Starting /dee2/code/volunteer_pipeline.sh SRR7170886 current disk space = 3088399048704 free memory = 1449924140 SRR7170886 SRAfilesize 7c9cca40e6b784e25d2e79ae5c4c1f53 SRR7170886.sra SRR7170886.sra file validated SRR7170886 is paired end SRR7170886 is conventional basespace SRR7170886 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170886_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.56 34.0 33.0 34.0 32.0 34.0 2 33.17375 34.0 33.0 34.0 32.0 34.0 3 33.24975 34.0 33.0 34.0 32.0 34.0 4 33.24325 34.0 33.0 34.0 32.0 34.0 5 33.24725 34.0 33.0 34.0 33.0 34.0 6 36.71525 38.0 37.0 38.0 34.0 38.0 7 37.2125 38.0 38.0 38.0 36.0 38.0 8 37.37775 38.0 38.0 38.0 37.0 38.0 9 37.41475 38.0 38.0 38.0 37.0 38.0 10-14 37.400850000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.324400000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.26325 38.0 38.0 38.0 36.8 38.0 25-29 37.239999999999995 38.0 38.0 38.0 36.4 38.0 30-34 37.154999999999994 38.0 38.0 38.0 36.2 38.0 35-39 37.1135 38.0 38.0 38.0 36.0 38.0 40-44 37.02034999999999 38.0 38.0 38.0 36.0 38.0 45-49 37.0607 38.0 38.0 38.0 36.0 38.0 50-54 36.8313 38.0 38.0 38.0 35.2 38.0 55-59 36.7798 38.0 38.0 38.0 35.0 38.0 60-64 36.70095 38.0 38.0 38.0 34.6 38.0 65-69 36.615950000000005 38.0 38.0 38.0 34.4 38.0 70-74 36.521249999999995 38.0 38.0 38.0 34.0 38.0 75-79 36.315200000000004 38.0 38.0 38.0 34.0 38.0 80-84 36.1699 38.0 37.4 38.0 33.6 38.0 85-89 36.20595 38.0 37.0 38.0 33.6 38.0 90-94 35.98085 38.0 37.0 38.0 32.6 38.0 95-99 35.774 38.0 37.0 38.0 31.4 38.0 100-104 35.68775 38.0 36.8 38.0 31.0 38.0 105-109 35.34705 38.0 36.0 38.0 29.0 38.0 110-114 35.089999999999996 38.0 35.8 38.0 28.4 38.0 115-119 34.88575000000001 38.0 35.4 38.0 27.4 38.0 120-124 34.297399999999996 38.0 34.0 38.0 24.6 38.0 125-129 33.800850000000004 38.0 33.2 38.0 21.6 38.0 130-134 33.27885 38.0 33.0 38.0 18.2 38.0 135-139 32.5105 37.8 31.4 38.0 15.2 38.0 140-144 31.8234 37.4 31.0 38.0 13.0 38.0 145-149 30.156650000000003 36.0 28.0 38.0 6.0 38.0 150-151 24.466250000000002 31.5 15.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 3.0 10 1.0 11 4.0 12 0.0 13 0.0 14 2.0 15 3.0 16 0.0 17 1.0 18 4.0 19 7.0 20 7.0 21 8.0 22 5.0 23 7.0 24 17.0 25 22.0 26 26.0 27 30.0 28 50.0 29 60.0 30 67.0 31 81.0 32 115.0 33 181.0 34 294.0 35 455.0 36 1038.0 37 1510.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.41717791411043 13.854805725971369 10.199386503067483 36.52862985685071 2 19.525000000000002 18.075 36.65 25.75 3 17.75 25.775 27.700000000000003 28.775000000000002 4 22.475 32.875 23.724999999999998 20.925 5 21.80545136284071 33.9584896224056 24.456114028507127 19.779944986246562 6 17.125 38.1 25.174999999999997 19.6 7 14.2 22.35 44.725 18.725 8 17.05 23.65 31.45 27.85 9 17.625 23.974999999999998 32.675 25.724999999999998 10-14 19.695 29.459999999999997 27.134999999999998 23.71 15-19 19.775000000000002 28.735 27.36 24.13 20-24 19.814999999999998 28.53 28.185 23.47 25-29 19.689999999999998 28.935 27.47 23.905 30-34 19.93 28.865000000000002 27.694999999999997 23.51 35-39 19.994999999999997 29.015 27.48 23.51 40-44 20.125 29.409999999999997 