Starting /dee2/code/volunteer_pipeline.sh SRR7170882 current disk space = 3088247808000 free memory = 1466555588 SRR7170882 SRAfilesize 1bc9679b2dfa1d2568645436bd95a5bf SRR7170882.sra SRR7170882.sra file validated SRR7170882 is paired end SRR7170882 is conventional basespace SRR7170882 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170882_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.485 34.0 33.0 34.0 32.0 34.0 2 33.10475 34.0 33.0 34.0 32.0 34.0 3 33.14125 34.0 33.0 34.0 32.0 34.0 4 33.15525 34.0 33.0 34.0 32.0 34.0 5 33.087 34.0 33.0 34.0 32.0 34.0 6 36.48025 38.0 37.0 38.0 34.0 38.0 7 37.03 38.0 38.0 38.0 35.0 38.0 8 37.16225 38.0 38.0 38.0 36.0 38.0 9 37.19725 38.0 38.0 38.0 36.0 38.0 10-14 37.19605 38.0 38.0 38.0 36.2 38.0 15-19 37.16295 38.0 38.0 38.0 36.0 38.0 20-24 37.09165 38.0 38.0 38.0 35.8 38.0 25-29 37.02615 38.0 38.0 38.0 35.8 38.0 30-34 36.922250000000005 38.0 38.0 38.0 35.6 38.0 35-39 36.87645 38.0 38.0 38.0 35.4 38.0 40-44 36.76 38.0 38.0 38.0 34.8 38.0 45-49 36.73165 38.0 38.0 38.0 34.4 38.0 50-54 36.553549999999994 38.0 38.0 38.0 34.0 38.0 55-59 36.48655 38.0 38.0 38.0 34.0 38.0 60-64 36.4102 38.0 38.0 38.0 34.0 38.0 65-69 36.4065 38.0 37.8 38.0 34.0 38.0 70-74 36.2556 38.0 37.0 38.0 33.4 38.0 75-79 35.81365000000001 38.0 37.0 38.0 31.8 38.0 80-84 35.46915 38.0 37.0 38.0 30.2 38.0 85-89 35.4595 38.0 37.0 38.0 30.2 38.0 90-94 35.2423 38.0 36.6 38.0 29.0 38.0 95-99 34.84565 38.0 36.0 38.0 27.8 38.0 100-104 34.78135 38.0 36.0 38.0 27.4 38.0 105-109 34.4467 38.0 35.0 38.0 25.4 38.0 110-114 34.242200000000004 38.0 34.8 38.0 23.8 38.0 115-119 33.92475 38.0 34.0 38.0 23.0 38.0 120-124 33.345549999999996 38.0 33.0 38.0 19.8 38.0 125-129 32.692800000000005 37.8 31.8 38.0 14.8 38.0 130-134 32.116499999999995 37.6 31.2 38.0 14.2 38.0 135-139 31.2546 36.2 29.6 38.0 13.0 38.0 140-144 30.2 36.0 28.0 38.0 9.6 38.0 145-149 28.37475 34.8 23.8 38.0 2.0 38.0 150-151 21.807499999999997 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 2.0 8 1.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 3.0 15 4.0 16 6.0 17 7.0 18 13.0 19 36.0 20 13.0 21 11.0 22 8.0 23 17.0 24 25.0 25 27.0 26 35.0 27 51.0 28 53.0 29 55.0 30 84.0 31 115.0 32 147.0 33 231.0 34 294.0 35 513.0 36 1096.0 37 1149.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.67007150153218 18.94790602655771 14.78549540347293 29.59652706843718 2 21.224999999999998 21.375 34.150000000000006 23.25 3 18.025 29.7 30.85 21.425 4 20.349999999999998 34.725 24.375 20.549999999999997 5 21.341005754315738 36.00200150112585 23.71778834125594 18.939204403302476 6 19.325 36.25 23.9 20.525 7 14.374999999999998 23.200000000000003 43.75 18.675 8 18.025 24.425 28.9 28.65 9 18.5 22.825 30.95 27.725 10-14 19.48 29.82 26.090000000000003 24.610000000000003 15-19 19.585 28.799999999999997 27.694999999999997 23.919999999999998 20-24 19.505 29.145 27.68 23.669999999999998 