Starting /dee2/code/volunteer_pipeline.sh SRR7170884 current disk space = 3088397713408 free memory = 1563013920 SRR7170884 SRAfilesize 42a5122cd1b1394ce8171f4f4986dfab SRR7170884.sra SRR7170884.sra file validated SRR7170884 is paired end SRR7170884 is conventional basespace SRR7170884 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170884_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.14825 34.0 33.0 34.0 32.0 34.0 2 33.1695 34.0 33.0 34.0 32.0 34.0 3 33.116 34.0 33.0 34.0 32.0 34.0 4 33.222 34.0 33.0 34.0 33.0 34.0 5 33.31225 34.0 33.0 34.0 33.0 34.0 6 36.8965 38.0 37.0 38.0 35.0 38.0 7 37.18775 38.0 38.0 38.0 36.0 38.0 8 37.3665 38.0 38.0 38.0 37.0 38.0 9 37.40575 38.0 38.0 38.0 37.0 38.0 10-14 37.39645 38.0 38.0 38.0 36.8 38.0 15-19 37.308299999999996 38.0 38.0 38.0 36.8 38.0 20-24 37.2604 38.0 38.0 38.0 36.6 38.0 25-29 37.2992 38.0 38.0 38.0 36.6 38.0 30-34 37.1793 38.0 38.0 38.0 36.2 38.0 35-39 37.0468 38.0 38.0 38.0 36.0 38.0 40-44 37.09925 38.0 38.0 38.0 36.0 38.0 45-49 36.93335 38.0 38.0 38.0 35.6 38.0 50-54 36.785650000000004 38.0 38.0 38.0 34.8 38.0 55-59 36.64055 38.0 38.0 38.0 34.2 38.0 60-64 36.536249999999995 38.0 38.0 38.0 34.2 38.0 65-69 36.53920000000001 38.0 38.0 38.0 34.2 38.0 70-74 36.492599999999996 38.0 38.0 38.0 34.0 38.0 75-79 36.4428 38.0 38.0 38.0 34.0 38.0 80-84 36.1634 38.0 37.0 38.0 33.2 38.0 85-89 36.141000000000005 38.0 37.0 38.0 33.0 38.0 90-94 35.9525 38.0 37.0 38.0 31.8 38.0 95-99 35.77329999999999 38.0 36.6 38.0 31.4 38.0 100-104 35.394400000000005 38.0 36.2 38.0 29.0 38.0 105-109 35.0208 38.0 35.6 38.0 27.8 38.0 110-114 34.395500000000006 38.0 34.0 38.0 24.0 38.0 115-119 34.15385 38.0 33.8 38.0 23.4 38.0 120-124 33.775 38.0 33.0 38.0 21.8 38.0 125-129 32.85600000000001 38.0 32.2 38.0 15.4 38.0 130-134 32.29715 37.8 31.0 38.0 14.2 38.0 135-139 31.2226 36.4 28.4 38.0 13.0 38.0 140-144 30.738 36.0 28.0 38.0 12.2 38.0 145-149 28.932750000000006 35.4 26.0 38.0 2.0 38.0 150-151 22.276125 27.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 2.0 12 2.0 13 1.0 14 0.0 15 2.0 16 2.0 17 2.0 18 1.0 19 9.0 20 10.0 21 9.0 22 16.0 23 20.0 24 14.0 25 35.0 26 27.0 27 37.0 28 50.0 29 69.0 30 93.0 31 110.0 32 135.0 33 209.0 34 277.0 35 484.0 36 1148.0 37 1234.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.9572206378014 15.996888773658283 8.374384236453201 30.671506352087114 2 20.0 21.099999999999998 34.825 24.075 3 16.478837966441272 28.3496118206862 30.678687703481096 24.492862509391436 4 22.1 34.175 23.925 19.8 5 20.674999999999997 37.625 23.7 18.0 6 17.7 36.125 25.5 20.674999999999997 7 14.325 23.075000000000003 43.95 18.65 8 18.15 24.224999999999998 29.25 28.375 9 17.025000000000002 23.150000000000002 32.925 26.900000000000002 10-14 20.435 28.985 26.534999999999997 24.044999999999998 15-19 20.09 28.63 28.13 23.150000000000002 20-24 19.6 28.26 28.65 23.49 25-29 19.905 29.035 27.83 23.23 30-34 19.955000000000002 28.785 27.76 23.5 35-39 19.89 28.970000000000002 27.384999999999998 23.755000000000003 40-44 19.62 29.205 28.055000000000003 23.119999999999997 45-49 19.99 29.294999999999998 27.034999999999997 23.68 50-54 