Starting /dee2/code/volunteer_pipeline.sh SRR7170880 current disk space = 3088210243584 free memory = 1580160636 SRR7170880 SRAfilesize d9e249034fa71f8827794bd9aa0039c0 SRR7170880.sra SRR7170880.sra file validated SRR7170880 is paired end SRR7170880 is conventional basespace SRR7170880 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170880_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.39225 34.0 33.0 34.0 32.0 34.0 2 33.099 34.0 33.0 34.0 32.0 34.0 3 33.17175 34.0 33.0 34.0 32.0 34.0 4 33.1965 34.0 33.0 34.0 32.0 34.0 5 33.1915 34.0 33.0 34.0 32.0 34.0 6 36.6715 38.0 37.0 38.0 34.0 38.0 7 37.09 38.0 38.0 38.0 36.0 38.0 8 37.24375 38.0 38.0 38.0 36.0 38.0 9 37.27625 38.0 38.0 38.0 37.0 38.0 10-14 37.30705 38.0 38.0 38.0 36.6 38.0 15-19 37.2352 38.0 38.0 38.0 36.4 38.0 20-24 37.160799999999995 38.0 38.0 38.0 36.2 38.0 25-29 37.1063 38.0 38.0 38.0 36.0 38.0 30-34 37.1048 38.0 38.0 38.0 36.0 38.0 35-39 37.01715 38.0 38.0 38.0 36.0 38.0 40-44 36.93059999999999 38.0 38.0 38.0 35.2 38.0 45-49 36.9014 38.0 38.0 38.0 35.2 38.0 50-54 36.68725 38.0 38.0 38.0 34.4 38.0 55-59 36.67955 38.0 38.0 38.0 34.4 38.0 60-64 36.662150000000004 38.0 38.0 38.0 34.4 38.0 65-69 36.53415 38.0 38.0 38.0 34.0 38.0 70-74 36.48755 38.0 38.0 38.0 34.0 38.0 75-79 36.25915 38.0 37.4 38.0 33.8 38.0 80-84 36.0313 38.0 37.0 38.0 32.6 38.0 85-89 36.1192 38.0 37.0 38.0 32.8 38.0 90-94 35.79495000000001 38.0 36.8 38.0 30.6 38.0 95-99 35.637800000000006 38.0 36.2 38.0 30.4 38.0 100-104 35.49159999999999 38.0 36.2 38.0 29.4 38.0 105-109 35.184250000000006 38.0 36.0 38.0 28.4 38.0 110-114 34.944900000000004 38.0 35.4 38.0 28.0 38.0 115-119 34.59715 38.0 34.8 38.0 25.4 38.0 120-124 34.18925 38.0 33.8 38.0 23.8 38.0 125-129 33.559799999999996 38.0 33.0 38.0 20.0 38.0 130-134 32.964749999999995 38.0 32.4 38.0 16.8 38.0 135-139 32.2042 37.2 31.0 38.0 14.0 38.0 140-144 31.349100000000004 36.6 29.4 38.0 12.8 38.0 145-149 29.81725 36.0 28.0 38.0 5.8 38.0 150-151 23.366999999999997 29.0 11.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 2.0 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 3.0 17 3.0 18 3.0 19 5.0 20 13.0 21 9.0 22 10.0 23 10.0 24 14.0 25 26.0 26 37.0 27 45.0 28 48.0 29 64.0 30 80.0 31 85.0 32 122.0 33 214.0 34 270.0 35 513.0 36 1029.0 37 1391.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.57348037958451 15.285970761733777 10.02821236214414 38.11233649653757 2 20.349999999999998 19.25 38.2 22.2 3 17.150000000000002 26.674999999999997 27.950000000000003 28.225 4 22.15 33.525 23.175 21.15 5 22.230557639409852 35.80895223805952 23.78094523630908 18.179544886221557 6 17.7 35.275 27.700000000000003 19.325 7 14.424999999999999 22.475 43.5 19.6 8 16.725 22.825 32.2 28.249999999999996 9 17.75 23.075000000000003 32.300000000000004 26.875 10-14 19.900000000000002 29.065 27.389999999999997 23.645 15-19 19.46 28.49 28.265 23.785 20-24 19.345000000000002 28.265 28.54 23.849999999999998 25-29 19.775000000000002 29.054999999999996 27.875 23.294999999999998 30-34 19.895 28.310000000000002 28.37 23.425 