25-29 20.26 28.515 27.525 23.7 30-34 19.56 29.065 27.355 24.02 35-39 20.095 29.29 26.825 23.79 40-44 20.03 28.694999999999997 27.6 23.674999999999997 45-49 19.634999999999998 28.835 27.76 23.77 50-54 20.169999999999998 28.83 27.235 23.765 55-59 19.415 28.410000000000004 28.060000000000002 24.115000000000002 60-64 20.055 27.915 28.12 23.91 65-69 20.27 29.4 26.87 23.46 70-74 19.84 29.849999999999998 26.889999999999997 23.419999999999998 75-79 20.5 28.87 27.250000000000004 23.380000000000003 80-84 20.135 29.415000000000003 26.86 23.59 85-89 20.5 29.115000000000002 26.905 23.48 90-94 20.575 29.265 26.8 23.36 95-99 20.415 28.910000000000004 27.315 23.36 100-104 20.45 28.849999999999998 26.745 23.955000000000002 105-109 20.995 28.4 26.945000000000004 23.66 110-114 21.12 28.494999999999997 26.889999999999997 23.494999999999997 115-119 21.04 28.515 26.85 23.595 120-124 20.69 28.4 26.590000000000003 24.32 125-129 21.3 28.125 26.305 24.27 130-134 21.355 28.055000000000003 26.040000000000003 24.55 135-139 20.93 27.77 26.66 24.64 140-144 21.195 28.165000000000003 26.05 24.59 145-149 21.265 28.22 26.345000000000002 24.169999999999998 150-151 20.7375 27.525 26.375 25.362499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.5 16 1.5 17 1.0 18 1.5 19 2.0 20 2.5 21 2.0 22 2.0 23 2.5 24 2.5 25 5.0 26 7.5 27 8.5 28 8.5 29 15.0 30 24.0 31 31.0 32 41.0 33 61.5 34 74.5 35 81.0 36 106.5 37 125.5 38 139.5 39 161.5 40 179.0 41 204.5 42 231.0 43 247.5 44 249.0 45 247.0 46 237.0 47 228.0 48 219.0 49 209.0 50 184.0 51 136.0 52 106.0 53 89.5 54 72.5 55 62.0 56 55.0 57 38.0 58 26.5 59 21.5 60 17.0 61 11.0 62 6.5 63 4.5 64 2.5 65 1.5 66 1.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08116385911178 97.05 2 0.7912200102092904 1.55 3 0.05104645227156713 0.15 4 0.025523226135783564 0.1 5 0.025523226135783564 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025523226135783564 1.0250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 41 1.0250000000000001 TruSeq Adapter, Index 7 (97% over 36bp) GCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.0625 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.21250000000000002 0.0 0.0 0.0 0.0 70-71 0.30000000000000004 0.0 0.0 0.0 0.0 72-73 0.375 0.0 0.0 0.0 0.0 74-75 0.45 0.0 0.0 0.0 0.0 76-77 0.5375 0.0 0.0 0.0 0.0 78-79 0.65 0.0 0.0 0.0 0.0 80-81 0.7749999999999999 0.0 0.0 0.0 0.0 82-83 0.8999999999999999 0.0 0.0 0.0 0.0 84-85 1.075 0.0 0.0 0.0 0.0 86-87 1.2375 0.0 0.0 0.0 0.0 88-89 1.3375 0.0 0.0 0.0 0.0 90-91 1.55 0.0 0.0 0.0 0.0 92-93 1.8125 0.0 0.0 0.0 0.0 94-95 2.0625 0.0 0.0 0.0 0.0 96-97 2.3875 0.0 0.0 0.0 0.0 98-99 2.7874999999999996 0.0 0.0 0.0 0.0 100-101 3.0875 0.0 0.0 0.0 0.0 102-103 3.5625 0.0 0.0 0.0 0.0 104-105 3.9499999999999997 0.0 0.0 0.0 0.0 106-107 4.5625 0.0 0.0 0.0 0.0 108-109 5.1375 0.0 0.0 0.0 0.0 110-111 5.5625 0.0 0.0 0.0 0.0 112-113 6.0625 0.0 0.0 0.0 0.0 114-115 6.550000000000001 0.0 0.0 0.0 0.0 116-117 7.0 0.0 0.0 0.0 0.0 118-119 7.8375 0.0 0.0 0.0 0.0 120-121 8.4 0.0 0.0 0.0 0.0 122-123 9.1125 0.0 0.0 0.0 0.0 124-125 9.899999999999999 0.0 0.0 0.0 0.0 126-127 10.65 0.0 0.0 0.0 0.0 128-129 11.45 0.0 0.0 0.0 0.0 130-131 12.1125 0.0 0.0 0.0 0.0 132-133 12.7875 0.0 0.0 0.0 0.0 134-135 13.4375 0.0 0.0 0.0 0.0 136-137 14.2 0.0 0.0 0.0 0.0 138-139 15.