Starting /dee2/code/volunteer_pipeline.sh SRR7170883 current disk space = 3088221233152 free memory = 1466730152 SRR7170883 SRAfilesize bbd54c1280076694d8d2e5e7f999fc43 SRR7170883.sra SRR7170883.sra file validated SRR7170883 is paired end SRR7170883 is conventional basespace SRR7170883 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170883_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8355 34.0 33.0 34.0 32.0 34.0 2 33.31 34.0 33.0 34.0 32.0 34.0 3 33.2665 34.0 33.0 34.0 33.0 34.0 4 33.3195 34.0 33.0 34.0 33.0 34.0 5 33.289 34.0 33.0 34.0 33.0 34.0 6 36.8385 38.0 37.0 38.0 35.0 38.0 7 37.27775 38.0 38.0 38.0 36.0 38.0 8 37.41825 38.0 38.0 38.0 37.0 38.0 9 37.4765 38.0 38.0 38.0 37.0 38.0 10-14 37.4895 38.0 38.0 38.0 37.0 38.0 15-19 37.41435 38.0 38.0 38.0 37.0 38.0 20-24 37.32685 38.0 38.0 38.0 37.0 38.0 25-29 37.272850000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.2801 38.0 38.0 38.0 37.0 38.0 35-39 37.28905 38.0 38.0 38.0 37.0 38.0 40-44 37.15585 38.0 38.0 38.0 36.4 38.0 45-49 37.063399999999994 38.0 38.0 38.0 36.0 38.0 50-54 36.9517 38.0 38.0 38.0 36.0 38.0 55-59 36.9729 38.0 38.0 38.0 36.0 38.0 60-64 36.93860000000001 38.0 38.0 38.0 35.8 38.0 65-69 36.846000000000004 38.0 38.0 38.0 35.4 38.0 70-74 36.78915000000001 38.0 38.0 38.0 35.0 38.0 75-79 36.3628 38.0 38.0 38.0 34.0 38.0 80-84 36.28765 38.0 38.0 38.0 34.0 38.0 85-89 36.2976 38.0 38.0 38.0 34.0 38.0 90-94 36.21084999999999 38.0 38.0 38.0 34.0 38.0 95-99 36.04260000000001 38.0 37.8 38.0 33.4 38.0 100-104 35.82615 38.0 37.0 38.0 31.8 38.0 105-109 35.66315 38.0 37.0 38.0 31.8 38.0 110-114 35.430099999999996 38.0 36.6 38.0 30.2 38.0 115-119 35.273250000000004 38.0 36.0 38.0 29.6 38.0 120-124 34.874550000000006 38.0 35.6 38.0 28.0 38.0 125-129 34.778549999999996 38.0 35.6 38.0 27.2 38.0 130-134 34.03825 38.0 34.4 38.0 22.6 38.0 135-139 33.9965 38.0 33.8 38.0 23.2 38.0 140-144 33.585800000000006 38.0 33.2 38.0 22.2 38.0 145-149 32.7007 38.0 33.0 38.0 13.8 38.0 150-151 27.605625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 2.0 14 1.0 15 1.0 16 1.0 17 4.0 18 10.0 19 22.0 20 11.0 21 6.0 22 5.0 23 9.0 24 12.0 25 15.0 26 24.0 27 21.0 28 22.0 29 42.0 30 48.0 31 79.0 32 95.0 33 123.0 34 174.0 35 301.0 36 788.0 37 2179.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.65482233502538 15.228426395939088 10.126903553299492 30.98984771573604 2 23.849999999999998 18.099999999999998 32.824999999999996 25.224999999999998 3 20.175 25.95 28.025 25.85 4 21.8 31.075000000000003 24.175 22.95 5 21.725 36.225 23.525 18.525 6 20.45 35.425000000000004 24.775 19.35 7 15.0 25.55 41.025 18.425 8 17.5 24.8 29.4 28.299999999999997 9 19.55 24.075 30.375000000000004 26.0 10-14 20.549999999999997 29.175 26.284999999999997 23.990000000000002 15-19 20.085 28.58 27.055 24.279999999999998 20-24 21.14 28.515 26.8 23.544999999999998 25-29 20.474999999999998 28.835 26.650000000000002 24.04 30-34 20.62 28.82 26.645000000000003 23.915 35-39 20.895 28.455000000000002 26.71 23.94 40-44 20.75 28.605000000000004 26.590000000000003 24.055 45-49 21.154999999999998 28.105000000000004 26.924999999999997 23.815 50-54 21.425 28.294999999999998 26.88 23.400000000000002 55-59 20.375 28.599999999999998 26.965 24.060000000000002 60-64 20.96 27.955000000000002 27.015 24.07 65-69 20.974999999999998 28.854999999999997 26.565 23.605 70-74 20.669999999999998 