35-39 19.765 29.189999999999998 27.650000000000002 23.395 40-44 20.165 28.51 27.93 23.395 45-49 20.175 28.065 28.305000000000003 23.455000000000002 50-54 19.814999999999998 28.185 28.199999999999996 23.799999999999997 55-59 20.19 28.405 28.470000000000002 22.935 60-64 20.16 28.494999999999997 27.98 23.365 65-69 19.925 28.74 27.634999999999998 23.7 70-74 19.314999999999998 29.165000000000003 27.42 24.099999999999998 75-79 20.465 28.395 27.54 23.599999999999998 80-84 20.24 28.555000000000003 27.655 23.549999999999997 85-89 19.86 28.38 28.515 23.244999999999997 90-94 20.31 28.825 27.065 23.799999999999997 95-99 20.549999999999997 28.435 27.715 23.3 100-104 19.869999999999997 28.965000000000003 27.71 23.455000000000002 105-109 20.544999999999998 28.83 26.845000000000002 23.78 110-114 20.13 28.37 27.665 23.835 115-119 20.745 28.910000000000004 27.295 23.05 120-124 20.46 28.54 27.08 23.919999999999998 125-129 20.990000000000002 28.425 27.305 23.28 130-134 20.73 28.365000000000002 26.5 24.404999999999998 135-139 20.95 28.26 27.12 23.669999999999998 140-144 20.979999999999997 28.075 26.57 24.375 145-149 21.165 28.155 26.87 23.810000000000002 150-151 20.525 29.212500000000002 26.8625 23.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.5 14 1.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 2.0 22 2.5 23 3.0 24 5.5 25 6.5 26 7.0 27 9.0 28 11.0 29 15.0 30 22.5 31 28.0 32 33.5 33 50.5 34 67.5 35 94.0 36 116.0 37 121.0 38 143.0 39 162.5 40 190.5 41 228.0 42 242.0 43 250.0 44 250.5 45 249.0 46 251.5 47 235.0 48 206.0 49 193.5 50 175.0 51 145.0 52 126.0 53 90.0 54 55.0 55 48.5 56 47.0 57 34.5 58 20.5 59 16.5 60 12.5 61 6.0 62 6.0 63 6.5 64 4.5 65 2.5 66 0.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5250000000000004 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.3875 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.4875 0.0 0.0 0.0 0.0 110-111 2.8125 0.0 0.0 0.0 0.0 112-113 3.175 0.0 0.0 0.0 0.0 114-115 3.575 0.0 0.0 0.0 0.0 116-117 4.0875 0.0 0.0 0.0 0.0 118-119 4.550000000000001 0.0 0.0 0.0 0.0 120-121 4.975 0.0 0.0 0.0 0.0 122-123 5.4125 0.0 0.0 0.0 0.0 124-125 6.074999999999999 0.0 0.0 0.0 0.0 126-127 6.6 0.0 0.0 0.0 0.0 128-129 7.3 0.0 0.0 0.0 0.0 130-131 7.9875 0.0 0.0 0.0 0.0 132-133 8.587499999999999 0.0 0.0 0.0 0.0 134-135 9.2375 0.0 0.0 0.0 0.0 136-137 9.975000000000001 0.0 0.0 0.0 0.0 138-139 10.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTCCC 10 0.006832588 144.9875 145 AGCTGAA 10 0.006832588 144.9875 3 >>END_MODULE SRR7170880 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170880_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.725 33.0 33.0 34.0 32.0 34.0 2 32.77425 33.0 33.0 34.0 32.0 34.0 3 32.828 33.0 33.0 34.0 32.0 34.0 4 32.8665 34.0 33.0 34.0 32.0 34.0 5 32.845 34.0 33.0 34.0 32.0 34.0 6 37.04325 38.0 38.0 38.0 37.0 38.0 7 37.1165 38.0 38.0 38.0 36.0 38.0 8 36.85175 38.0 38.0 38.0 36.0 38.0 9 36.90175 38.0 38.0 38.0 36.0 38.0 10-14 37.034299999999995 38.0 38.0 38.0 36.0 38.0 15-19 37.082550000000005 38.0 38.0 38.0 36.0 38.0 20-24 