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATATC 10 0.0065874006 146.74684 4 AAAATAT 10 0.0065874006 146.74684 3 TACTTTC 10 0.0065874006 146.74684 2 >>END_MODULE SRR7170882 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170882_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.50825 33.0 33.0 34.0 32.0 34.0 2 32.60025 33.0 33.0 34.0 32.0 34.0 3 32.61325 33.0 33.0 34.0 32.0 34.0 4 32.67475 33.0 33.0 34.0 32.0 34.0 5 32.57725 33.0 33.0 34.0 32.0 34.0 6 36.73525 38.0 38.0 38.0 36.0 38.0 7 36.79375 38.0 38.0 38.0 36.0 38.0 8 36.572 38.0 38.0 38.0 35.0 38.0 9 36.653 38.0 38.0 38.0 35.0 38.0 10-14 36.761700000000005 38.0 38.0 38.0 36.0 38.0 15-19 36.7365 38.0 38.0 38.0 36.0 38.0 20-24 36.69565 38.0 38.0 38.0 35.8 38.0 25-29 36.5884 38.0 38.0 38.0 35.2 38.0 30-34 36.540949999999995 38.0 38.0 38.0 35.4 38.0 35-39 36.51025 38.0 38.0 38.0 35.0 38.0 40-44 36.52795 38.0 38.0 38.0 35.0 38.0 45-49 36.4556 38.0 38.0 38.0 34.8 38.0 50-54 36.5012 38.0 38.0 38.0 35.2 38.0 55-59 36.38109999999999 38.0 38.0 38.0 34.6 38.0 60-64 36.3083 38.0 38.0 38.0 34.2 38.0 65-69 36.1736 38.0 38.0 38.0 34.0 38.0 70-74 36.167699999999996 38.0 38.0 38.0 34.0 38.0 75-79 36.102149999999995 38.0 38.0 38.0 33.8 38.0 80-84 35.572 38.0 38.0 38.0 32.0 38.0 85-89 35.416000000000004 38.0 37.6 38.0 30.6 38.0 90-94 35.28575 38.0 37.0 38.0 30.2 38.0 95-99 35.17165 38.0 37.0 38.0 29.0 38.0 100-104 34.97905 38.0 37.0 38.0 28.6 38.0 105-109 34.80005 38.0 36.6 38.0 27.4 38.0 110-114 34.5293 38.0 36.2 38.0 26.0 38.0 115-119 34.1117 38.0 35.6 38.0 21.4 38.0 120-124 33.9328 38.0 35.0 38.0 22.2 38.0 125-129 33.501799999999996 38.0 34.4 38.0 17.4 38.0 130-134 32.94435 38.0 33.4 38.0 14.6 38.0 135-139 32.651500000000006 38.0 33.0 38.0 13.4 38.0 140-144 31.743299999999998 38.0 31.8 38.0 12.2 38.0 145-149 30.32765 37.4 29.4 38.0 4.2 38.0 150-151 24.46575 32.0 13.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 5.0 4 1.0 5 6.0 6 6.0 7 2.0 8 0.0 9 8.0 10 3.0 11 2.0 12 4.0 13 9.0 14 5.0 15 5.0 16 7.0 17 10.0 18 8.0 19 18.0 20 44.0 21 13.0 22 19.0 23 24.0 24 24.0 25 12.0 26 19.0 27 29.0 28 45.0 29 40.0 30 58.0 31 78.0 32 88.0 33 122.0 34 183.0 35 287.0 36 774.0 37 2022.