Starting /dee2/code/volunteer_pipeline.sh SRR7170885 current disk space = 3088448901120 free memory = 1495977004 SRR7170885 SRAfilesize 392f62e1cacf34761c70323c542b5122 SRR7170885.sra SRR7170885.sra file validated SRR7170885 is paired end SRR7170885 is conventional basespace SRR7170885 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170885_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.47725 34.0 33.0 34.0 32.0 34.0 2 33.11375 34.0 33.0 34.0 32.0 34.0 3 33.19925 34.0 33.0 34.0 32.0 34.0 4 33.23425 34.0 33.0 34.0 32.0 34.0 5 33.2305 34.0 33.0 34.0 32.0 34.0 6 36.64075 38.0 37.0 38.0 34.0 38.0 7 37.1305 38.0 38.0 38.0 36.0 38.0 8 37.24075 38.0 38.0 38.0 36.0 38.0 9 37.3715 38.0 38.0 38.0 37.0 38.0 10-14 37.3874 38.0 38.0 38.0 37.0 38.0 15-19 37.2975 38.0 38.0 38.0 36.8 38.0 20-24 37.23535 38.0 38.0 38.0 36.4 38.0 25-29 37.21955 38.0 38.0 38.0 36.2 38.0 30-34 37.1323 38.0 38.0 38.0 36.0 38.0 35-39 37.1104 38.0 38.0 38.0 36.0 38.0 40-44 37.0065 38.0 38.0 38.0 36.0 38.0 45-49 36.91134999999999 38.0 38.0 38.0 35.2 38.0 50-54 36.834500000000006 38.0 38.0 38.0 35.0 38.0 55-59 36.781949999999995 38.0 38.0 38.0 35.0 38.0 60-64 36.696600000000004 38.0 38.0 38.0 34.6 38.0 65-69 36.58815 38.0 38.0 38.0 34.0 38.0 70-74 36.549850000000006 38.0 38.0 38.0 34.0 38.0 75-79 36.34135 38.0 37.0 38.0 34.0 38.0 80-84 36.0612 38.0 37.0 38.0 33.0 38.0 85-89 36.115899999999996 38.0 37.0 38.0 33.2 38.0 90-94 35.8845 38.0 37.0 38.0 31.8 38.0 95-99 35.593700000000005 38.0 36.6 38.0 30.4 38.0 100-104 35.465250000000005 38.0 36.2 38.0 29.8 38.0 105-109 35.12665 38.0 35.8 38.0 28.4 38.0 110-114 34.99225 38.0 35.4 38.0 28.4 38.0 115-119 34.662549999999996 38.0 34.8 38.0 26.6 38.0 120-124 34.21635 38.0 33.6 38.0 24.4 38.0 125-129 33.70295 38.0 33.0 38.0 22.2 38.0 130-134 33.08815 38.0 32.8 38.0 19.4 38.0 135-139 32.34005 37.2 31.0 38.0 15.2 38.0 140-144 31.4224 36.6 29.6 38.0 12.8 38.0 145-149 29.7875 36.0 28.0 38.0 5.8 38.0 150-151 23.567625 29.5 12.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 0.0 14 1.0 15 2.0 16 5.0 17 4.0 18 4.0 19 11.0 20 4.0 21 5.0 22 11.0 23 12.0 24 14.0 25 21.0 26 25.0 27 36.0 28 50.0 29 59.0 30 76.0 31 97.0 32 128.0 33 202.0 34 279.0 35 482.0 36 1088.0 37 1382.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.64532650448143 15.211267605633802 10.57618437900128 37.56722151088348 2 20.150000000000002 19.775000000000002 35.675000000000004 24.4 3 16.925 26.0 29.125 27.950000000000003 4 21.375 32.425 23.9 22.3 5 22.575 35.525 23.974999999999998 17.925 6 16.425 38.65 25.825 19.1 7 14.299999999999999 24.775 43.725 17.2 8 17.75 24.474999999999998 32.2 25.575 9 15.775 26.075 33.5 24.65 10-14 19.145 31.009999999999998 26.779999999999998 23.064999999999998 15-19 19.105 30.154999999999998 27.500000000000004 23.24 20-24 19.415 29.470000000000002 27.815 23.3 25-29 18.945 29.875 27.825 23.355 30-34 19.03 29.904999999999998 28.24 22.825 35-39 19.305 29.84 27.355 23.5 40-44 19.355 30.055 27.685 22.905 45-49 19.28 29.349999999999998 27.465 23.905 50-54 19.185 29.935000000000002 27.765 23.115 55-59 19.794999999999998 29.43 27.139999999999997 23.635 60-64 19.585 29.409999999999997 27.58 23.425 65-69 19.825 29.69 27.61 22.875 70-74 19.605 