27.700000000000003 22.765 45-49 20.145 28.525 27.57 23.76 50-54 20.665 28.67 27.150000000000002 23.515 55-59 20.06 28.74 27.825 23.375 60-64 20.705000000000002 28.110000000000003 27.74 23.445 65-69 20.155 28.854999999999997 27.755000000000003 23.235 70-74 20.18 28.810000000000002 27.565 23.445 75-79 19.975 28.77 28.084999999999997 23.169999999999998 80-84 20.21 28.455000000000002 27.82 23.515 85-89 19.97 28.299999999999997 28.18 23.549999999999997 90-94 20.31 28.88 27.750000000000004 23.06 95-99 20.544999999999998 28.144999999999996 27.650000000000002 23.66 100-104 19.939999999999998 28.804999999999996 27.875 23.380000000000003 105-109 20.335 29.225 27.169999999999998 23.27 110-114 20.935000000000002 28.49 26.96 23.615 115-119 21.23 28.15 27.37 23.25 120-124 20.82 29.015 26.93 23.235 125-129 21.224999999999998 28.17 27.0 23.605 130-134 20.945 28.625 27.025 23.405 135-139 21.165 27.815 27.565 23.455000000000002 140-144 21.14 27.915 27.474999999999998 23.47 145-149 20.830000000000002 28.735 26.945000000000004 23.49 150-151 20.7375 28.7 25.887500000000003 24.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 2.0 23 2.5 24 2.5 25 5.0 26 7.5 27 9.0 28 9.0 29 14.0 30 22.5 31 33.5 32 43.0 33 49.0 34 72.0 35 89.0 36 98.5 37 126.0 38 137.5 39 147.0 40 180.5 41 217.0 42 240.0 43 240.0 44 257.5 45 264.5 46 247.5 47 233.5 48 217.5 49 210.5 50 175.5 51 138.0 52 118.0 53 97.0 54 74.5 55 53.0 56 48.5 57 40.5 58 24.5 59 14.5 60 10.0 61 8.0 62 4.0 63 1.0 64 2.0 65 3.0 66 1.0 67 0.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1999999999999997 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24204143506822 98.2 2 0.6568974229408793 1.3 3 0.05053057099545225 0.15 4 0.025265285497726126 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025265285497726126 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 10 0.25 TruSeq Adapter, Index 3 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.45 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.9625 0.0 0.0 0.0 0.0 108-109 2.25 0.0 0.0 0.0 0.0 110-111 2.6375 0.0 0.0 0.0 0.0 112-113 2.9875 0.0 0.0 0.0 0.0 114-115 3.2625 0.0 0.0 0.0 0.0 116-117 3.7 0.0 0.0 0.0 0.0 118-119 4.137499999999999 0.0 0.0 0.0 0.0 120-121 4.550000000000001 0.0 0.0 0.0 0.0 122-123 4.887499999999999 0.0 0.0 0.0 0.0 124-125 5.35 0.0 0.0 0.0 0.0 126-127 5.775 0.0 0.0 0.0 0.0 128-129 6.3875 0.0 0.0 0.0 0.0 130-131 6.875 0.0 0.0 0.0 0.0 132-133 7.375 0.0 0.0 0.0 0.0 134-135 7.9375 0.0 0.0 0.0 0.0 136-137 8.45 0.0 0.0 0.0 0.0 138-139 8.975000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATTA 10 0.006832588 144.9875 2 >>END_MODULE SRR7170886 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170886_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.73275 33.0 33.0 34.0 32.0 34.0 2 32.87125 33.0 33.0 34.0 32.0 34.0 3 32.90575 34.0 33.0 34.0 32.0 34.0 4 32.9525 34.0 33.0 34.0 32.0 34.0 5 32.9435 34.0 33.0 34.0 32.0 34.0 6 37.12575 38.0 38.0 38.0 37.0 38.0 7 37.20975 38.0 38.0 38.0 37.0 38.0 8 37.03175 38.0 38.0 38.0 37.0 38.0 9 36.963 38.0 38.0 38.0 36.0 38.0 10-14 37.1043 38.0 38.0 38.0 36.6 38.0 15-19 37.140750000000004 38.0 38.0 38.0 36.8 38.0 