28.975 26.619999999999997 23.735 75-79 20.73 28.15 27.134999999999998 23.985 80-84 20.919999999999998 28.77 26.76 23.549999999999997 85-89 21.48 28.035 27.034999999999997 23.45 90-94 20.825 28.365000000000002 27.205000000000002 23.605 95-99 20.935000000000002 28.244999999999997 26.88 23.94 100-104 21.2 28.715000000000003 26.400000000000002 23.685000000000002 105-109 21.12 27.52 27.0 24.36 110-114 20.985 27.905 27.229999999999997 23.880000000000003 115-119 20.575 28.139999999999997 26.76 24.525 120-124 21.015 28.57 26.99 23.425 125-129 21.3 27.925 26.275 24.5 130-134 22.025 27.939999999999998 26.055 23.98 135-139 21.595 28.27 26.115 24.02 140-144 21.884999999999998 27.775 26.025 24.315 145-149 22.134999999999998 28.22 25.635 24.01 150-151 21.762500000000003 27.800000000000004 25.55 24.887500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.5 21 1.0 22 0.5 23 1.5 24 3.0 25 3.5 26 4.0 27 5.0 28 9.5 29 18.0 30 24.0 31 25.0 32 28.5 33 39.0 34 57.5 35 83.0 36 98.5 37 109.5 38 129.0 39 145.0 40 156.5 41 177.0 42 200.0 43 206.5 44 220.0 45 233.0 46 234.5 47 247.0 48 245.5 49 220.0 50 193.0 51 157.0 52 136.5 53 118.0 54 90.5 55 76.0 56 66.0 57 60.5 58 45.0 59 38.5 60 33.0 61 19.5 62 13.0 63 6.0 64 4.0 65 3.5 66 1.5 67 2.0 68 1.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.48834230079426 96.1 2 1.1529592621060722 2.25 3 0.23059185242121444 0.675 4 0.07686395080707148 0.3 5 0.025621316935690495 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025621316935690495 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTAT 22 0.5499999999999999 TruSeq Adapter, Index 7 (97% over 38bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTATG 5 0.125 TruSeq Adapter, Index 7 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.9125000000000001 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.8375 0.0 0.0 0.0 0.0 108-109 1.975 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.7125000000000004 0.0 0.0 0.0 0.0 116-117 3.0875000000000004 0.0 0.0 0.0 0.0 118-119 3.475 0.0 0.0 0.0 0.0 120-121 4.0875 0.0 0.0 0.0 0.0 122-123 4.625 0.0 0.0 0.0 0.0 124-125 5.137499999999999 0.0 0.0 0.0 0.0 126-127 5.8375 0.0 0.0 0.0 0.0 128-129 6.225 0.0 0.0 0.0 0.0 130-131 6.737500000000001 0.0 0.0 0.0 0.0 132-133 7.324999999999999 0.0 0.0 0.0 0.0 134-135 7.9625 0.0 0.0 0.0 0.0 136-137 8.625 0.0 0.0 0.0 0.0 138-139 9.462499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCGTGA 10 0.006830828 145.0 1 >>END_MODULE SRR7170883 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170883_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91525 33.0 33.0 34.0 32.0 34.0 2 33.03225 34.0 33.0 34.0 32.0 34.0 3 33.0465 34.0 33.0 34.0 32.0 34.0 4 32.986 34.0 33.0 34.0 32.0 34.0 5 32.94625 34.0 33.0 34.0 32.0 34.0 6 37.0635 38.0 38.0 38.0 37.0 38.0 7 37.16475 38.0 38.0 38.0 37.0 38.0 8 37.1645 38.0 38.0 38.0 37.0 38.0 9 37.193 38.0 38.0 38.0 37.0 38.0 10-14 37.11045 38.0 38.0 38.0 37.0 38.0 15-19 37.08090000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.0505 38.0 38.0 38.0 37.0 38.0 25-29 37.0401 38.0 38.0 38.0 36.4 38.0 30-34 37.0006 38.0 38.0 38.0 36.6 38.0 35-39 36.9767 38.0 38.0 38.0 36.0 38.0 40-44 36.9277 38.0 38.0 38.0 36.0 38.0 45-49 36.9296 38.0 38.0 38.0 36.0 38.0 50-54 36.94535 38.0 38.0 38.0 36.0 38.0 55-59 36.894999999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.78445000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.783049999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.77395 