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.300000000000004 19.175 18.2 23.325000000000003 2 27.55 22.75 30.9 18.8 3 22.34175631723793 24.293219914936202 35.001250938203654 18.363772829622217 4 24.275 33.975 22.650000000000002 19.1 5 26.069552164123095 34.65098824118088 21.165874405804352 18.11358518889167 6 21.7 35.75 23.875 18.675 7 20.549999999999997 19.75 38.625 21.075 8 21.5 25.1 25.5 27.900000000000002 9 22.5 26.474999999999998 25.8 25.224999999999998 10-14 23.544999999999998 28.92 26.085 21.45 15-19 23.16 27.689999999999998 28.105000000000004 21.044999999999998 20-24 23.189999999999998 28.505000000000003 28.01 20.294999999999998 25-29 23.395 28.555000000000003 27.375 20.674999999999997 30-34 23.03 28.084999999999997 27.97 20.915 35-39 23.155 28.050000000000004 27.675 21.12 40-44 23.925 27.55 27.55 20.974999999999998 45-49 22.205 27.725 28.505000000000003 21.565 50-54 23.06 27.63 28.01 21.3 55-59 23.474999999999998 27.345000000000002 28.305000000000003 20.875 60-64 23.405 26.905 27.87 21.82 65-69 23.235 27.41 28.215 21.14 70-74 23.241162058102905 28.32641632081604 27.51137556877844 20.921046052302618 75-79 23.205000000000002 28.71 27.245 20.84 80-84 23.41 28.449999999999996 27.215 20.925 85-89 23.474999999999998 28.055000000000003 26.6 21.87 90-94 23.645 28.044999999999998 27.27 21.04 95-99 24.04 28.634999999999998 26.895000000000003 20.43 100-104 24.42 27.355 27.755000000000003 20.47 105-109 24.73 28.199999999999996 26.99 20.080000000000002 110-114 24.45 28.57 26.700000000000003 20.28 115-119 25.240000000000002 28.360000000000003 26.76 19.64 120-124 24.86 28.58 26.495 20.064999999999998 125-129 25.705 28.244999999999997 26.875 19.175 130-134 25.72 28.265 26.195 19.82 135-139 25.94 27.439999999999998 27.16 19.46 140-144 25.905 28.044999999999998 26.950000000000003 19.1 145-149 26.724999999999998 28.134999999999998 26.284999999999997 18.855 150-151 27.537499999999998 27.625 26.174999999999997 18.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 0.5 21 0.5 22 1.5 23 2.5 24 4.0 25 6.0 26 9.0 27 8.0 28 7.5 29 13.5 30 18.5 31 24.5 32 30.0 33 36.5 34 46.5 35 55.5 36 69.0 37 97.0 38 136.0 39 161.5 40 190.0 41 204.0 42 224.0 43 245.5 44 248.0 45 251.0 46 248.0 47 250.5 48 244.0 49 216.0 50 180.0 51 149.5 52 119.0 53 102.5 54 101.0 55 86.0 56 60.0 57 41.5 58 23.5 59 22.5 60 20.0 61 9.5 62 8.5 63 7.5 64 5.5 65 3.0 66 1.5 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.075 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.58283947436229 95.65 2 1.1337284205101776 2.1999999999999997 3 0.1545993300695697 0.44999999999999996 4 0.0515331100231899 0.2 5 0.02576655501159495 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02576655501159495 0.22499999999999998 >10 0.02576655501159495 1.15 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 46 1.15 Illumina Single End PCR Primer 1 (97% over 34bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.0625 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.16249999999999998 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.32499999999999996 0.0 0.0 0.0 0.0 72-73 0.4 0.0 0.0 0.0 0.0 74-75 0.475 0.0 0.0 0.0 0.0 76-77 0.5625 0.0 0.0 0.0 0.0 78-79 0.675 0.0 0.0 0.0 0.0 80-81 