37.0344 38.0 38.0 38.0 36.2 38.0 25-29 36.9667 38.0 38.0 38.0 35.8 38.0 30-34 36.9028 38.0 38.0 38.0 36.0 38.0 35-39 36.89145 38.0 38.0 38.0 36.0 38.0 40-44 36.86 38.0 38.0 38.0 35.6 38.0 45-49 36.826 38.0 38.0 38.0 36.0 38.0 50-54 36.7603 38.0 38.0 38.0 35.4 38.0 55-59 36.75765 38.0 38.0 38.0 35.2 38.0 60-64 36.69625 38.0 38.0 38.0 35.0 38.0 65-69 36.6378 38.0 38.0 38.0 34.6 38.0 70-74 36.544349999999994 38.0 38.0 38.0 34.0 38.0 75-79 36.4601 38.0 38.0 38.0 34.0 38.0 80-84 36.30615 38.0 38.0 38.0 34.0 38.0 85-89 36.19535 38.0 38.0 38.0 33.4 38.0 90-94 35.941199999999995 38.0 37.2 38.0 32.6 38.0 95-99 35.8526 38.0 37.0 38.0 32.2 38.0 100-104 35.6238 38.0 37.0 38.0 31.0 38.0 105-109 35.4784 38.0 37.0 38.0 30.2 38.0 110-114 35.2506 38.0 36.4 38.0 29.2 38.0 115-119 34.86280000000001 38.0 35.8 38.0 27.0 38.0 120-124 34.58365 38.0 35.2 38.0 25.4 38.0 125-129 34.2243 38.0 34.8 38.0 23.6 38.0 130-134 33.7956 38.0 33.8 38.0 21.8 38.0 135-139 33.29275 38.0 33.0 38.0 20.0 38.0 140-144 32.37835 38.0 32.8 38.0 13.4 38.0 145-149 30.7605 37.4 30.0 38.0 6.0 38.0 150-151 24.905625 32.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 3.0 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 3.0 11 1.0 12 2.0 13 4.0 14 2.0 15 6.0 16 5.0 17 1.0 18 5.0 19 7.0 20 12.0 21 15.0 22 13.0 23 11.0 24 22.0 25 23.0 26 31.0 27 35.0 28 40.0 29 52.0 30 56.0 31 85.0 32 104.0 33 122.0 34 218.0 35 336.0 36 788.0 37 1990.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.35 18.3 13.65 28.7 2 25.525 24.474999999999998 34.175 15.825 3 19.979994998749685 28.132033008252062 31.207801950487625 20.68017004251063 4 23.724999999999998 35.0 22.55 18.725 5 23.386693346673336 36.99349674837419 22.18609304652326 17.433716858429214 6 19.425 36.925000000000004 25.374999999999996 18.275 7 18.425 18.65 43.375 19.55 8 21.65 23.525 28.799999999999997 26.025 9 21.525 24.2 29.025000000000002 25.25 10-14 22.720000000000002 28.935 26.665 21.68 15-19 23.21 27.575 28.410000000000004 20.805 20-24 23.51 28.105000000000004 27.88 20.505000000000003 25-29 22.105 28.685 28.73 20.48 30-34 22.505 28.09 28.74 20.665 35-39 22.689999999999998 28.215 28.23 20.865000000000002 40-44 22.625 28.175 28.58 20.62 45-49 22.605 27.875 28.48 21.04 50-54 23.325000000000003 28.405 27.92 20.349999999999998 55-59 23.255 27.450000000000003 28.22 21.075 60-64 22.935 27.800000000000004 27.944999999999997 21.32 65-69 23.31 27.495000000000005 28.660000000000004 20.535 70-74 23.005 28.355000000000004 27.395000000000003 21.245 75-79 22.81 28.555000000000003 27.79 20.845 80-84 23.695 27.634999999999998 27.61 21.060000000000002 85-89 23.150000000000002 28.23 27.98 20.64 90-94 23.815 27.644999999999996 27.505000000000003 21.035 95-99 23.455000000000002 28.375 27.6 20.57 100-104 22.97 28.01 28.18 20.84 105-109 23.955000000000002 28.78 27.279999999999998 19.985 110-114 23.28 28.4 27.82 20.5 115-119 24.345 28.310000000000002 27.825 19.52 120-124 24.695 28.365000000000002 27.41 19.53 125-129 24.44 27.87 27.26 20.43 130-134 24.72 27.925 27.33 20.025000000000002 135-139 24.98 27.575 27.439999999999998 20.005 140-144 25.115 28.325 26.665 19.895 145-149 24.9 27.82 27.150000000000002 20.13 150-151 25.525 27.900000000000002 27.287499999999998 19.287499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 1.5 12 1.