20.305 28.335 27.950000000000003 23.41 55-59 20.285 28.835 27.77 23.11 60-64 20.01 28.694999999999997 28.18 23.115 65-69 19.845 29.32 28.244999999999997 22.59 70-74 19.75 28.4 28.15 23.7 75-79 19.865 29.475 27.675 22.985 80-84 19.919999999999998 28.854999999999997 27.46 23.765 85-89 20.325 28.625 27.900000000000002 23.150000000000002 90-94 20.674999999999997 28.610000000000003 27.755000000000003 22.96 95-99 20.385 28.59 28.275 22.75 100-104 20.61 28.799999999999997 27.655 22.935 105-109 20.205000000000002 29.14 27.18 23.474999999999998 110-114 20.515 28.67 27.750000000000004 23.064999999999998 115-119 20.49 29.015 27.255000000000003 23.24 120-124 20.415 28.785 26.88 23.919999999999998 125-129 20.724999999999998 28.83 26.52 23.925 130-134 20.695 29.07 27.084999999999997 23.150000000000002 135-139 21.43 28.804999999999996 26.575 23.189999999999998 140-144 21.12 28.749999999999996 26.27 23.86 145-149 21.349999999999998 28.7 26.43 23.52 150-151 21.25 28.6625 26.6 23.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 2.5 20 1.5 21 2.5 22 4.5 23 6.0 24 5.5 25 5.0 26 8.5 27 13.0 28 12.5 29 17.5 30 23.0 31 30.5 32 42.5 33 55.0 34 73.5 35 85.0 36 94.0 37 118.0 38 140.5 39 164.5 40 192.5 41 228.0 42 254.0 43 257.0 44 253.0 45 253.5 46 256.5 47 239.5 48 220.0 49 196.5 50 162.0 51 130.0 52 102.0 53 79.5 54 62.0 55 52.0 56 46.5 57 32.5 58 21.0 59 20.0 60 14.5 61 6.0 62 4.0 63 4.0 64 3.0 65 1.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5749999999999997 2 0.0 3 0.17500000000000002 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54739753583102 98.97500000000001 2 0.35202413879808897 0.7000000000000001 3 0.07543374402816193 0.22499999999999998 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.11249999999999999 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.1749999999999998 0.0 0.0 0.0 0.0 100-101 1.425 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.2375 0.0 0.0 0.0 0.0 108-109 2.625 0.0 0.0 0.0 0.0 110-111 3.1125 0.0 0.0 0.0 0.0 112-113 3.5375 0.0 0.0 0.0 0.0 114-115 3.925 0.0 0.0 0.0 0.0 116-117 4.35 0.0 0.0 0.0 0.0 118-119 4.824999999999999 0.0 0.0 0.0 0.0 120-121 5.25 0.0 0.0 0.0 0.0 122-123 5.8625 0.0 0.0 0.0 0.0 124-125 6.35 0.0 0.0 0.0 0.0 126-127 7.0375 0.0 0.0 0.0 0.0 128-129 7.8125 0.0 0.0 0.0 0.0 130-131 8.3 0.0 0.0 0.0 0.0 132-133 8.9 0.0 0.0 0.0 0.0 134-135 9.35 0.0 0.0 0.0 0.0 136-137 9.9125 0.0 0.0 0.0 0.0 138-139 10.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACTTT 10 0.006836113 144.9625 2 CGTCTGA 20 0.005942617 28.992498 135-139 GTCTGAA 30 0.0014459731 24.160418 135-139 >>END_MODULE SRR7170884 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170884_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.847 33.0 33.0 34.0 32.0 34.0 2 32.8085 33.0 33.0 34.0 32.0 34.0 3 32.8785 33.0 33.0 34.0 32.0 34.0 4 32.93575 34.0 33.0 34.0 32.0 34.0 5 32.882 34.0 33.0 34.0 32.0 34.0 6 37.09725 38.0 38.0 38.0 36.0 38.0 7 37.09425 38.0 38.0 38.0 37.0 38.0 8 37.0355 38.0 38.0 38.0 36.0 38.0 9 37.1445 38.0 38.0 38.0 37.0 38.0 10-14 37.088300000000004 38.0 38.0 38.0 36.0 38.0 15-19 37.064750000000004 38.0 38.0 38.0 36.4 38.0 20-24 