Starting /dee2/code/volunteer_pipeline.sh SRR7170881 current disk space = 3088233635840 free memory = 1464612196 SRR7170881 SRAfilesize 8bb9f5268ce12220024b830045ec848e SRR7170881.sra SRR7170881.sra file validated SRR7170881 is paired end SRR7170881 is conventional basespace SRR7170881 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170881_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.54125 34.0 33.0 34.0 32.0 34.0 2 33.15775 34.0 33.0 34.0 32.0 34.0 3 33.2215 34.0 33.0 34.0 32.0 34.0 4 33.254 34.0 33.0 34.0 32.0 34.0 5 33.23375 34.0 33.0 34.0 33.0 34.0 6 36.63975 38.0 37.0 38.0 34.0 38.0 7 37.09425 38.0 38.0 38.0 36.0 38.0 8 37.2135 38.0 38.0 38.0 36.0 38.0 9 37.24225 38.0 38.0 38.0 37.0 38.0 10-14 37.2516 38.0 38.0 38.0 36.4 38.0 15-19 37.18325 38.0 38.0 38.0 36.0 38.0 20-24 37.14015 38.0 38.0 38.0 36.0 38.0 25-29 37.0724 38.0 38.0 38.0 36.0 38.0 30-34 37.0316 38.0 38.0 38.0 36.0 38.0 35-39 36.93345000000001 38.0 38.0 38.0 35.6 38.0 40-44 36.84705 38.0 38.0 38.0 35.2 38.0 45-49 36.794650000000004 38.0 38.0 38.0 35.0 38.0 50-54 36.58965 38.0 38.0 38.0 34.2 38.0 55-59 36.5594 38.0 38.0 38.0 34.2 38.0 60-64 36.53955 38.0 38.0 38.0 34.2 38.0 65-69 36.366699999999994 38.0 38.0 38.0 34.0 38.0 70-74 36.2895 38.0 37.8 38.0 33.8 38.0 75-79 36.12605 38.0 37.2 38.0 33.2 38.0 80-84 35.87485 38.0 37.0 38.0 32.0 38.0 85-89 35.91279999999999 38.0 37.0 38.0 32.8 38.0 90-94 35.7277 38.0 37.0 38.0 31.4 38.0 95-99 35.40565 38.0 36.2 38.0 29.6 38.0 100-104 35.22165 38.0 36.0 38.0 28.6 38.0 105-109 34.85785 38.0 36.0 38.0 27.4 38.0 110-114 34.7617 38.0 35.0 38.0 26.8 38.0 115-119 34.35575 38.0 34.4 38.0 24.4 38.0 120-124 33.8514 38.0 33.2 38.0 22.2 38.0 125-129 33.3053 38.0 33.0 38.0 19.6 38.0 130-134 32.791700000000006 38.0 32.2 38.0 16.4 38.0 135-139 31.890499999999996 37.4 30.0 38.0 13.6 38.0 140-144 30.898699999999998 36.2 28.6 38.0 12.0 38.0 145-149 29.386149999999997 36.0 27.4 38.0 2.0 38.0 150-151 23.48125 29.5 11.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 3.0 8 1.0 9 2.0 10 1.0 11 0.0 12 0.0 13 4.0 14 4.0 15 2.0 16 3.0 17 1.0 18 7.0 19 10.0 20 13.0 21 12.0 22 14.0 23 11.0 24 23.0 25 29.0 26 35.0 27 38.0 28 55.0 29 70.0 30 75.0 31 103.0 32 136.0 33 170.0 34 299.0 35 467.0 36 1020.0 37 1392.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.815997955532836 18.119090212113466 11.960132890365449 30.104778941988243 2 21.15 19.900000000000002 37.05 21.9 3 17.299999999999997 28.599999999999998 30.925000000000004 23.175 4 20.325 35.3 24.55 19.825 5 20.180045011252815 37.009252313078264 24.731182795698924 18.079519879969993 6 16.5 37.45 25.95 20.1 7 13.750000000000002 24.5 44.15 17.599999999999998 8 16.8 25.3 30.825000000000003 27.075 9 17.25 24.05 31.85 26.85 10-14 19.885 30.12 26.369999999999997 23.625 15-19 18.815 29.345 28.42 23.419999999999998 20-24 18.94 29.365000000000002 28.255000000000003 23.44 25-29 19.48 29.075 28.294999999999998 23.150000000000002 30-34 19.220000000000002 29.185 28.325 23.27 35-39 19.5 28.794999999999998 28.000000000000004 23.705000000000002 40-44 19.805 28.935 27.644999999999996 23.615 45-49 19.85 28.410000000000004 28.189999999999998 23.549999999999997 50-54 20.14 28.59 28.194999999999997 23.075000000000003 55-59 19.965 29.23 27.195000000000004 