29.425 27.975 22.994999999999997 75-79 20.4 28.89 27.24 23.47 80-84 20.169999999999998 28.38 27.875 23.575 85-89 19.71 28.565 28.075 23.65 90-94 19.7 29.165000000000003 27.584999999999997 23.549999999999997 95-99 20.205000000000002 28.76 27.12 23.915 100-104 19.775000000000002 29.025000000000002 27.875 23.325000000000003 105-109 19.869999999999997 29.4 27.1 23.630000000000003 110-114 20.06 28.96 27.200000000000003 23.78 115-119 20.715 29.04 26.83 23.415 120-124 20.885 27.985 27.35 23.78 125-129 20.549999999999997 28.9 26.540000000000003 24.01 130-134 20.925 28.810000000000002 26.150000000000002 24.115000000000002 135-139 20.935000000000002 28.57 26.729999999999997 23.765 140-144 20.979999999999997 28.38 26.31 24.33 145-149 21.27 28.860000000000003 25.81 24.060000000000002 150-151 20.775 28.6625 26.200000000000003 24.3625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 2.5 21 3.0 22 1.5 23 2.5 24 5.5 25 10.5 26 13.5 27 13.0 28 15.5 29 21.5 30 32.0 31 42.5 32 50.5 33 72.0 34 95.5 35 105.0 36 114.5 37 143.5 38 167.0 39 170.5 40 187.5 41 205.5 42 222.0 43 226.5 44 222.0 45 250.5 46 248.0 47 209.5 48 207.5 49 195.5 50 156.5 51 128.5 52 106.0 53 91.5 54 78.5 55 52.0 56 34.5 57 29.0 58 21.5 59 15.5 60 8.5 61 5.0 62 4.0 63 2.5 64 2.0 65 1.0 66 1.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03675538656526 97.675 2 0.8365019011406843 1.6500000000000001 3 0.050697084917617236 0.15 4 0.0 0.0 5 0.050697084917617236 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025348542458808618 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 3 (97% over 36bp) CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit GTTCGATTCAGCATCCGAATCCAGAAAGCAAAAACAAAGTAGAATATTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 0.9874999999999999 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.4500000000000002 0.0 0.0 0.0 0.0 100-101 1.7 0.0 0.0 0.0 0.0 102-103 1.925 0.0 0.0 0.0 0.0 104-105 2.3499999999999996 0.0 0.0 0.0 0.0 106-107 2.675 0.0 0.0 0.0 0.0 108-109 3.0375 0.0 0.0 0.0 0.0 110-111 3.425 0.0 0.0 0.0 0.0 112-113 3.85 0.0 0.0 0.0 0.0 114-115 4.387499999999999 0.0 0.0 0.0 0.0 116-117 4.95 0.0 0.0 0.0 0.0 118-119 5.612500000000001 0.0 0.0 0.0 0.0 120-121 6.0625 0.0 0.0 0.0 0.0 122-123 6.699999999999999 0.0 0.0 0.0 0.0 124-125 7.425 0.0 0.0 0.0 0.0 126-127 8.1625 0.0 0.0 0.0 0.0 128-129 8.975000000000001 0.0 0.0 0.0 0.0 130-131 9.6875 0.0 0.0 0.0 0.0 132-133 10.4875 0.0 0.0 0.0 0.0 134-135 11.3625 0.0 0.0 0.0 0.0 136-137 12.125 0.0 0.0 0.0 0.0 138-139 12.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATGGA 10 0.006836113 144.9625 145 AAAAAAA 35 0.0035419178 20.70893 25-29 >>END_MODULE SRR7170885 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170885_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72925 33.0 33.0 34.0 32.0 34.0 2 32.87 33.0 33.0 34.0 32.0 34.0 3 32.9245 34.0 33.0 34.0 32.0 34.0 4 32.962 34.0 33.0 34.0 32.0 34.0 5 32.979 34.0 33.0 34.0 32.0 34.0 6 37.2355 38.0 38.0 38.0 37.0 38.0 7 37.261 38.0 38.0 38.0 37.0 38.0 8 37.1155 38.0 38.0 38.0 37.0 38.0 9 37.10475 38.0 38.0 38.0 37.0 38.0 10-14 37.201 38.0 38.0 38.0 37.0 38.0 15-19 37.23975 38.0 38.0 38.0 37.0 38.0 20-24 37.17285 38.0 38.0 38.0 36.8 38.0 25-29 