38.0 38.0 38.0 35.6 38.0 75-79 36.673199999999994 38.0 38.0 38.0 35.2 38.0 80-84 36.34165 38.0 38.0 38.0 34.2 38.0 85-89 36.193799999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.181349999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.0616 38.0 38.0 38.0 33.8 38.0 100-104 35.89825 38.0 37.8 38.0 33.0 38.0 105-109 35.68925 38.0 37.6 38.0 32.4 38.0 110-114 35.3729 38.0 37.0 38.0 30.2 38.0 115-119 35.16225 38.0 36.8 38.0 28.8 38.0 120-124 34.79665 38.0 36.0 38.0 27.4 38.0 125-129 34.44475 38.0 35.4 38.0 25.2 38.0 130-134 34.1854 38.0 35.2 38.0 23.8 38.0 135-139 33.482350000000004 38.0 34.0 38.0 18.6 38.0 140-144 33.0625 38.0 33.0 38.0 15.4 38.0 145-149 31.99305 38.0 33.0 38.0 8.2 38.0 150-151 26.68175 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 6.0 4 2.0 5 0.0 6 0.0 7 1.0 8 1.0 9 1.0 10 1.0 11 0.0 12 0.0 13 6.0 14 5.0 15 6.0 16 4.0 17 6.0 18 7.0 19 11.0 20 21.0 21 15.0 22 14.0 23 12.0 24 18.0 25 16.0 26 26.0 27 24.0 28 43.0 29 42.0 30 43.0 31 64.0 32 81.0 33 105.0 34 145.0 35 252.0 36 635.0 37 2383.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.2 21.325 11.85 21.625 2 28.725 23.025000000000002 29.9 18.35 3 20.575 26.075 33.650000000000006 19.7 4 23.25 34.699999999999996 23.200000000000003 18.85 5 24.2 36.4 21.325 18.075 6 21.13028257064266 37.15928982245561 21.80545136284071 19.904976244061015 7 18.854713678419603 20.155038759689923 38.73468367091773 22.255563890972745 8 22.05551387846962 23.605901475368842 26.281570392598148 28.057014253563388 9 20.905226306576644 25.23130782695674 28.732183045761438 25.131282820705174 10-14 23.545886471617905 27.82195548887222 26.376594148537137 22.255563890972745 15-19 23.20580145036259 27.216804201050266 27.6419104776194 21.935483870967744 20-24 23.00075018754689 27.906976744186046 27.446861715428856 21.64541135283821 25-29 23.118091331966188 28.09983494222978 27.429600360126045 21.352473365677987 30-34 23.201960588176455 27.393217965389617 27.628288486545966 21.776532959887966 35-39 22.924169667867147 27.02080832332933 27.686074429771907 22.368947579031612 40-44 23.571785892946473 27.448724362181093 27.66383191595798 21.315657828914457 45-49 23.290480716322346 27.822520134060326 27.507378320244108 21.37962082937322 50-54 23.094237695078032 26.405562224889955 28.416366546618647 22.083833533413365 55-59 23.27047171227052 26.91711270071532 27.992596668500823 21.81981891851333 60-64 23.304321728691477 26.91076430572229 28.07623049219688 21.708683473389357 65-69 23.263142099734907 27.114490071525033 27.8297404091432 21.792627419596858 70-74 22.886443221610804 27.623811905952977 27.173586793396698 22.316158079039518 75-79 23.030363663648643 27.917562903306486 26.912110449702364 22.139962983342503 80-84 23.255464959231652 27.53238957530889 26.822069931469162 22.390075533990295 85-89 23.790705817617926 27.18223200440198 27.2822770246611 21.744785153318993 90-94 23.281640820410203 27.25862931465733 27.71885942971486 21.74087043521761 95-99 23.41670835417709 27.32866433216608 27.46873436718359 21.785892946473236 100-104 23.85311921556856 27.440092050627847 27.044874681074592 21.661914052729 105-109 24.20831457301516 27.355045274901197 26.939816899294613 21.496823252789035 110-114 23.898143979188553 27.375056280954524 27.224973735554553 