0.8 0.0 0.0 0.0 0.0 82-83 0.925 0.0 0.0 0.0 0.0 84-85 1.1 0.0 0.0 0.0 0.0 86-87 1.2625 0.0 0.0 0.0 0.0 88-89 1.3375 0.0 0.0 0.0 0.0 90-91 1.575 0.0 0.0 0.0 0.0 92-93 1.8250000000000002 0.0 0.0 0.0 0.0 94-95 2.1375 0.0 0.0 0.0 0.0 96-97 2.525 0.0 0.0 0.0 0.0 98-99 2.8625 0.0 0.0 0.0 0.0 100-101 3.1625 0.0 0.0 0.0 0.0 102-103 3.6125 0.0 0.0 0.0 0.0 104-105 3.925 0.0 0.0 0.0 0.0 106-107 4.55 0.0 0.0 0.0 0.0 108-109 5.125 0.0 0.0 0.0 0.0 110-111 5.6 0.0 0.0 0.0 0.0 112-113 6.075 0.0 0.0 0.0 0.0 114-115 6.574999999999999 0.0 0.0 0.0 0.0 116-117 7.05 0.0 0.0 0.0 0.0 118-119 7.85 0.0 0.0 0.0 0.0 120-121 8.462499999999999 0.0 0.0 0.0 0.0 122-123 9.25 0.0 0.0 0.0 0.0 124-125 10.1125 0.0 0.0 0.0 0.0 126-127 10.912500000000001 0.0 0.0 0.0 0.0 128-129 11.7 0.0 0.0 0.0 0.0 130-131 12.3875 0.0 0.0 0.0 0.0 132-133 13.024999999999999 0.0 0.0 0.0 0.0 134-135 13.6875 0.0 0.0 0.0 0.0 136-137 14.475000000000001 0.0 0.0 0.0 0.0 138-139 15.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGCCC 10 0.0068396386 144.9375 8 AAAAAAA 115 1.383647E-5 12.603261 140-144 >>END_MODULE Read 875313 spots for SRR7170882.sra Written 875313 spots for SRR7170882.sra Read 875313 spots for SRR7170882.sra Written 875313 spots for SRR7170882.sra Read 875314 spots for SRR7170882.sra Written 875314 spots for SRR7170882.sra Read 875313 spots for SRR7170882.sra Written 875313 spots for SRR7170882.sra Read 875313 spots for SRR7170882.sra Written 875313 spots for SRR7170882.sra Read 875313 spots for SRR7170882.sra Written 875313 spots for SRR7170882.sra Read 875313 spots for SRR7170882.sra Written 875313 spots for SRR7170882.sra Read 875313 spots for SRR7170882.sra Written 875313 spots for SRR7170882.sra Read 875313 spots for SRR7170882.sra Written 875313 spots for SRR7170882.sra Read 875313 spots for SRR7170882.sra Written 875313 spots for SRR7170882.sra Read 875313 spots for SRR7170882.sra Written 875313 spots for SRR7170882.sra Read 875313 spots for SRR7170882.sra Written 875313 spots for SRR7170882.sra Read 875313 spots for SRR7170882.sra Written 875313 spots for SRR7170882.sra Read 875313 spots for SRR7170882.sra Written 875313 spots for SRR7170882.sra Read 875313 spots for SRR7170882.sra Written 875313 spots for SRR7170882.sra Read 875313 spots for SRR7170882.sra Written 875313 spots for SRR7170882.sra Read 875313 spots for SRR7170882.sra Written 875313 spots for SRR7170882.sra Read 875313 spots for SRR7170882.sra Written 875313 spots for SRR7170882.sra Read 875313 spots for SRR7170882.sra Written 875313 spots for SRR7170882.sra Read 875313 spots for SRR7170882.sra Written 875313 spots for SRR7170882.sra SRR ids: ['SRR7170882.