37.07254999999999 38.0 38.0 38.0 36.4 38.0 30-34 37.072199999999995 38.0 38.0 38.0 36.2 38.0 35-39 37.0744 38.0 38.0 38.0 36.4 38.0 40-44 36.99425 38.0 38.0 38.0 36.0 38.0 45-49 37.012550000000005 38.0 38.0 38.0 36.0 38.0 50-54 36.99915 38.0 38.0 38.0 36.0 38.0 55-59 36.97965000000001 38.0 38.0 38.0 36.0 38.0 60-64 36.910799999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.7962 38.0 38.0 38.0 35.2 38.0 70-74 36.78144999999999 38.0 38.0 38.0 35.2 38.0 75-79 36.7144 38.0 38.0 38.0 35.0 38.0 80-84 36.47895 38.0 38.0 38.0 34.6 38.0 85-89 36.422000000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.21665 38.0 38.0 38.0 33.6 38.0 95-99 36.15315 38.0 38.0 38.0 33.8 38.0 100-104 35.986399999999996 38.0 37.2 38.0 33.4 38.0 105-109 35.802749999999996 38.0 37.0 38.0 32.4 38.0 110-114 35.53855 38.0 36.6 38.0 31.4 38.0 115-119 35.164300000000004 38.0 36.4 38.0 28.4 38.0 120-124 34.93485 38.0 35.8 38.0 27.6 38.0 125-129 34.67165 38.0 35.2 38.0 26.6 38.0 130-134 34.21185 38.0 33.8 38.0 24.4 38.0 135-139 33.77875 38.0 33.0 38.0 22.6 38.0 140-144 32.836800000000004 38.0 33.0 38.0 16.6 38.0 145-149 31.3151 38.0 31.0 38.0 8.2 38.0 150-151 25.327375 32.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 1.0 5 0.0 6 1.0 7 0.0 8 2.0 9 3.0 10 0.0 11 1.0 12 4.0 13 6.0 14 2.0 15 4.0 16 3.0 17 1.0 18 5.0 19 7.0 20 13.0 21 12.0 22 8.0 23 16.0 24 13.0 25 16.0 26 13.0 27 30.0 28 30.0 29 46.0 30 41.0 31 89.0 32 90.0 33 109.0 34 178.0 35 355.0 36 762.0 37 2135.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.574999999999996 20.075000000000003 14.075 26.275 2 26.35 24.8 33.050000000000004 15.8 3 20.330082520630157 28.40710177544386 32.13303325831458 19.129782445611404 4 24.05 34.225 22.5 19.225 5 25.656414103525883 37.109277319329834 20.355088772193046 16.879219804951237 6 18.35 38.925 24.5 18.224999999999998 7 20.549999999999997 19.7 40.300000000000004 19.45 8 21.725 25.275 28.575 24.425 9 21.775 25.124999999999996 29.049999999999997 24.05 10-14 24.395 28.32 26.235000000000003 21.05 15-19 23.46 28.34 27.845 20.355 20-24 23.285 28.499999999999996 27.665 20.549999999999997 25-29 23.34 28.1 27.884999999999998 20.674999999999997 30-34 23.080000000000002 28.33 27.950000000000003 20.64 35-39 23.175 28.465 27.42 20.94 40-44 22.975 28.62 27.6 20.805 45-49 22.785 27.605 28.535 21.075 50-54 22.955000000000002 27.92 28.610000000000003 20.515 55-59 23.794999999999998 27.965 27.955000000000002 20.285 60-64 22.585 27.63 28.449999999999996 21.335 65-69 23.41 27.47 28.62 20.5 70-74 23.294999999999998 28.155 27.765 20.785 75-79 23.145 27.884999999999998 27.825 21.145 80-84 23.41 28.28 27.87 20.44 85-89 23.875 27.63 28.060000000000002 20.435 90-94 24.224999999999998 27.884999999999998 27.93 19.96 95-99 23.855 27.725 28.025 20.395 100-104 23.66 27.634999999999998 28.599999999999998 20.105 105-109 23.935000000000002 27.495000000000005 28.610000000000003 19.96 110-114 24.59 28.165000000000003 27.555000000000003 19.689999999999998 115-119 24.654999999999998 28.16 27.589999999999996 19.595000000000002 120-124 24.75 28.15 27.815 19.285 125-129 24.94 27.975 27.415 19.67 130-134 25.21 27.97 27.395000000000003 19.425 135-139 25.540000000000003 26.935 28.065 19.46 140-144 26.195 28.09 26.795 18.92 145-149 26.57 27.565 26.995 18.87 150-151 26.6625 27.750000000000004 27.150000000000002 18.