20-24 37.077 38.0 38.0 38.0 36.8 38.0 25-29 36.994350000000004 38.0 38.0 38.0 36.2 38.0 30-34 36.97395 38.0 38.0 38.0 36.0 38.0 35-39 36.95739999999999 38.0 38.0 38.0 36.0 38.0 40-44 36.93605 38.0 38.0 38.0 36.0 38.0 45-49 36.8846 38.0 38.0 38.0 36.0 38.0 50-54 36.92229999999999 38.0 38.0 38.0 36.0 38.0 55-59 36.87425 38.0 38.0 38.0 36.0 38.0 60-64 36.8525 38.0 38.0 38.0 36.0 38.0 65-69 36.708349999999996 38.0 38.0 38.0 35.0 38.0 70-74 36.67285 38.0 38.0 38.0 34.8 38.0 75-79 36.5897 38.0 38.0 38.0 34.6 38.0 80-84 36.406150000000004 38.0 38.0 38.0 34.0 38.0 85-89 36.32925 38.0 38.0 38.0 34.0 38.0 90-94 36.13365 38.0 37.8 38.0 33.6 38.0 95-99 36.09865 38.0 38.0 38.0 33.6 38.0 100-104 35.8793 38.0 37.0 38.0 33.0 38.0 105-109 35.74255 38.0 37.0 38.0 31.8 38.0 110-114 35.529450000000004 38.0 36.8 38.0 30.6 38.0 115-119 35.13955 38.0 36.2 38.0 28.4 38.0 120-124 34.954899999999995 38.0 36.0 38.0 28.2 38.0 125-129 34.45155 38.0 34.8 38.0 25.0 38.0 130-134 34.054899999999996 38.0 33.8 38.0 23.2 38.0 135-139 33.7635 38.0 33.4 38.0 23.0 38.0 140-144 32.83005000000001 38.0 33.0 38.0 16.2 38.0 145-149 31.419050000000006 37.8 31.8 38.0 8.0 38.0 150-151 25.41075 32.0 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 2.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 2.0 11 3.0 12 3.0 13 3.0 14 1.0 15 8.0 16 2.0 17 6.0 18 3.0 19 8.0 20 19.0 21 5.0 22 11.0 23 13.0 24 23.0 25 16.0 26 19.0 27 30.0 28 42.0 29 48.0 30 52.0 31 66.0 32 87.0 33 109.0 34 198.0 35 299.0 36 809.0 37 2106.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.425 20.875 12.825000000000001 25.874999999999996 2 26.674999999999997 25.5 31.674999999999997 16.150000000000002 3 20.530132533133283 28.132033008252062 32.30807701925482 19.02975743935984 4 22.925 35.575 22.625 18.875 5 23.06153076538269 38.519259629814904 21.5607803901951 16.858429214607305 6 19.75 38.25 23.025000000000002 18.975 7 18.075 20.375 40.525 21.025 8 20.65 24.575 27.450000000000003 27.325 9 21.325 25.55 28.775000000000002 24.349999999999998 10-14 23.285 28.67 26.43 21.615000000000002 15-19 22.8 28.53 27.500000000000004 21.17 20-24 22.735 29.14 27.705000000000002 20.419999999999998 25-29 22.595000000000002 28.849999999999998 27.584999999999997 20.97 30-34 22.745 28.04 28.62 20.595 35-39 22.75 28.15 28.215 20.885 40-44 22.595000000000002 28.82 27.955000000000002 20.630000000000003 45-49 22.785 27.860000000000003 28.134999999999998 21.22 50-54 22.805 27.544999999999998 28.53 21.12 55-59 22.825 28.005000000000003 28.32 20.849999999999998 60-64 22.71 27.625 28.634999999999998 21.029999999999998 65-69 23.200000000000003 27.79 27.935 21.075 70-74 23.645 27.42 27.66 21.275 75-79 22.515 27.705000000000002 27.805000000000003 21.975 80-84 23.565 28.244999999999997 27.43 20.76 85-89 23.3 28.095 27.73 20.875 90-94 23.115 27.944999999999997 28.000000000000004 20.94 95-99 23.169999999999998 28.225 27.76 20.845 100-104 23.45 28.88 27.200000000000003 20.47 105-109 23.595 27.700000000000003 28.17 20.535 110-114 23.605 27.955000000000002 28.165000000000003 20.275000000000002 115-119 23.990000000000002 28.21 27.485 20.315 120-124 24.385 27.675 27.71 