23.61 60-64 19.54 29.099999999999998 27.57 23.79 65-69 19.975 29.65 27.474999999999998 22.900000000000002 70-74 19.24 29.43 27.74 23.59 75-79 20.13 28.89 27.74 23.24 80-84 19.794999999999998 29.035 27.555000000000003 23.615 85-89 20.135 29.080000000000002 27.584999999999997 23.200000000000003 90-94 20.01 28.794999999999998 27.46 23.735 95-99 19.74 28.675 27.87 23.715 100-104 20.07 28.74 26.97 24.22 105-109 20.135 29.175 27.43 23.26 110-114 20.599999999999998 28.99 26.650000000000002 23.76 115-119 20.665 28.655 26.810000000000002 23.87 120-124 20.755000000000003 28.810000000000002 26.729999999999997 23.705000000000002 125-129 20.68 28.57 26.945000000000004 23.805 130-134 21.18 28.849999999999998 26.615 23.355 135-139 21.12 28.79 26.35 23.74 140-144 21.165 28.03 26.71 24.095 145-149 21.0 28.499999999999996 26.405 24.095 150-151 20.974999999999998 28.237499999999997 26.7625 24.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 0.5 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.5 20 1.5 21 2.0 22 2.0 23 2.0 24 2.0 25 6.0 26 10.0 27 10.0 28 16.0 29 26.0 30 37.5 31 45.0 32 56.5 33 75.5 34 76.5 35 87.5 36 108.0 37 128.5 38 151.5 39 172.5 40 204.0 41 220.5 42 220.5 43 235.5 44 253.5 45 236.0 46 213.5 47 214.5 48 203.0 49 193.5 50 179.0 51 130.0 52 99.0 53 90.0 54 72.5 55 59.0 56 47.0 57 34.0 58 26.5 59 15.0 60 7.0 61 8.0 62 6.0 63 2.0 64 0.5 65 1.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.175 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80437547697787 97.1 2 0.8903586873569066 1.7500000000000002 3 0.2035105571101501 0.6 4 0.05087763927753752 0.2 5 0.02543881963876876 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02543881963876876 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 3 (97% over 36bp) CAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.8374999999999999 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.225 0.0 0.0 0.0 0.0 96-97 1.425 0.0 0.0 0.0 0.0 98-99 1.775 0.0 0.0 0.0 0.0 100-101 2.075 0.0 0.0 0.0 0.0 102-103 2.3625 0.0 0.0 0.0 0.0 104-105 2.7625 0.0 0.0 0.0 0.0 106-107 3.225 0.0 0.0 0.0 0.0 108-109 3.575 0.0 0.0 0.0 0.0 110-111 3.775 0.0 0.0 0.0 0.0 112-113 4.2375 0.0 0.0 0.0 0.0 114-115 4.85 0.0 0.0 0.0 0.0 116-117 5.324999999999999 0.0 0.0 0.0 0.0 118-119 5.824999999999999 0.0 0.0 0.0 0.0 120-121 6.3 0.0 0.0 0.0 0.0 122-123 6.725 0.0 0.0 0.0 0.0 124-125 7.425000000000001 0.0 0.0 0.0 0.0 126-127 7.975 0.0 0.0 0.0 0.0 128-129 8.8125 0.0 0.0 0.0 0.0 130-131 9.475000000000001 0.0 0.0 0.0 0.0 132-133 10.100000000000001 0.0 0.0 0.0 0.0 134-135 10.5125 0.0 0.0 0.0 0.0 136-137 11.2 0.0 0.0 0.0 0.0 138-139 11.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAACAC 10 0.006832588 144.9875 8 TTAGTTG 10 0.006832588 144.9875 3 >>END_MODULE SRR7170881 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170881_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6805 33.0 33.0 34.0 32.0 34.0 2 32.7715 33.0 33.0 34.0 32.0 34.0 3 32.79675 33.0 33.0 34.0 32.0 34.0 4 32.776 34.0 33.0 34.0 32.0 34.0 5 32.8125 34.0 33.0 34.0 32.0 34.0 6 37.0165 38.0 38.0 38.0 36.0 38.0 7 37.0295 38.0 38.0 38.0 37.0 38.0 8 36.92225 38.0 38.0 38.0 36.0 38.0 9 36.9655 38.0 38.0 38.0 36.0 38.0 10-14 36.97275 38.0 38.0 38.0 36.8 38.0 15-19 36.9884 38.0 38.0 