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_70hx06g5 SRR7170882.sra spots: 17506261 blocks: [[1, 875313], [875314, 1750626], [1750627, 2625939], [2625940, 3501252], [3501253, 4376565], [4376566, 5251878], [5251879, 6127191], [6127192, 7002504], [7002505, 7877817], [7877818, 8753130], [8753131, 9628443], [9628444, 10503756], [10503757, 11379069], [11379070, 12254382], [12254383, 13129695], [13129696, 14005008], [14005009, 14880321], [14880322, 15755634], [15755635, 16630947], [16630948, 17506261]] SRR7170882 file size 5910597 SRR7170882 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170882 SRR7170882_1.fastq SRR7170882_2.fastq Input file: SRR7170882_1.fastq Paired file: SRR7170882_2.fastq trimmed: SRR7170882-trimmed-pair1.fastq, SRR7170882-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:19:21 2025 >> started Thu Feb 13 21:19:51 2025 >> done (29.433s) 17506261 read pairs processed; of these: 48546 ( 0.28%) short read pairs filtered out after trimming by size control 251730 ( 1.44%) empty read pairs filtered out after trimming by size control 17205985 (98.28%) read pairs available; of these: 12686201 (73.73%) trimmed read pairs available after processing 4519784 (26.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 35 0.00% 19 28 0.00% 20 35 0.00% 21 42 0.00% 22 41 0.00% 23 42 0.00% 24 36 0.00% 25 52 0.00% 26 39 0.00% 27 41 0.00% 28 55 0.00% 29 55 0.00% 30 60 0.00% 31 77 0.00% 32 64 0.00% 33 66 0.00% 34 97 0.00% 35 71 0.00% 36 91 0.00% 37 116 0.00% 38 126 0.00% 39 155 0.00% 40 188 0.00% 41 224 0.00% 42 219 0.00% 43 228 0.00% 44 243 0.00% 45 302 0.00% 46 337 0.00% 47 356 0.00% 48 416 0.00% 49 510 0.00% 50 588 0.00% 51 704 0.00% 52 796 0.00% 53 787 0.00% 54 827 0.00% 55 862 0.01% 56 964 0.01% 57 1110 0.01% 58 1170 0.01% 59 1490 0.01% 60 1707 0.01% 61 2060 0.01% 62 2407 0.01% 63 2604 0.02% 64 2645 0.02% 65 2685 0.02% 66 2714 0.02% 67 3025 0.02% 68 3348 0.02% 69 3858 0.02% 70 4689 0.03% 71 5561 0.03% 72 7143 0.04% 73 7622 0.04% 74 8653 0.05% 75 11274 0.07% 76 24460 0.14% 77 18326 0.11% 78 10757 0.06% 79 10706 0.06% 80 12019 0.07% 81 14259 0.08% 82 16241 0.09% 83 18245 0.11% 84 20831 0.12% 85 21155 0.12% 86 21386 0.12% 87 21846 0.13% 88 22460 0.13% 89 23814 0.14% 90 25825 0.15% 91 28589 0.17% 92 31661 0.18% 93 34693 0.20% 94 36313 0.21% 95 36917 0.21% 96 36461 0.21% 97 36020 0.21% 98 35752 0.21% 99 36977 0.21% 100 39389 0.23% 101 42356 0.25% 102 46898 0.27% 103 49927 0.29% 104 52615 0.31% 105 53493 0.31% 106 52723 0.31% 107 52300 0.30% 108 51897 0.30% 109 51586 0.30% 110 53744 0.31% 111 56772 0.33% 112 61769 0.36% 113 65080 0.38% 114 69179 0.40% 115 70854 0.41% 116 70934 0.41% 117 69871 0.41% 118 69783 0.41% 119 69555 0.40% 120 71595 0.42% 121 74581 0.43% 122 78689 0.46% 123 85062 0.49% 124 89388 0.52% 125 92017 0.53% 126 95835 0.56% 127 95719 0.56% 128 95990 0.56% 129 97674 0.57% 130 100446 0.58% 131 104769 0.61% 132 112005 0.65% 133 120160 0.70% 134 129007 0.75% 135 138693 0.81% 136 146436 0.85% 137 155660 0.90% 138 164885 0.96% 139 174413 1.01% 140 186923 1.09% 141 204515 1.19% 142 228541 1.33% 143 259401 1.51% 144 299628 1.74% 145 352713 