20.23 125-129 24.465 28.18 26.889999999999997 20.465 130-134 24.77 28.225 27.68 19.325 135-139 24.86 28.299999999999997 27.384999999999998 19.455 140-144 25.474999999999998 27.775 27.54 19.21 145-149 25.895000000000003 27.744999999999997 26.85 19.509999999999998 150-151 26.0625 28.000000000000004 27.400000000000002 18.5375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 2.0 23 2.0 24 1.0 25 1.5 26 4.0 27 7.5 28 7.0 29 6.5 30 11.5 31 20.0 32 27.0 33 35.0 34 51.0 35 67.5 36 82.5 37 107.0 38 148.5 39 182.0 40 199.0 41 225.5 42 265.0 43 303.0 44 286.5 45 250.0 46 245.0 47 235.5 48 221.5 49 205.0 50 177.0 51 134.5 52 104.5 53 90.0 54 78.0 55 55.0 56 36.5 57 35.0 58 26.5 59 18.5 60 13.0 61 8.0 62 4.0 63 2.0 64 2.5 65 4.0 66 3.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16455696202532 97.925 2 0.6329113924050633 1.25 3 0.1518987341772152 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.025316455696202535 0.15 7 0.0 0.0 8 0.0 0.0 9 0.025316455696202535 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 9 0.22499999999999998 Illumina Single End PCR Primer 1 (97% over 34bp) AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.9625 0.0 0.0 0.0 0.0 108-109 2.2625 0.0 0.0 0.0 0.0 110-111 2.6375 0.0 0.0 0.0 0.0 112-113 3.0 0.0 0.0 0.0 0.0 114-115 3.2875 0.0 0.0 0.0 0.0 116-117 3.725 0.0 0.0 0.0 0.0 118-119 4.1625 0.0 0.0 0.0 0.0 120-121 4.574999999999999 0.0 0.0 0.0 0.0 122-123 4.9125 0.0 0.0 0.0 0.0 124-125 5.375 0.0 0.0 0.0 0.0 126-127 5.775 0.0 0.0 0.0 0.0 128-129 6.425000000000001 0.0 0.0 0.0 0.0 130-131 6.887499999999999 0.0 0.0 0.0 0.0 132-133 7.4 0.0 0.0 0.0 0.0 134-135 7.9375 0.0 0.0 0.0 0.0 136-137 8.412500000000001 0.0 0.0 0.0 0.0 138-139 8.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 743569 spots for SRR7170886.sra Written 743569 spots for SRR7170886.sra Read 743569 spots for SRR7170886.sra Written 743569 spots for SRR7170886.sra Read 743569 spots for SRR7170886.sra Written 743569 spots for SRR7170886.sra Read 743569 spots for SRR7170886.sra Written 743569 spots for SRR7170886.sra Read 743569 spots for SRR7170886.sra Written 743569 spots for SRR7170886.sra Read 743569 spots for SRR7170886.sra Written 743569 spots for SRR7170886.sra Read 743569 spots for SRR7170886.sra Written 743569 spots for SRR7170886.sra Read 743569 spots for SRR7170886.sra Written 743569 spots for SRR7170886.sra Read 743569 spots for SRR7170886.sra Written 743569 spots for SRR7170886.sra Read 743569 spots for SRR7170886.sra Written 743569 spots for SRR7170886.sra Read 743569 spots for SRR7170886.sra Written 743569 spots for SRR7170886.sra Read 743569 spots for SRR7170886.sra Written 743569 spots for SRR7170886.sra Read 743569 spots for SRR7170886.sra Written 743569 spots for SRR7170886.sra Read 743569 spots for SRR7170886.sra Written 743569 spots for SRR7170886.sra Read 743569 spots for SRR7170886.sra Written 743569 spots for SRR7170886.sra Read 743572 spots for SRR7170886.sra Written 743572 spots for SRR7170886.sra Read 743569 spots for SRR7170886.sra Written 743569 spots for SRR7170886.sra Read 743569 spots for SRR7170886.sra Written 743569 spots for SRR7170886.sra Read 743569 spots for SRR7170886.sra Written 743569 spots for SRR7170886.sra Read 743569 spots for SRR7170886.sra Written 743569 spots for SRR7170886.sra SRR ids: ['SRR7170886.