38.0 36.8 38.0 20-24 36.923500000000004 38.0 38.0 38.0 36.2 38.0 25-29 36.87855 38.0 38.0 38.0 36.2 38.0 30-34 36.8683 38.0 38.0 38.0 36.0 38.0 35-39 36.8428 38.0 38.0 38.0 36.0 38.0 40-44 36.85865 38.0 38.0 38.0 36.0 38.0 45-49 36.7907 38.0 38.0 38.0 36.0 38.0 50-54 36.7559 38.0 38.0 38.0 36.0 38.0 55-59 36.6952 38.0 38.0 38.0 35.4 38.0 60-64 36.66805 38.0 38.0 38.0 35.6 38.0 65-69 36.5677 38.0 38.0 38.0 35.0 38.0 70-74 36.56230000000001 38.0 38.0 38.0 35.0 38.0 75-79 36.5647 38.0 38.0 38.0 35.0 38.0 80-84 36.2716 38.0 38.0 38.0 34.0 38.0 85-89 36.128949999999996 38.0 38.0 38.0 34.0 38.0 90-94 35.98780000000001 38.0 38.0 38.0 33.4 38.0 95-99 35.87035 38.0 38.0 38.0 33.0 38.0 100-104 35.74965 38.0 37.2 38.0 32.6 38.0 105-109 35.56545 38.0 37.0 38.0 31.4 38.0 110-114 35.32180000000001 38.0 36.8 38.0 30.2 38.0 115-119 35.0269 38.0 36.4 38.0 28.2 38.0 120-124 34.743900000000004 38.0 36.0 38.0 27.4 38.0 125-129 34.40169999999999 38.0 35.2 38.0 24.8 38.0 130-134 34.04979999999999 38.0 34.2 38.0 23.2 38.0 135-139 33.608399999999996 38.0 33.2 38.0 21.0 38.0 140-144 32.81685 38.0 33.0 38.0 16.2 38.0 145-149 31.23905 37.6 31.0 38.0 8.4 38.0 150-151 25.411749999999998 32.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 1.0 4 1.0 5 1.0 6 1.0 7 2.0 8 1.0 9 1.0 10 2.0 11 1.0 12 3.0 13 7.0 14 5.0 15 6.0 16 5.0 17 10.0 18 4.0 19 12.0 20 11.0 21 16.0 22 4.0 23 11.0 24 21.0 25 21.0 26 18.0 27 27.0 28 28.0 29 36.0 30 46.0 31 70.0 32 86.0 33 112.0 34 173.0 35 305.0 36 740.0 37 2193.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.65 21.224999999999998 12.825000000000001 22.3 2 25.775 24.95 31.65 17.625 3 21.43035758939735 27.506876719179797 33.683420855213804 17.37934483620905 4 24.075 33.75 23.125 19.05 5 23.55588897224306 37.80945236309077 19.979994998749685 18.65466366591648 6 22.05 36.875 23.799999999999997 17.275 7 19.625 21.2 38.5 20.674999999999997 8 20.549999999999997 26.275 26.625 26.55 9 21.775 26.1 27.875 24.25 10-14 23.385 28.33 26.555 21.73 15-19 23.62 27.73 28.1 20.549999999999997 20-24 22.445 28.685 27.96 20.91 25-29 23.34 28.51 27.785 20.365 30-34 22.85 28.189999999999998 28.110000000000003 20.849999999999998 35-39 23.265 27.85 28.48 20.405 40-44 23.18 28.48 27.97 20.369999999999997 45-49 22.98 27.534999999999997 28.485 21.0 50-54 22.68 28.275 28.53 20.515 55-59 22.82 27.689999999999998 27.900000000000002 21.59 60-64 22.97 27.71 28.634999999999998 20.685000000000002 65-69 23.06 27.47 27.73 21.740000000000002 70-74 23.3 28.465 27.37 20.865000000000002 75-79 23.189999999999998 28.144999999999996 27.334999999999997 21.33 80-84 23.805 27.85 27.665 20.68 85-89 23.765 28.165000000000003 27.93 20.14 90-94 23.925 27.775 27.66 20.64 95-99 23.875 28.24 27.415 20.47 100-104 23.985 27.689999999999998 27.87 20.455000000000002 105-109 24.055 27.675 28.49 19.78 110-114 23.555 28.794999999999998 27.46 20.19 115-119 24.81 27.58 28.005000000000003 19.605 120-124 24.57 28.485 27.1 19.845 125-129 24.98 27.944999999999997 27.200000000000003 19.875 130-134 25.245 28.37 27.544999999999998 18.84 135-139 25.369999999999997 28.175 27.395000000000003 19.06 140-144 25.569999999999997 28.07 27.675 18.685 145-149 25.814999999999998 28.994999999999997 26.5 18.69 150-151 26.325 27.85 27.237499999999997 18.587500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 2.0 21 1.5 22 1.0 23 2.0 24 2.5 25 2.5 26 3.5 27 6.5 28 10.0 29 11.0 30 15.0 31 18.5 32 26.5 33 44.5 34 67.0 35 84.0 36 98.0 37 111.0 38 123.0 39 155.0 40 182.0 41 210.0 42 228.5 43 254.5 44 270.5 45 272.0 46 268.5 47 245.5 48 227.0 49 205.0 50 164.0 51 133.5 52 118.5 53 95.0 54 90.5 55 77.5 56 48.0 57 31.0 58 27.5 59 15.0 60 10.0 61 12.0 62 8.5 63 6.5 64 4.0 65 1.5 66 0.5 67 0.