2.05% 146 438004 2.55% 147 570819 3.32% 148 812457 4.72% 149 1361648 7.91% 150 3916350 22.76% 151 4519784 26.27% 17205985 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=15 prefix-density=0.76 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=29.48 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.8 sequence=ACCACACCAGAGGCCACAGACATGGCCAATACATAACAATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGT criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=20 prefix-density=0.94 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.23 sequence-density-rank=18 fanout-score=12.25 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=4.3 sequence=AGCAATGGCAGCA SRR7170882 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:20:34 Started mapping on | Feb 13 21:20:34 Finished on | Feb 13 21:24:33 Mapping speed, Million of reads per hour | 259.17 Number of input reads | 17205985 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 16056878 Uniquely mapped reads % | 93.32% Average mapped length | 283.16 Number of splices: Total | 14842989 Number of splices: Annotated (sjdb) | 14502414 Number of splices: GT/AG | 14565676 Number of splices: GC/AG | 219322 Number of splices: AT/AC | 10397 Number of splices: Non-canonical | 47594 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430537 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 65208 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.70% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 755122 755122 755122 N_multimapping 430537 430537 430537 N_noFeature 628051 15630766 807197 N_ambiguous 357901 1474 110000 UnstrandedReadsAssigned:15070926 PositiveStrandReadsAssigned:424638 NegativeStrandReadsAssigned:15139681 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=135 echo kmer=131 SRR7170882 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170882-trimmed-pair1.fastq SRR7170882-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,205,985 reads, 15,115,192 reads pseudoaligned [quant] estimated average fragment length: 220.339 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52401 SRR7170882.ke.tsv 34699 SRR7170882.se.tsv 87100 total ==> SRR7170882.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798.66 704 19.175 Potri.005G024800.1.v4.1 1035 815.661 299 17.9587 Potri.004G059700.1.v4.1 961 741.71 33 2.17968 Potri.007G009000.2.v4.1 1416 1196.66 0 0 Potri.003G141000.2.v4.1 2943 2723.66 797.42 14.3432 Potri.016G087400.1.v4.1 270 100.2 1186 579.866 Potri.015G069301.1.v4.1 564 350.003 0 0 Potri.010G195200.1.v4.1 1773 1553.66 40.9102 1.28999 Potri.012G127500.1.v4.1 977 757.686 196 12.673 ==> SRR7170882.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 665 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 475 Potri.001G212900.v4.1 16 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 7 SRR7170882 completed mapping pipeline successfully