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.0 21 1.0 22 2.0 23 1.5 24 1.5 25 3.5 26 6.5 27 8.5 28 8.5 29 11.0 30 20.0 31 26.5 32 32.0 33 42.0 34 57.0 35 71.0 36 89.0 37 108.5 38 130.5 39 165.0 40 189.0 41 199.0 42 234.5 43 264.5 44 256.5 45 260.0 46 265.0 47 257.5 48 249.5 49 216.5 50 171.5 51 136.0 52 115.0 53 99.5 54 77.0 55 64.0 56 48.0 57 31.5 58 23.5 59 16.5 60 12.5 61 8.0 62 5.5 63 3.0 64 2.0 65 2.5 66 0.5 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0365111561866 97.65 2 0.7606490872210954 1.5 3 0.12677484787018256 0.375 4 0.02535496957403651 0.1 5 0.02535496957403651 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02535496957403651 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCT 10 0.25 Illumina Single End PCR Primer 1 (96% over 32bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0125 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.9 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.2375 0.0 0.0 0.0 0.0 98-99 1.525 0.0 0.0 0.0 0.0 100-101 1.775 0.0 0.0 0.0 0.0 102-103 1.9875 0.0 0.0 0.0 0.0 104-105 2.425 0.0 0.0 0.0 0.0 106-107 2.75 0.0 0.0 0.0 0.0 108-109 3.1125 0.0 0.0 0.0 0.0 110-111 3.5 0.0 0.0 0.0 0.0 112-113 3.9375 0.0 0.0 0.0 0.0 114-115 4.5 0.0 0.0 0.0 0.0 116-117 5.1 0.0 0.0 0.0 0.0 118-119 5.725 0.0 0.0 0.0 0.0 120-121 6.137499999999999 0.0 0.0 0.0 0.0 122-123 6.8375 0.0 0.0 0.0 0.0 124-125 7.6 0.0 0.0 0.0 0.0 126-127 8.3625 0.0 0.0 0.0 0.0 128-129 9.225000000000001 0.0 0.0 0.0 0.0 130-131 9.9875 0.0 0.0 0.0 0.0 132-133 10.7875 0.0 0.0 0.0 0.0 134-135 11.7 0.0 0.0 0.0 0.0 136-137 12.4875 0.0 0.0 0.0 0.0 138-139 13.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTCGC 10 0.006830828 145.0 145 CTTGGCG 10 0.006830828 145.0 1 GGAAGAT 10 0.006830828 145.0 1 TTGGCGC 10 0.006830828 145.0 2 TGGCGCC 10 0.006830828 145.0 3 CTTGAGG 10 0.006830828 145.0 5 >>END_MODULE Read 879835 spots for SRR7170885.sra Written 879835 spots for SRR7170885.sra Read 879835 spots for SRR7170885.sra Written 879835 spots for SRR7170885.sra Read 879835 spots for SRR7170885.sra Written 879835 spots for SRR7170885.sra Read 879835 spots for SRR7170885.sra Written 879835 spots for SRR7170885.sra Read 879835 spots for SRR7170885.sra Written 879835 spots for SRR7170885.sra Read 879835 spots for SRR7170885.sra Written 879835 spots for SRR7170885.sra Read 879835 spots for SRR7170885.sra Written 879835 spots for SRR7170885.sra Read 879835 spots for SRR7170885.sra Written 879835 spots for SRR7170885.sra Read 879835 spots for SRR7170885.sra Written 879835 spots for SRR7170885.sra Read 879835 spots for SRR7170885.sra Written 879835 spots for SRR7170885.sra Read 879835 spots for SRR7170885.sra Written 879835 spots for SRR7170885.sra Read 879835 spots for SRR7170885.sra Written 879835 spots for SRR7170885.sra Read 879835 spots for SRR7170885.sra Written 879835 spots for SRR7170885.sra Read 879835 spots for SRR7170885.sra Written 879835 spots for SRR7170885.sra Read 879847 spots for SRR7170885.sra Written 879847 spots for SRR7170885.sra Read 879835 spots for SRR7170885.sra Written 879835 spots for SRR7170885.sra Read 879835 spots for SRR7170885.sra Written 879835 spots for SRR7170885.sra Read 879835 spots for SRR7170885.sra Written 879835 spots for SRR7170885.sra Read 879835 spots for SRR7170885.sra Written 879835 spots for SRR7170885.sra Read 879835 spots for SRR7170885.sra Written 879835 spots for SRR7170885.sra SRR ids: ['SRR7170885.