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.5 24 2.5 25 4.0 26 6.0 27 8.5 28 13.5 29 19.5 30 19.0 31 21.5 32 35.0 33 43.0 34 51.0 35 74.0 36 95.5 37 111.5 38 131.0 39 167.0 40 204.0 41 210.5 42 235.5 43 262.0 44 267.5 45 271.0 46 245.5 47 232.5 48 215.5 49 202.5 50 184.0 51 142.5 52 118.0 53 95.5 54 82.5 55 62.0 56 40.0 57 32.5 58 24.0 59 19.5 60 15.5 61 8.5 62 6.0 63 4.0 64 4.0 65 2.5 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08883826879271 97.875 2 0.7339913945836497 1.4500000000000002 3 0.12655024044545685 0.375 4 0.0 0.0 5 0.02531004808909137 0.125 6 0.0 0.0 7 0.02531004808909137 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.3875 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.85 0.0 0.0 0.0 0.0 106-107 2.1625 0.0 0.0 0.0 0.0 108-109 2.45 0.0 0.0 0.0 0.0 110-111 2.7750000000000004 0.0 0.0 0.0 0.0 112-113 3.15 0.0 0.0 0.0 0.0 114-115 3.55 0.0 0.0 0.0 0.0 116-117 4.0875 0.0 0.0 0.0 0.0 118-119 4.5375 0.0 0.0 0.0 0.0 120-121 4.949999999999999 0.0 0.0 0.0 0.0 122-123 5.3875 0.0 0.0 0.0 0.0 124-125 6.050000000000001 0.0 0.0 0.0 0.0 126-127 6.5625 0.0 0.0 0.0 0.0 128-129 7.225 0.0 0.0 0.0 0.0 130-131 7.9375 0.0 0.0 0.0 0.0 132-133 8.537500000000001 0.0 0.0 0.0 0.0 134-135 9.1875 0.0 0.0 0.0 0.0 136-137 9.899999999999999 0.0 0.0 0.0 0.0 138-139 10.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATTC 10 0.006830828 145.0 2 GTCAACC 10 0.006830828 145.0 1 AAAAAAA 40 0.0076550315 18.125 70-74 >>END_MODULE Read 979813 spots for SRR7170880.sra Written 979813 spots for SRR7170880.sra Read 979813 spots for SRR7170880.sra Written 979813 spots for SRR7170880.sra Read 979813 spots for SRR7170880.sra Written 979813 spots for SRR7170880.sra Read 979813 spots for SRR7170880.sra Written 979813 spots for SRR7170880.sra Read 979813 spots for SRR7170880.sra Written 979813 spots for SRR7170880.sra Read 979813 spots for SRR7170880.sra Written 979813 spots for SRR7170880.sra Read 979813 spots for SRR7170880.sra Written 979813 spots for SRR7170880.sra Read 979813 spots for SRR7170880.sra Written 979813 spots for SRR7170880.sra Read 979813 spots for SRR7170880.sra Written 979813 spots for SRR7170880.sra Read 979813 spots for SRR7170880.sra Written 979813 spots for SRR7170880.sra Read 979813 spots for SRR7170880.sra Written 979813 spots for SRR7170880.sra Read 979813 spots for SRR7170880.sra Written 979813 spots for SRR7170880.sra Read 979813 spots for SRR7170880.sra Written 979813 spots for SRR7170880.sra Read 979813 spots for SRR7170880.sra Written 979813 spots for SRR7170880.sra Read 979813 spots for SRR7170880.sra Written 979813 spots for SRR7170880.sra Read 979813 spots for SRR7170880.sra Written 979813 spots for SRR7170880.sra Read 979826 spots for SRR7170880.sra Written 979826 spots for SRR7170880.sra Read 979813 spots for SRR7170880.sra Written 979813 spots for SRR7170880.sra Read 979813 spots for SRR7170880.sra Written 979813 spots for SRR7170880.sra Read 979813 spots for SRR7170880.sra Written 979813 spots for SRR7170880.sra SRR ids: ['SRR7170880.