36.98335 38.0 38.0 38.0 36.0 38.0 25-29 36.9359 38.0 38.0 38.0 36.0 38.0 30-34 36.870050000000006 38.0 38.0 38.0 36.0 38.0 35-39 36.9003 38.0 38.0 38.0 36.0 38.0 40-44 36.93125 38.0 38.0 38.0 36.0 38.0 45-49 36.98075 38.0 38.0 38.0 36.0 38.0 50-54 36.8938 38.0 38.0 38.0 35.8 38.0 55-59 36.79535 38.0 38.0 38.0 35.8 38.0 60-64 36.73925 38.0 38.0 38.0 35.2 38.0 65-69 36.653000000000006 38.0 38.0 38.0 34.8 38.0 70-74 36.51085 38.0 38.0 38.0 34.0 38.0 75-79 36.4803 38.0 38.0 38.0 34.2 38.0 80-84 36.3327 38.0 38.0 38.0 33.8 38.0 85-89 36.22255 38.0 38.0 38.0 33.8 38.0 90-94 36.06525 38.0 37.6 38.0 33.0 38.0 95-99 35.84025 38.0 37.0 38.0 31.8 38.0 100-104 35.72865 38.0 37.0 38.0 31.4 38.0 105-109 35.5363 38.0 37.0 38.0 29.8 38.0 110-114 35.2543 38.0 36.2 38.0 28.6 38.0 115-119 34.954299999999996 38.0 36.0 38.0 27.6 38.0 120-124 34.5726 38.0 35.4 38.0 24.8 38.0 125-129 33.967349999999996 38.0 33.8 38.0 22.6 38.0 130-134 33.492 38.0 33.2 38.0 20.2 38.0 135-139 32.877449999999996 38.0 33.0 38.0 15.6 38.0 140-144 31.878949999999996 38.0 31.4 38.0 12.8 38.0 145-149 30.8825 37.6 30.4 38.0 6.0 38.0 150-151 24.683125 31.5 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 2.0 6 1.0 7 0.0 8 4.0 9 2.0 10 0.0 11 2.0 12 1.0 13 1.0 14 4.0 15 7.0 16 5.0 17 6.0 18 5.0 19 7.0 20 13.0 21 16.0 22 10.0 23 20.0 24 24.0 25 16.0 26 36.0 27 43.0 28 34.0 29 46.0 30 48.0 31 64.0 32 85.0 33 166.0 34 224.0 35 349.0 36 797.0 37 1959.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.45 20.4 11.575000000000001 22.575 2 26.375 24.825 31.45 17.349999999999998 3 21.65 26.724999999999998 32.15 19.475 4 23.3 34.5 23.7 18.5 5 23.075000000000003 38.074999999999996 22.6 16.25 6 19.900000000000002 38.175 23.075000000000003 18.85 7 18.6 18.525 42.175000000000004 20.7 8 20.599999999999998 24.6 28.599999999999998 26.200000000000003 9 23.05 24.075 28.849999999999998 24.025 10-14 22.564999999999998 28.565 27.41 21.46 15-19 22.395 28.355000000000004 28.244999999999997 21.005 20-24 23.275000000000002 28.405 27.935 20.385 25-29 22.425 28.24 28.754999999999995 20.580000000000002 30-34 22.31 28.685 28.785 20.22 35-39 22.335 28.485 28.389999999999997 20.79 40-44 22.675 28.17 28.585 20.57 45-49 22.18 28.244999999999997 28.939999999999998 20.635 50-54 22.455 28.28 28.544999999999998 20.72 55-59 22.755 28.185 28.155 20.905 60-64 22.615 27.834999999999997 28.68 20.87 65-69 22.63 27.889999999999997 28.599999999999998 20.880000000000003 70-74 22.705000000000002 28.335 27.875 21.085 75-79 23.06 27.435 28.52 20.985 80-84 22.84 28.105000000000004 28.349999999999998 20.705000000000002 85-89 23.34 28.1 27.665 20.895 90-94 22.93 27.925 28.57 20.575 95-99 22.49 27.944999999999997 28.77 20.794999999999998 100-104 23.549999999999997 28.08 28.315 20.055 105-109 23.515 27.58 28.999999999999996 19.905 110-114 24.03 27.779999999999998 27.51 20.68 115-119 23.95 28.494999999999997 27.66 19.895 120-124 24.605 28.18 27.500000000000004 19.715 125-129 24.705 28.51 27.1 19.685 130-134 25.03 27.76 27.334999999999997 19.875 135-139 25.055 27.87 27.265 19.81 140-144 25.1 27.139999999999997 27.765 19.994999999999997 145-149 25.685000000000002 