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sybzwqyw SRR7170885.sra spots: 17596712 blocks: [[1, 879835], [879836, 1759670], [1759671, 2639505], [2639506, 3519340], [3519341, 4399175], [4399176, 5279010], [5279011, 6158845], [6158846, 7038680], [7038681, 7918515], [7918516, 8798350], [8798351, 9678185], [9678186, 10558020], [10558021, 11437855], [11437856, 12317690], [12317691, 13197525], [13197526, 14077360], [14077361, 14957195], [14957196, 15837030], [15837031, 16716865], [16716866, 17596712]] SRR7170885 file size 5941247 SRR7170885 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170885 SRR7170885_1.fastq SRR7170885_2.fastq Input file: SRR7170885_1.fastq Paired file: SRR7170885_2.fastq trimmed: SRR7170885-trimmed-pair1.fastq, SRR7170885-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:50:04 2025 >> started Thu Feb 13 21:50:32 2025 >> done (28.033s) 17596712 read pairs processed; of these: 18945 ( 0.11%) short read pairs filtered out after trimming by size control 63996 ( 0.36%) empty read pairs filtered out after trimming by size control 17513771 (99.53%) read pairs available; of these: 12314381 (70.31%) trimmed read pairs available after processing 5199390 (29.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 9 0.00% 20 10 0.00% 21 8 0.00% 22 9 0.00% 23 10 0.00% 24 12 0.00% 25 11 0.00% 26 11 0.00% 27 20 0.00% 28 11 0.00% 29 20 0.00% 30 14 0.00% 31 29 0.00% 32 27 0.00% 33 20 0.00% 34 29 0.00% 35 25 0.00% 36 26 0.00% 37 34 0.00% 38 36 0.00% 39 34 0.00% 40 44 0.00% 41 65 0.00% 42 56 0.00% 43 69 0.00% 44 67 0.00% 45 67 0.00% 46 86 0.00% 47 116 0.00% 48 143 0.00% 49 141 0.00% 50 202 0.00% 51 217 0.00% 52 272 0.00% 53 273 0.00% 54 272 0.00% 55 289 0.00% 56 350 0.00% 57 390 0.00% 58 459 0.00% 59 593 0.00% 60 664 0.00% 61 790 0.00% 62 889 0.01% 63 965 0.01% 64 1057 0.01% 65 1133 0.01% 66 1251 0.01% 67 1450 0.01% 68 1637 0.01% 69 1907 0.01% 70 2222 0.01% 71 2458 0.01% 72 2934 0.02% 73 3365 0.02% 74 3916 0.02% 75 4914 0.03% 76 8930 0.05% 77 7940 0.05% 78 5908 0.03% 79 6203 0.04% 80 6637 0.04% 81 7498 0.04% 82 8681 0.05% 83 9911 0.06% 84 11722 0.07% 85 12314 0.07% 86 13001 0.07% 87 14047 0.08% 88 15099 0.09% 89 15690 0.09% 90 17234 0.10% 91 18872 0.11% 92 20333 0.12% 93 22704 0.13% 94 24296 0.14% 95 25718 0.15% 96 27095 0.15% 97 28389 0.16% 98 29417 0.17% 99 30827 0.18% 100 32654 0.19% 101 34047 0.19% 102 37164 0.21% 103 38854 0.22% 104 41325 0.24% 105 43667 0.25% 106 44826 0.26% 107 46369 0.26% 108 47051 0.27% 109 48334 0.28% 110 50127 0.29% 111 52317 0.30% 112 55067 0.31% 113 56430 0.32% 114 59869 0.34% 115 62578 0.36% 116 64441 0.37% 117 65632 0.37% 118 67275 0.38% 119 68598 0.39% 120 70122 0.40% 121 73351 0.42% 122 75001 0.43% 123 78943 0.45% 124 82054 0.47% 125 84717 0.48% 126 88388 0.50% 127 90943 0.52% 128 94232 0.54% 129 97398 0.56% 130 100097 0.57% 131 103403 0.59% 132 108262 0.62% 133 114606 