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jt4ywrqi SRR7170880.sra spots: 19596273 blocks: [[1, 979813], [979814, 1959626], [1959627, 2939439], [2939440, 3919252], [3919253, 4899065], [4899066, 5878878], [5878879, 6858691], [6858692, 7838504], [7838505, 8818317], [8818318, 9798130], [9798131, 10777943], [10777944, 11757756], [11757757, 12737569], [12737570, 13717382], [13717383, 14697195], [14697196, 15677008], [15677009, 16656821], [16656822, 17636634], [17636635, 18616447], [18616448, 19596273]] SRR7170880 file size 6618833 SRR7170880 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170880 SRR7170880_1.fastq SRR7170880_2.fastq Input file: SRR7170880_1.fastq Paired file: SRR7170880_2.fastq trimmed: SRR7170880-trimmed-pair1.fastq, SRR7170880-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:30:17 2025 >> started Thu Feb 13 21:30:41 2025 >> done (23.213s) 19596273 read pairs processed; of these: 19912 ( 0.10%) short read pairs filtered out after trimming by size control 21026 ( 0.11%) empty read pairs filtered out after trimming by size control 19555335 (99.79%) read pairs available; of these: 13365296 (68.35%) trimmed read pairs available after processing 6190039 (31.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 9 0.00% 20 8 0.00% 21 10 0.00% 22 13 0.00% 23 12 0.00% 24 12 0.00% 25 10 0.00% 26 19 0.00% 27 11 0.00% 28 20 0.00% 29 18 0.00% 30 19 0.00% 31 15 0.00% 32 22 0.00% 33 23 0.00% 34 20 0.00% 35 20 0.00% 36 21 0.00% 37 31 0.00% 38 28 0.00% 39 53 0.00% 40 46 0.00% 41 54 0.00% 42 67 0.00% 43 69 0.00% 44 68 0.00% 45 77 0.00% 46 85 0.00% 47 94 0.00% 48 119 0.00% 49 145 0.00% 50 167 0.00% 51 199 0.00% 52 200 0.00% 53 220 0.00% 54 243 0.00% 55 271 0.00% 56 322 0.00% 57 320 0.00% 58 428 0.00% 59 481 0.00% 60 536 0.00% 61 610 0.00% 62 709 0.00% 63 767 0.00% 64 872 0.00% 65 949 0.00% 66 1061 0.01% 67 1225 0.01% 68 1284 0.01% 69 1558 0.01% 70 1655 0.01% 71 2001 0.01% 72 2318 0.01% 73 2709 0.01% 74 2992 0.02% 75 3234 0.02% 76 4212 0.02% 77 4216 0.02% 78 4211 0.02% 79 4661 0.02% 80 5336 0.03% 81 5972 0.03% 82 6857 0.04% 83 7779 0.04% 84 9432 0.05% 85 9561 0.05% 86 10272 0.05% 87 11138 0.06% 88 11501 0.06% 89 12477 0.06% 90 13604 0.07% 91 14695 0.08% 92 16140 0.08% 93 17531 0.09% 94 19156 0.10% 95 20261 0.10% 96 21074 0.11% 97 22234 0.11% 98 22619 0.12% 99 24288 0.12% 100 25821 0.13% 101 26970 0.14% 102 29393 0.15% 103 31156 0.16% 104 32529 0.17% 105 34258 0.18% 106 35709 0.18% 107 37059 0.19% 108 38442 0.20% 109 39928 0.20% 110 41416 0.21% 111 43293 0.22% 112 45816 0.23% 113 47608 0.24% 114 50666 0.26% 115 52404 0.27% 116 54740 0.28% 117 55877 0.29% 118 58099 0.30% 119 59735 0.31% 120 62365 0.32% 121 64278 0.33% 122 67163 0.34% 123 70024 0.36% 124 74348 0.38% 125 77663 0.40% 126 81034 0.41% 127 84292 0.43% 128 87357 0.45% 129 91980 0.47% 130 95915 