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.61963190184049 96.45 2 1.0736196319018405 2.1 3 0.1278118609406953 0.375 4 0.07668711656441718 0.3 5 0.025562372188139063 0.125 6 0.0 0.0 7 0.051124744376278126 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.025562372188139063 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 12 0.3 Illumina Single End PCR Primer 1 (96% over 32bp) AACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 7 0.17500000000000002 No Hit CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.38749999999999996 0.0 0.0 0.0 0.0 86-87 0.6000000000000001 0.0 0.0 0.0 0.0 88-89 0.725 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 0.9875 0.0 0.0 0.0 0.0 94-95 1.225 0.0 0.0 0.0 0.0 96-97 1.425 0.0 0.0 0.0 0.0 98-99 1.775 0.0 0.0 0.0 0.0 100-101 2.075 0.0 0.0 0.0 0.0 102-103 2.3625 0.0 0.0 0.0 0.0 104-105 2.7375 0.0 0.0 0.0 0.0 106-107 3.15 0.0 0.0 0.0 0.0 108-109 3.4875 0.0 0.0 0.0 0.0 110-111 3.7 0.0 0.0 0.0 0.0 112-113 4.1 0.0 0.0 0.0 0.0 114-115 4.65 0.0 0.0 0.0 0.0 116-117 5.1 0.0 0.0 0.0 0.0 118-119 5.6125 0.0 0.0 0.0 0.0 120-121 6.0625 0.0 0.0 0.0 0.0 122-123 6.550000000000001 0.0 0.0 0.0 0.0 124-125 7.2375 0.0 0.0 0.0 0.0 126-127 7.775 0.0 0.0 0.0 0.0 128-129 8.6125 0.0 0.0 0.0 0.0 130-131 9.25 0.0 0.0 0.0 0.0 132-133 9.8375 0.0 0.0 0.0 0.0 134-135 10.25 0.0 0.0 0.0 0.0 136-137 10.9375 0.0 0.0 0.0 0.0 138-139 11.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAGCA 10 0.006830828 145.0 7 >>END_MODULE Read 849131 spots for SRR7170881.sra Written 849131 spots for SRR7170881.sra Read 849131 spots for SRR7170881.sra Written 849131 spots for SRR7170881.sra Read 849131 spots for SRR7170881.sra Written 849131 spots for SRR7170881.sra Read 849131 spots for SRR7170881.sra Written 849131 spots for SRR7170881.sra Read 849131 spots for SRR7170881.sra Written 849131 spots for SRR7170881.sra Read 849131 spots for SRR7170881.sra Written 849131 spots for SRR7170881.sra Read 849131 spots for SRR7170881.sra Written 849131 spots for SRR7170881.sra Read 849131 spots for SRR7170881.sra Written 849131 spots for SRR7170881.sra Read 849131 spots for SRR7170881.sra Written 849131 spots for SRR7170881.sra Read 849131 spots for SRR7170881.sra Written 849131 spots for SRR7170881.sra Read 849131 spots for SRR7170881.sra Written 849131 spots for SRR7170881.sra Read 849131 spots for SRR7170881.sra Written 849131 spots for SRR7170881.sra Read 849131 spots for SRR7170881.sra Written 849131 spots for SRR7170881.sra Read 849131 spots for SRR7170881.sra Written 849131 spots for SRR7170881.sra Read 849131 spots for SRR7170881.sra Written 849131 spots for SRR7170881.sra Read 849131 spots for SRR7170881.sra Written 849131 spots for SRR7170881.sra Read 849131 spots for SRR7170881.sra Written 849131 spots for SRR7170881.sra Read 849137 spots for SRR7170881.sra Written 849137 spots for SRR7170881.sra Read 849131 spots for SRR7170881.sra Written 849131 spots for SRR7170881.sra Read 849131 spots for SRR7170881.sra Written 849131 spots for SRR7170881.sra SRR ids: ['SRR7170881.