174957], [10174958, 10957646], [10957647, 11740335], [11740336, 12523024], [12523025, 13305713], [13305714, 14088402], [14088403, 14871091], [14871092, 15653794]] SRR7170879 file size 5282856 SRR7170879 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170879 SRR7170879_1.fastq SRR7170879_2.fastq Input file: SRR7170879_1.fastq Paired file: SRR7170879_2.fastq trimmed: SRR7170879-trimmed-pair1.fastq, SRR7170879-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:07:21 2025 >> started Thu Feb 13 21:07:38 2025 >> done (17.029s) 15653794 read pairs processed; of these: 29626 ( 0.19%) short read pairs filtered out after trimming by size control 31940 ( 0.20%) empty read pairs filtered out after trimming by size control 15592228 (99.61%) read pairs available; of these: 11080246 (71.06%) trimmed read pairs available after processing 4511982 (28.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 14 0.00% 20 13 0.00% 21 16 0.00% 22 23 0.00% 23 19 0.00% 24 19 0.00% 25 23 0.00% 26 21 0.00% 27 16 0.00% 28 28 0.00% 29 24 0.00% 30 29 0.00% 31 24 0.00% 32 20 0.00% 33 18 0.00% 34 26 0.00% 35 23 0.00% 36 30 0.00% 37 41 0.00% 38 50 0.00% 39 42 0.00% 40 65 0.00% 41 68 0.00% 42 74 0.00% 43 75 0.00% 44 65 0.00% 45 88 0.00% 46 100 0.00% 47 98 0.00% 48 117 0.00% 49 113 0.00% 50 177 0.00% 51 219 0.00% 52 230 0.00% 53 262 0.00% 54 257 0.00% 55 298 0.00% 56 348 0.00% 57 372 0.00% 58 417 0.00% 59 484 0.00% 60 552 0.00% 61 679 0.00% 62 798 0.01% 63 865 0.01% 64 924 0.01% 65 1000 0.01% 66 1168 0.01% 67 1272 0.01% 68 1403 0.01% 69 1649 0.01% 70 1844 0.01% 71 2216 0.01% 72 2633 0.02% 73 3018 0.02% 74 3238 0.02% 75 3668 0.02% 76 4876 0.03% 77 5090 0.03% 78 4567 0.03% 79 4839 0.03% 80 5494 0.04% 81 6464 0.04% 82 7458 0.05% 83 8830 0.06% 84 10316 0.07% 85 10577 0.07% 86 11106 0.07% 87 11731 0.08% 88 11937 0.08% 89 13060 0.08% 90 14075 0.09% 91 15218 0.10% 92 16706 0.11% 93 18596 0.12% 94 19916 0.13% 95 20700 0.13% 96 21301 0.14% 97 21910 0.14% 98 22188 0.14% 99 23089 0.15% 100 24738 0.16% 101 26855 0.17% 102 29158 0.19% 103 31411 0.20% 104 33000 0.21% 105 34873 0.22% 106 35659 0.23% 107 35686 0.23% 108 36335 0.23% 109 37050 0.24% 110 38554 0.25% 111 40841 0.26% 112 43237 0.28% 113 45711 0.29% 114 48523 0.31% 115 50948 0.33% 116 51721 0.33% 117 52858 0.34% 118 53361 0.34% 119 54064 0.35% 120 56174 0.36% 121 58147 0.37% 122 60595 0.39% 123 65230 0.42% 124 69706 0.45% 125 72510 0.47% 126 75496 0.48% 127 77109 0.49% 128 79136 0.51% 129 81530 0.52% 130 84477 0.54% 131 88863 0.57% 132 94364 0.61% 133 101510 0.65% 134 108795 0.70% 135 117631 0.75% 136 124913 0.80% 137 133176 0.85% 138 143706 0.92% 139 153077 0.98% 140 165380 1.06% 141 181127 1.16% 142 203966 1.31% 143 231583 1.49% 144 266114 1.71% 145 315969 2.03% 146 392401 2.52% 147 515328 3.31% 148 742764 4.76% 149 1274371 8.17% 150 3799095 24.37% 151 4511982 28.94% 15592228 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.80 fanout-score-rank=20 prefix-density=0.38 prefix-fanout=3.0 sequence=CCAATTCTCGAGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=17.52 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=2.5 sequence=TGCTTGCTTCTTCTAATCCACTGGAGAACTTT criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=27 prefix-density=0.72 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=78.39 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.2 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGC SRR7170879 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:08:32 Started mapping on | Feb 13 21:08:33 Finished on | Feb 13 21:10:29 Mapping speed, Million of reads per hour | 483.90 Number of input reads | 15592228 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 14512659 Uniquely mapped reads % | 93.08% Average mapped length | 286.57 Number of splices: Total | 13526742 Number of splices: Annotated (sjdb) | 13147932 Number of splices: GT/AG | 13275693 Number of splices: GC/AG | 184412 Number of splices: AT/AC | 9092 Number of splices: Non-canonical | 57545 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 483413 % of reads mapped to multiple loci | 3.10% Number of reads mapped to too many loci | 27483 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.57% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 618438 618438 618438 N_multimapping 483413 483413 483413 N_noFeature 647455 14264270 765720 N_ambiguous 259723 1161 128996 UnstrandedReadsAssigned:13605481 PositiveStrandReadsAssigned:247228 NegativeStrandReadsAssigned:13617943 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=140 echo kmer=135 SRR7170879 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170879-trimmed-pair1.fastq SRR7170879-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,592,228 reads, 13,632,593 reads pseudoaligned [quant] estimated average fragment length: 225.077 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52401 SRR7170879.ke.tsv 34699 SRR7170879.se.tsv 87100 total ==> SRR7170879.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.92 2078 83.641 Potri.005G024800.1.v4.1 1035 810.923 364 32.4115 Potri.004G059700.1.v4.1 961 736.99 5 0.489876 Potri.007G009000.2.v4.1 1416 1191.92 0 0 Potri.003G141000.2.v4.1 2943 2718.92 863 22.9188 Potri.016G087400.1.v4.1 270 92.2901 1134.79 887.843 Potri.015G069301.1.v4.1 564 345.61 0 0 Potri.010G195200.1.v4.1 1773 1548.92 848 39.5315 Potri.012G127500.1.v4.1 977 752.954 469 44.9761 ==> SRR7170879.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 291 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 238 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 346 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 15 SRR7170879 completed mapping pipeline successfully