0.65% 134 121287 0.69% 135 128465 0.73% 136 136023 0.78% 137 145369 0.83% 138 155509 0.89% 139 165877 0.95% 140 178068 1.02% 141 194027 1.11% 142 215610 1.23% 143 240747 1.37% 144 277344 1.58% 145 326436 1.86% 146 405015 2.31% 147 535503 3.06% 148 781922 4.46% 149 1361960 7.78% 150 4242473 24.22% 151 5199390 29.69% 17513771 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=32 prefix-density=0.32 prefix-fanout=2.7 sequence=ATCATTTTACATATTGATAAAGACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=155.27 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.9 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAA criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=8.33 fanout-score-rank=8 prefix-density=1.70 prefix-fanout=1.9 sequence=CACCTGCGACAACTGCGACTGCG criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=31.19 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.1 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT SRR7170885 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:51:13 Started mapping on | Feb 13 21:51:14 Finished on | Feb 13 21:53:03 Mapping speed, Million of reads per hour | 578.44 Number of input reads | 17513771 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 16687383 Uniquely mapped reads % | 95.28% Average mapped length | 286.04 Number of splices: Total | 14659830 Number of splices: Annotated (sjdb) | 14281846 Number of splices: GT/AG | 14359658 Number of splices: GC/AG | 224101 Number of splices: AT/AC | 12440 Number of splices: Non-canonical | 63631 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 1.99 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 443698 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 27600 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.98% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 397312 397312 397312 N_multimapping 443698 443698 443698 N_noFeature 569442 16305232 704323 N_ambiguous 396739 1211 148793 UnstrandedReadsAssigned:15721202 PositiveStrandReadsAssigned:380940 NegativeStrandReadsAssigned:15834267 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=139 echo kmer=135 SRR7170885 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170885-trimmed-pair1.fastq SRR7170885-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,513,771 reads, 15,788,478 reads pseudoaligned [quant] estimated average fragment length: 213.169 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 SRR7170885.ke.tsv 34699 SRR7170885.se.tsv 87100 total ==> SRR7170885.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.83 599 15.2402 Potri.005G024800.1.v4.1 1035 822.831 640 35.7363 Potri.004G059700.1.v4.1 961 748.846 16 0.981675 Potri.007G009000.2.v4.1 1416 1203.83 1 0.0381658 Potri.003G141000.2.v4.1 2943 2730.83 443.422 7.46041 Potri.016G087400.1.v4.1 270 95.2911 1230.62 593.352 Potri.015G069301.1.v4.1 564 354.567 0 0 Potri.010G195200.1.v4.1 1773 1560.83 91 2.67871 Potri.012G127500.1.v4.1 977 764.836 1023 61.4536 ==> SRR7170885.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 476 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 671 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 20 SRR7170885 completed mapping pipeline successfully