0.49% 131 100363 0.51% 132 106603 0.55% 133 114336 0.58% 134 120411 0.62% 135 129632 0.66% 136 138474 0.71% 137 149522 0.76% 138 161300 0.82% 139 173516 0.89% 140 189971 0.97% 141 208563 1.07% 142 233978 1.20% 143 265542 1.36% 144 307252 1.57% 145 366699 1.88% 146 460551 2.36% 147 612085 3.13% 148 900731 4.61% 149 1585165 8.11% 150 5015475 25.65% 151 6190039 31.65% 19555335 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=11 prefix-density=0.54 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=40.39 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=8.1 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.99 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=26 prefix-density=0.98 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=8.83 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=3.0 sequence=CAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCA SRR7170880 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:31:34 Started mapping on | Feb 13 21:31:35 Finished on | Feb 13 21:34:04 Mapping speed, Million of reads per hour | 472.48 Number of input reads | 19555335 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 18411979 Uniquely mapped reads % | 94.15% Average mapped length | 288.94 Number of splices: Total | 17717155 Number of splices: Annotated (sjdb) | 17296126 Number of splices: GT/AG | 17375833 Number of splices: GC/AG | 274768 Number of splices: AT/AC | 9566 Number of splices: Non-canonical | 56988 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 417448 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 82835 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.20% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 740579 740579 740579 N_multimapping 417448 417448 417448 N_noFeature 833898 18050939 991401 N_ambiguous 335071 1443 130549 UnstrandedReadsAssigned:17243010 PositiveStrandReadsAssigned:359597 NegativeStrandReadsAssigned:17290029 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR7170880 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170880-trimmed-pair1.fastq SRR7170880-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,555,335 reads, 17,232,879 reads pseudoaligned [quant] estimated average fragment length: 235.072 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52401 SRR7170880.ke.tsv 34699 SRR7170880.se.tsv 87100 total ==> SRR7170880.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.93 465 13.6352 Potri.005G024800.1.v4.1 1035 800.928 146 9.53553 Potri.004G059700.1.v4.1 961 726.969 8 0.575651 Potri.007G009000.2.v4.1 1416 1181.93 0 0 Potri.003G141000.2.v4.1 2943 2708.93 938.47 18.1221 Potri.016G087400.1.v4.1 270 87.85 883 525.78 Potri.015G069301.1.v4.1 564 335.49 0 0 Potri.010G195200.1.v4.1 1773 1538.93 35.7604 1.21554 Potri.012G127500.1.v4.1 977 742.959 108 7.60404 ==> SRR7170880.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 580 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 351 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 1 SRR7170880 completed mapping pipeline successfully