21.501826004302366 115-119 24.20952571542926 27.856714028417052 27.296377826696016 20.637382429457674 120-124 24.46968180908545 28.13688212927757 26.340804482689613 21.052631578947366 125-129 25.08630609896433 27.602941912242958 27.077600440286187 20.233151548506527 130-134 25.231400410266673 27.122629709311052 26.292089858407962 21.35388002201431 135-139 24.976234552459097 27.297743533296643 27.09261019662781 20.63341171761645 140-144 25.212606303151574 27.318659329664836 27.208604302151073 20.260130065032516 145-149 25.80290145072536 27.808904452226113 25.987993996998497 20.400200100050025 150-151 25.887943971985994 27.55127563781891 26.40070035017509 20.16008004002001 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 1.0 18 2.0 19 1.0 20 1.5 21 1.5 22 0.0 23 1.0 24 1.5 25 3.0 26 4.5 27 6.0 28 9.0 29 10.0 30 16.0 31 24.0 32 28.0 33 35.0 34 42.5 35 58.5 36 77.5 37 93.0 38 114.5 39 137.0 40 161.5 41 184.0 42 196.0 43 226.0 44 246.0 45 261.5 46 260.0 47 235.5 48 233.0 49 218.5 50 187.5 51 154.5 52 136.5 53 117.5 54 111.0 55 94.0 56 69.5 57 57.5 58 43.0 59 38.5 60 31.5 61 20.0 62 12.0 63 10.5 64 7.0 65 4.0 66 2.5 67 2.5 68 2.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.025 15-19 0.025 20-24 0.025 25-29 0.034999999999999996 30-34 0.03 35-39 0.04 40-44 0.05 45-49 0.045 50-54 0.04 55-59 0.045 60-64 0.04 65-69 0.034999999999999996 70-74 0.05 75-79 0.045 80-84 0.045 85-89 0.045 90-94 0.05 95-99 0.05 100-104 0.055 105-109 0.055 110-114 0.055 115-119 0.06 120-124 0.06 125-129 0.065 130-134 0.065 135-139 0.065 140-144 0.05 145-149 0.05 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.58902001026168 96.075 2 1.07747562852745 2.1 3 0.12827090815802974 0.375 4 0.1026167265264238 0.4 5 0.02565418163160595 0.125 6 0.0513083632632119 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02565418163160595 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 25 0.625 Illumina Single End PCR Primer 1 (96% over 32bp) GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit GGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.7375 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.325 0.0 0.0 0.0 0.0 114-115 2.7125000000000004 0.0 0.0 0.0 0.0 116-117 3.0875000000000004 0.0 0.0 0.0 0.0 118-119 3.4875 0.0 0.0 0.0 0.0 120-121 4.1625 0.0 0.0 0.0 0.0 122-123 4.6875 0.0 0.0 0.0 0.0 124-125 5.2125 0.0 0.0 0.0 0.0 126-127 5.9125 0.0 0.0 0.0 0.0 128-129 6.2875 0.0 0.0 0.0 0.0 130-131 6.7875 0.0 0.0 0.0 0.0 132-133 7.35 0.0 0.0 0.0 0.0 134-135 8.025 0.0 0.0 0.0 0.0 136-137 8.6875 0.0 0.0 0.0 0.0 138-139 9.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGTTC 10 0.00682755 145.0 2 >>END_MODULE Read 420877 spots for SRR7170883.sra Written 420877 spots for SRR7170883.sra Read 420877 spots for SRR7170883.sra Written 420877 spots for SRR7170883.sra Read 420877 spots for SRR7170883.sra Written 420877 spots for SRR7170883.sra Read 420877 spots for SRR7170883.sra Written 420877 spots for SRR7170883.sra Read 420877 spots for SRR7170883.sra Written 420877 spots for SRR7170883.sra Read 420877 spots for SRR7170883.sra Written 420877 spots for SRR7170883.sra Read 420877 spots for SRR7170883.sra Written 420877 spots for SRR7170883.sra Read 420877 spots for SRR7170883.sra Written 420877 spots for SRR7170883.sra Read 420877 spots for SRR7170883.sra Written 420877 spots for SRR7170883.sra Read 420877 spots for