27.950000000000003 26.83 19.535 150-151 26.450000000000003 27.5875 26.85 19.112499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.5 20 0.5 21 1.5 22 2.0 23 3.0 24 6.5 25 6.0 26 4.5 27 9.5 28 17.0 29 21.0 30 19.0 31 18.0 32 28.0 33 39.0 34 53.0 35 69.0 36 86.5 37 122.0 38 166.5 39 188.0 40 218.0 41 231.0 42 237.0 43 270.5 44 282.5 45 257.5 46 251.0 47 263.0 48 233.5 49 185.0 50 154.5 51 124.0 52 91.5 53 77.0 54 67.5 55 54.5 56 37.5 57 28.0 58 18.5 59 15.5 60 13.5 61 7.5 62 7.0 63 5.5 64 2.5 65 2.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3195564516129 98.52499999999999 2 0.6048387096774194 1.2 3 0.025201612903225805 0.075 4 0.05040322580645161 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.0750000000000002 0.0 0.0 0.0 0.0 100-101 1.325 0.0 0.0 0.0 0.0 102-103 1.525 0.0 0.0 0.0 0.0 104-105 1.775 0.0 0.0 0.0 0.0 106-107 2.1125 0.0 0.0 0.0 0.0 108-109 2.5 0.0 0.0 0.0 0.0 110-111 2.9875 0.0 0.0 0.0 0.0 112-113 3.4125 0.0 0.0 0.0 0.0 114-115 3.8375 0.0 0.0 0.0 0.0 116-117 4.262499999999999 0.0 0.0 0.0 0.0 118-119 4.775 0.0 0.0 0.0 0.0 120-121 5.275 0.0 0.0 0.0 0.0 122-123 5.9125 0.0 0.0 0.0 0.0 124-125 6.4 0.0 0.0 0.0 0.0 126-127 7.1 0.0 0.0 0.0 0.0 128-129 7.9 0.0 0.0 0.0 0.0 130-131 8.4375 0.0 0.0 0.0 0.0 132-133 9.05 0.0 0.0 0.0 0.0 134-135 9.5 0.0 0.0 0.0 0.0 136-137 10.1125 0.0 0.0 0.0 0.0 138-139 10.899999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTTTAG 10 0.006830828 145.0 1 GTTCGAT 10 0.006830828 145.0 1 GTGTAGG 20 0.00593511 29.0 135-139 AAGAGCG 20 0.00593511 29.0 125-129 GAAGAGC 20 0.00593511 29.0 125-129 TGTAGGG 20 0.00593511 29.0 135-139 GCGTCGT 20 0.00593511 29.0 130-134 CGTCGTG 20 0.00593511 29.0 130-134 GGGAAAG 20 0.00593511 29.0 140-144 GAGATCG 20 0.00593511 29.0 120-124 >>END_MODULE Read 892552 spots for SRR7170884.sra Written 892552 spots for SRR7170884.sra Read 892552 spots for SRR7170884.sra Written 892552 spots for SRR7170884.sra Read 892552 spots for SRR7170884.sra Written 892552 spots for SRR7170884.sra Read 892552 spots for SRR7170884.sra Written 892552 spots for SRR7170884.sra Read 892552 spots for SRR7170884.sra Written 892552 spots for SRR7170884.sra Read 892552 spots for SRR7170884.sra Written 892552 spots for SRR7170884.sra Read 892552 spots for SRR7170884.sra Written 892552 spots for SRR7170884.sra Read 892552 spots for SRR7170884.sra Written 892552 spots for SRR7170884.sra Read 892552 spots for SRR7170884.sra Written 892552 spots for SRR7170884.sra Read 892552 spots for SRR7170884.sra Written 892552 spots for SRR7170884.sra Read 892552 spots for SRR7170884.sra Written 892552 spots for SRR7170884.sra Read 892552 spots for SRR7170884.sra Written 892552 spots for SRR7170884.sra Read 892552 spots for SRR7170884.sra Written 892552 spots for SRR7170884.sra Read 892552 spots for SRR7170884.sra Written 892552 spots for SRR7170884.sra Read 892552 spots for SRR7170884.sra Written 892552 spots for SRR7170884.sra Read 892552 spots for SRR7170884.sra Written 892552 spots for SRR7170884.sra Read 892568 spots for SRR7170884.sra Written 892568 spots for SRR7170884.sra Read 892552 spots for SRR7170884.sra Written 892552 spots for SRR7170884.sra Read 892552 spots for SRR7170884.sra Written 892552 spots for SRR7170884.sra Read 892552 spots for SRR7170884.sra Written 892552 spots for SRR7170884.sra SRR ids: ['SRR7170884.