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6fodnvqe SRR7170881.sra spots: 16982626 blocks: [[1, 849131], [849132, 1698262], [1698263, 2547393], [2547394, 3396524], [3396525, 4245655], [4245656, 5094786], [5094787, 5943917], [5943918, 6793048], [6793049, 7642179], [7642180, 8491310], [8491311, 9340441], [9340442, 10189572], [10189573, 11038703], [11038704, 11887834], [11887835, 12736965], [12736966, 13586096], [13586097, 14435227], [14435228, 15284358], [15284359, 16133489], [16133490, 16982626]] SRR7170881 file size 5733154 SRR7170881 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170881 SRR7170881_1.fastq SRR7170881_2.fastq Input file: SRR7170881_1.fastq Paired file: SRR7170881_2.fastq trimmed: SRR7170881-trimmed-pair1.fastq, SRR7170881-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:19:36 2025 >> started Thu Feb 13 21:19:56 2025 >> done (19.791s) 16982626 read pairs processed; of these: 35355 ( 0.21%) short read pairs filtered out after trimming by size control 82233 ( 0.48%) empty read pairs filtered out after trimming by size control 16865038 (99.31%) read pairs available; of these: 11839426 (70.20%) trimmed read pairs available after processing 5025612 (29.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 11 0.00% 20 14 0.00% 21 20 0.00% 22 21 0.00% 23 33 0.00% 24 36 0.00% 25 32 0.00% 26 41 0.00% 27 41 0.00% 28 48 0.00% 29 36 0.00% 30 52 0.00% 31 51 0.00% 32 55 0.00% 33 36 0.00% 34 52 0.00% 35 55 0.00% 36 65 0.00% 37 53 0.00% 38 74 0.00% 39 58 0.00% 40 73 0.00% 41 87 0.00% 42 101 0.00% 43 109 0.00% 44 90 0.00% 45 115 0.00% 46 146 0.00% 47 160 0.00% 48 144 0.00% 49 210 0.00% 50 233 0.00% 51 276 0.00% 52 284 0.00% 53 330 0.00% 54 335 0.00% 55 358 0.00% 56 395 0.00% 57 466 0.00% 58 516 0.00% 59 597 0.00% 60 732 0.00% 61 842 0.00% 62 1028 0.01% 63 1102 0.01% 64 1198 0.01% 65 1243 0.01% 66 1286 0.01% 67 1345 0.01% 68 1685 0.01% 69 1833 0.01% 70 2253 0.01% 71 2698 0.02% 72 3215 0.02% 73 3871 0.02% 74 4222 0.03% 75 5224 0.03% 76 9881 0.06% 77 9155 0.05% 78 6160 0.04% 79 6118 0.04% 80 6793 0.04% 81 8015 0.05% 82 9231 0.05% 83 10617 0.06% 84 12737 0.08% 85 12997 0.08% 86 13878 0.08% 87 14423 0.09% 88 14893 0.09% 89 15900 0.09% 90 17164 0.10% 91 19012 0.11% 92 21247 0.13% 93 23560 0.14% 94 24640 0.15% 95 26379 0.16% 96 26676 0.16% 97 26734 0.16% 98 26826 0.16% 99 27689 0.16% 100 29843 0.18% 101 31795 0.19% 102 35628 0.21% 103 38331 0.23% 104 40786 0.24% 105 43029 0.26% 106 43021 0.26% 107 42889 0.25% 108 42618 0.25% 109 42986 0.25% 110 44549 0.26% 111 47526 0.28% 112 50780 0.30% 113 54627 0.32% 114 58330 0.35% 115 60216 0.36% 116 61276 0.36% 117 61853 0.37% 118 61846 0.37% 119 61556 0.36% 120 62807 0.37% 121 65892 0.39% 122 69851 0.41% 123 74230 0.44% 124 79242 0.47% 125 82439 0.49% 126 86086 0.51% 127 86114 0.51% 128 86588 0.51% 129 89158 0.53% 130 91008 0.54% 131 94879 0.56% 132 100380 0.60% 133 108982 0.65% 134 116610 0.69% 135 125090 0.74% 136 132235 0.78% 137 140247 0.83% 138 149301 0.89% 139 156595 0.93% 140 168565 1.00% 