SRR7170883.sra Written 420877 spots for SRR7170883.sra Read 420877 spots for SRR7170883.sra Written 420877 spots for SRR7170883.sra Read 420877 spots for SRR7170883.sra Written 420877 spots for SRR7170883.sra Read 420877 spots for SRR7170883.sra Written 420877 spots for SRR7170883.sra Read 420877 spots for SRR7170883.sra Written 420877 spots for SRR7170883.sra Read 420877 spots for SRR7170883.sra Written 420877 spots for SRR7170883.sra Read 420877 spots for SRR7170883.sra Written 420877 spots for SRR7170883.sra Read 420877 spots for SRR7170883.sra Written 420877 spots for SRR7170883.sra Read 420877 spots for SRR7170883.sra Written 420877 spots for SRR7170883.sra Read 420877 spots for SRR7170883.sra Written 420877 spots for SRR7170883.sra Read 420895 spots for SRR7170883.sra Written 420895 spots for SRR7170883.sra SRR ids: ['SRR7170883.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bl81kn1b SRR7170883.sra spots: 8417558 blocks: [[1, 420877], [420878, 841754], [841755, 1262631], [1262632, 1683508], [1683509, 2104385], [2104386, 2525262], [2525263, 2946139], [2946140, 3367016], [3367017, 3787893], [3787894, 4208770], [4208771, 4629647], [4629648, 5050524], [5050525, 5471401], [5471402, 5892278], [5892279, 6313155], [6313156, 6734032], [6734033, 7154909], [7154910, 7575786], [7575787, 7996663], [7996664, 8417558]] SRR7170883 file size 2833824 SRR7170883 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170883 SRR7170883_1.fastq SRR7170883_2.fastq Input file: SRR7170883_1.fastq Paired file: SRR7170883_2.fastq trimmed: SRR7170883-trimmed-pair1.fastq, SRR7170883-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:23:44 2025 >> started Thu Feb 13 21:23:54 2025 >> done (9.823s) 8417558 read pairs processed; of these: 14035 ( 0.17%) short read pairs filtered out after trimming by size control 75105 ( 0.89%) empty read pairs filtered out after trimming by size control 8328418 (98.94%) read pairs available; of these: 5310625 (63.77%) trimmed read pairs available after processing 3017793 (36.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 10 0.00% 20 10 0.00% 21 11 0.00% 22 14 0.00% 23 8 0.00% 24 12 0.00% 25 13 0.00% 26 14 0.00% 27 17 0.00% 28 22 0.00% 29 18 0.00% 30 21 0.00% 31 27 0.00% 32 16 0.00% 33 14 0.00% 34 17 0.00% 35 14 0.00% 36 16 0.00% 37 21 0.00% 38 39 0.00% 39 24 0.00% 40 36 0.00% 41 24 0.00% 42 29 0.00% 43 32 0.00% 44 36 0.00% 45 39 0.00% 46 52 0.00% 47 51 0.00% 48 76 0.00% 49 68 0.00% 50 86 0.00% 51 87 0.00% 52 79 0.00% 53 128 0.00% 54 137 0.00% 55 134 0.00% 56 157 0.00% 57 187 0.00% 58 163 0.00% 59 201 0.00% 60 222 0.00% 61 249 0.00% 62 294 0.00% 63 356 0.00% 64 380 0.00% 65 387 0.00% 66 438 0.01% 67 436 0.01% 68 488 0.01% 69 644 0.01% 70 702 0.01% 71 858 0.01% 72 916 0.01% 73 1118 0.01% 74 1261 0.02% 75 1562 0.02% 76 3378 0.04% 77 4282 0.05% 78 2765 0.03% 79 2167 0.03% 80 2328 0.03% 81 2592 0.03% 82 2963 0.04% 83 3476 0.04% 84 4473 0.05% 85 4884 0.06% 86 4597 0.06% 87 5071 0.06% 88 5297 0.06% 89 5580 0.07% 90 5819 0.07% 91 6495 0.08% 92 7071 0.08% 93 7709 0.09% 94 8213 0.10% 95 8793 0.11% 96 9113 0.11% 97 9228 0.11% 98 9440 0.11% 99 10023 0.12% 100 10604 0.13% 101 11009 0.13% 102 12432 0.15% 103 13359 0.16% 104 14131 0.17% 105 14861 0.18% 106 15410 0.19% 107 15694 0.19% 108 16320 0.20% 109 16312 0.20% 110 16829 0.20% 111 18244 0.22% 112 19383 0.23% 113 20532 0.25% 114 