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xqxxolk1 SRR7170884.sra spots: 17851056 blocks: [[1, 892552], [892553, 1785104], [1785105, 2677656], [2677657, 3570208], [3570209, 4462760], [4462761, 5355312], [5355313, 6247864], [6247865, 7140416], [7140417, 8032968], [8032969, 8925520], [8925521, 9818072], [9818073, 10710624], [10710625, 11603176], [11603177, 12495728], [12495729, 13388280], [13388281, 14280832], [14280833, 15173384], [15173385, 16065936], [16065937, 16958488], [16958489, 17851056]] SRR7170884 file size 6027436 SRR7170884 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170884 SRR7170884_1.fastq SRR7170884_2.fastq Input file: SRR7170884_1.fastq Paired file: SRR7170884_2.fastq trimmed: SRR7170884-trimmed-pair1.fastq, SRR7170884-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:44:02 2025 >> started Thu Feb 13 21:44:22 2025 >> done (20.385s) 17851056 read pairs processed; of these: 24290 ( 0.14%) short read pairs filtered out after trimming by size control 22809 ( 0.13%) empty read pairs filtered out after trimming by size control 17803957 (99.74%) read pairs available; of these: 12626644 (70.92%) trimmed read pairs available after processing 5177313 (29.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 19 0.00% 20 19 0.00% 21 16 0.00% 22 25 0.00% 23 32 0.00% 24 26 0.00% 25 25 0.00% 26 42 0.00% 27 27 0.00% 28 39 0.00% 29 25 0.00% 30 26 0.00% 31 37 0.00% 32 25 0.00% 33 35 0.00% 34 37 0.00% 35 33 0.00% 36 41 0.00% 37 31 0.00% 38 47 0.00% 39 41 0.00% 40 75 0.00% 41 45 0.00% 42 60 0.00% 43 84 0.00% 44 66 0.00% 45 81 0.00% 46 118 0.00% 47 112 0.00% 48 111 0.00% 49 145 0.00% 50 167 0.00% 51 199 0.00% 52 236 0.00% 53 276 0.00% 54 277 0.00% 55 298 0.00% 56 332 0.00% 57 403 0.00% 58 418 0.00% 59 473 0.00% 60 622 0.00% 61 682 0.00% 62 752 0.00% 63 849 0.00% 64 960 0.01% 65 1044 0.01% 66 1104 0.01% 67 1228 0.01% 68 1375 0.01% 69 1733 0.01% 70 1976 0.01% 71 2245 0.01% 72 2620 0.01% 73 2975 0.02% 74 3310 0.02% 75 3664 0.02% 76 4254 0.02% 77 4460 0.03% 78 4531 0.03% 79 4964 0.03% 80 5825 0.03% 81 6728 0.04% 82 7821 0.04% 83 8761 0.05% 84 10304 0.06% 85 10825 0.06% 86 11406 0.06% 87 12203 0.07% 88 12752 0.07% 89 13789 0.08% 90 14967 0.08% 91 16551 0.09% 92 18256 0.10% 93 19966 0.11% 94 21212 0.12% 95 22760 0.13% 96 23295 0.13% 97 23997 0.13% 98 24847 0.14% 99 26105 0.15% 100 27943 0.16% 101 29538 0.17% 102 32550 0.18% 103 34263 0.19% 104 36308 0.20% 105 38578 0.22% 106 39563 0.22% 107 40010 0.22% 108 41488 0.23% 109 42491 0.24% 110 43774 0.25% 111 46262 0.26% 112 49242 0.28% 113 52002 0.29% 114 54803 0.31% 115 56777 0.32% 116 58684 0.33% 117 60289 0.34% 118 60890 0.34% 119 62246 0.35% 120 64677 0.36% 121 67614 0.38% 122 70699 0.40% 123 74887 0.42% 124 78741 0.44% 125 82237 0.46% 126 86190 0.48% 127 88607 0.50% 128 91115 0.51% 129 94321 0.53% 130 97659 0.55% 131 102183 0.57% 132 108866 0.61% 133 116137 0.65% 134 123035 0.69% 135 132478 0.74% 