141 183555 1.09% 142 204907 1.21% 143 232514 1.38% 144 268482 1.59% 145 317538 1.88% 146 396713 2.35% 147 518305 3.07% 148 755550 4.48% 149 1309676 7.77% 150 4101976 24.32% 151 5025612 29.80% 16865038 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=25 prefix-density=0.58 prefix-fanout=2.3 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.11 sequence-density-rank=29 fanout-score=28.76 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=9.6 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTCTGCAAATGCATCAGGATCATCAGCGAGGCCAAGTGGGTCAAAGGCACCGCCAGGATAAATGGGGTCAAGTCCTTCGCCAAGTGGCCCTCCACCCACTCTGTACCCTTCAACGAATCCCATAAGCACAACCTGGGAAGCCCAGATGGCGAGGATGCTCTGAGCATGGATGAGGTTGGGGTTGCCAAGGTAATCAAGGCCACCCTCTGAGAAGATTTGAGCTCCAGCCTTGAACCA criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=20 prefix-density=0.96 prefix-fanout=1.9 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=36.38 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.5 sequence=CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR7170881 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:20:40 Started mapping on | Feb 13 21:20:41 Finished on | Feb 13 21:22:50 Mapping speed, Million of reads per hour | 470.65 Number of input reads | 16865038 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 15716349 Uniquely mapped reads % | 93.19% Average mapped length | 286.23 Number of splices: Total | 14391774 Number of splices: Annotated (sjdb) | 14029624 Number of splices: GT/AG | 14110648 Number of splices: GC/AG | 212001 Number of splices: AT/AC | 10934 Number of splices: Non-canonical | 58191 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 458202 % of reads mapped to multiple loci | 2.72% Number of reads mapped to too many loci | 25437 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.89% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 719143 719143 719143 N_multimapping 458202 458202 458202 N_noFeature 574273 15325192 716397 N_ambiguous 387305 1345 137369 UnstrandedReadsAssigned:14754771 PositiveStrandReadsAssigned:389812 NegativeStrandReadsAssigned:14862583 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=139 echo kmer=135 SRR7170881 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170881-trimmed-pair1.fastq SRR7170881-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,865,038 reads, 14,823,554 reads pseudoaligned [quant] estimated average fragment length: 219.827 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR7170881.ke.tsv 34699 SRR7170881.se.tsv 87100 total ==> SRR7170881.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.17 432 11.6168 Potri.005G024800.1.v4.1 1035 816.173 165 9.78088 Potri.004G059700.1.v4.1 961 742.22 9 0.58666 Potri.007G009000.2.v4.1 1416 1197.17 0 0 Potri.003G141000.2.v4.1 2943 2724.17 431.27 7.65933 Potri.016G087400.1.v4.1 270 94.6537 1579.38 807.284 Potri.015G069301.1.v4.1 564 349.505 0 0 Potri.010G195200.1.v4.1 1773 1554.17 17 0.529208 Potri.012G127500.1.v4.1 977 758.184 424 27.0563 ==> SRR7170881.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 734 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 560 Potri.001G212900.v4.1 96 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 6 SRR7170881 completed mapping pipeline successfully