21805 0.26% 115 23175 0.28% 116 23727 0.28% 117 24483 0.29% 118 24959 0.30% 119 24839 0.30% 120 25532 0.31% 121 27076 0.33% 122 27952 0.34% 123 30194 0.36% 124 31861 0.38% 125 33031 0.40% 126 34700 0.42% 127 35422 0.43% 128 36441 0.44% 129 37516 0.45% 130 38085 0.46% 131 39345 0.47% 132 41893 0.50% 133 44327 0.53% 134 47349 0.57% 135 50449 0.61% 136 53260 0.64% 137 57052 0.69% 138 60395 0.73% 139 64442 0.77% 140 68954 0.83% 141 75351 0.90% 142 83947 1.01% 143 95440 1.15% 144 111763 1.34% 145 133623 1.60% 146 167854 2.02% 147 223937 2.69% 148 328045 3.94% 149 600594 7.21% 150 2098453 25.20% 151 3017793 36.23% 8328418 reads passed initial QC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=9 prefix-density=0.74 prefix-fanout=2.1 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=251.90 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=12.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=1.01 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=64.03 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=1.6 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR7170883 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:24:49 Started mapping on | Feb 13 21:24:49 Finished on | Feb 13 21:26:42 Mapping speed, Million of reads per hour | 265.33 Number of input reads | 8328418 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 7418395 Uniquely mapped reads % | 89.07% Average mapped length | 289.74 Number of splices: Total | 6501988 Number of splices: Annotated (sjdb) | 6363333 Number of splices: GT/AG | 6372890 Number of splices: GC/AG | 103571 Number of splices: AT/AC | 3745 Number of splices: Non-canonical | 21782 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 228846 % of reads mapped to multiple loci | 2.75% Number of reads mapped to too many loci | 54356 % of reads mapped to too many loci | 0.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.38% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 692654 692654 692654 N_multimapping 228846 228846 228846 N_noFeature 244394 7277142 302369 N_ambiguous 129062 704 45222 UnstrandedReadsAssigned:7044939 PositiveStrandReadsAssigned:140549 NegativeStrandReadsAssigned:7070804 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7170883 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170883-trimmed-pair1.fastq SRR7170883-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,328,418 reads, 7,123,258 reads pseudoaligned [quant] estimated average fragment length: 233.286 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR7170883.ke.tsv 34699 SRR7170883.se.tsv 87100 total ==> SRR7170883.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.71 240 15.3446 Potri.005G024800.1.v4.1 1035 802.714 64 9.1028 Potri.004G059700.1.v4.1 961 728.724 3 0.470017 Potri.007G009000.2.v4.1 1416 1183.71 0 0 Potri.003G141000.2.v4.1 2943 2710.71 317 13.3515 Potri.016G087400.1.v4.1 270 89.6829 465 591.969 Potri.015G069301.1.v4.1 564 337.893 0 0 Potri.010G195200.1.v4.1 1773 1540.71 5 0.370513 Potri.012G127500.1.v4.1 977 744.719 197 30.2016 ==> SRR7170883.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 157 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 166 Potri.001G212900.v4.1 91 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 75 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7170883 completed mapping pipeline successfully