136 140367 0.79% 137 150201 0.84% 138 160291 0.90% 139 172293 0.97% 140 185468 1.04% 141 202539 1.14% 142 225378 1.27% 143 255365 1.43% 144 297347 1.67% 145 352693 1.98% 146 432368 2.43% 147 569317 3.20% 148 824325 4.63% 149 1476802 8.29% 150 4432384 24.90% 151 5177313 29.08% 17803957 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=13 prefix-density=0.45 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.13 sequence-density-rank=20 fanout-score=8.72 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=3.6 sequence=TTGCAGCCATTCTC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=19 prefix-density=0.63 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=21.61 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.7 sequence=ATTTTTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTACCATTGCCTTCTCTCCCTTATCCATGGCAGCTCGAGAATT SRR7170884 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:45:08 Started mapping on | Feb 13 21:45:08 Finished on | Feb 13 21:46:50 Mapping speed, Million of reads per hour | 628.37 Number of input reads | 17803957 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 16863352 Uniquely mapped reads % | 94.72% Average mapped length | 286.96 Number of splices: Total | 16177953 Number of splices: Annotated (sjdb) | 15761497 Number of splices: GT/AG | 15872146 Number of splices: GC/AG | 239935 Number of splices: AT/AC | 10241 Number of splices: Non-canonical | 55631 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 467422 % of reads mapped to multiple loci | 2.63% Number of reads mapped to too many loci | 51457 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.29% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 492925 492925 492925 N_multimapping 467422 467422 467422 N_noFeature 753363 16554297 907513 N_ambiguous 289041 1204 133529 UnstrandedReadsAssigned:15820948 PositiveStrandReadsAssigned:307851 NegativeStrandReadsAssigned:15822310 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=141 echo kmer=137 SRR7170884 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170884-trimmed-pair1.fastq SRR7170884-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,803,957 reads, 15,785,084 reads pseudoaligned [quant] estimated average fragment length: 229.231 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,057 rounds 52401 SRR7170884.ke.tsv 34699 SRR7170884.se.tsv 87100 total ==> SRR7170884.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.77 1274 43.025 Potri.005G024800.1.v4.1 1035 806.769 423 31.6913 Potri.004G059700.1.v4.1 961 732.83 2 0.164959 Potri.007G009000.2.v4.1 1416 1187.77 0 0 Potri.003G141000.2.v4.1 2943 2714.77 825.379 18.3768 Potri.016G087400.1.v4.1 270 93.2835 1150 745.146 Potri.015G069301.1.v4.1 564 342.594 0 0 Potri.010G195200.1.v4.1 1773 1544.77 267.908 10.4827 Potri.012G127500.1.v4.1 977 748.79 266 21.4719 ==> SRR7170884.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 651 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 333 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 274 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170884 completed mapping pipeline successfully