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1c_wx6et SRR7170886.sra spots: 14871383 blocks: [[1, 743569], [743570, 1487138], [1487139, 2230707], [2230708, 2974276], [2974277, 3717845], [3717846, 4461414], [4461415, 5204983], [5204984, 5948552], [5948553, 6692121], [6692122, 7435690], [7435691, 8179259], [8179260, 8922828], [8922829, 9666397], [9666398, 10409966], [10409967, 11153535], [11153536, 11897104], [11897105, 12640673], [12640674, 13384242], [13384243, 14127811], [14127812, 14871383]] SRR7170886 file size 5017723 SRR7170886 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170886 SRR7170886_1.fastq SRR7170886_2.fastq Input file: SRR7170886_1.fastq Paired file: SRR7170886_2.fastq trimmed: SRR7170886-trimmed-pair1.fastq, SRR7170886-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:38:50 2025 >> started Thu Feb 13 21:39:06 2025 >> done (15.900s) 14871383 read pairs processed; of these: 17649 ( 0.12%) short read pairs filtered out after trimming by size control 25429 ( 0.17%) empty read pairs filtered out after trimming by size control 14828305 (99.71%) read pairs available; of these: 10115365 (68.22%) trimmed read pairs available after processing 4712940 (31.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 9 0.00% 21 10 0.00% 22 15 0.00% 23 10 0.00% 24 14 0.00% 25 14 0.00% 26 9 0.00% 27 11 0.00% 28 18 0.00% 29 21 0.00% 30 22 0.00% 31 21 0.00% 32 23 0.00% 33 22 0.00% 34 18 0.00% 35 33 0.00% 36 23 0.00% 37 21 0.00% 38 28 0.00% 39 25 0.00% 40 32 0.00% 41 47 0.00% 42 45 0.00% 43 50 0.00% 44 54 0.00% 45 48 0.00% 46 53 0.00% 47 62 0.00% 48 65 0.00% 49 72 0.00% 50 117 0.00% 51 95 0.00% 52 121 0.00% 53 149 0.00% 54 139 0.00% 55 178 0.00% 56 184 0.00% 57 240 0.00% 58 259 0.00% 59 275 0.00% 60 340 0.00% 61 460 0.00% 62 447 0.00% 63 493 0.00% 64 539 0.00% 65 567 0.00% 66 637 0.00% 67 752 0.01% 68 860 0.01% 69 960 0.01% 70 1152 0.01% 71 1294 0.01% 72 1558 0.01% 73 1775 0.01% 74 2028 0.01% 75 2289 0.02% 76 3254 0.02% 77 3137 0.02% 78 2811 0.02% 79 3127 0.02% 80 3530 0.02% 81 4163 0.03% 82 4705 0.03% 83 5443 0.04% 84 6512 0.04% 85 6788 0.05% 86 7493 0.05% 87 7812 0.05% 88 8213 0.06% 89 8645 0.06% 90 9513 0.06% 91 10761 0.07% 92 11518 0.08% 93 12662 0.09% 94 13920 0.09% 95 14806 0.10% 96 15391 0.10% 97 16370 0.11% 98 16589 0.11% 99 17522 0.12% 100 18717 0.13% 101 19946 0.13% 102 21796 0.15% 103 23522 0.16% 104 25214 0.17% 105 26519 0.18% 106 27614 0.19% 107 28378 0.19% 108 29137 0.20% 109 29657 0.20% 110 30967 0.21% 111 32692 0.22% 112 34374 0.23% 113 36836 0.25% 114 38973 0.26% 115 41136 0.28% 116 42548 0.29% 117 44030 0.30% 118 44818 0.30% 119 45394 0.31% 120 47410 0.32% 121 49396 0.33% 122 51271 0.35% 123 54906 0.37% 124 58217 0.39% 125 61458 0.41% 126 64276 0.43% 127 66351 0.45% 128 67787 0.46% 129 71156 0.48% 130 73392 0.49% 131 76389 0.52% 132 81116 0.55% 133 87039 0.59% 134 92319 0.62% 135 99570 0.67% 136 106551 0.72% 137 114413 0.77% 138 123145 0.83% 139 132648 0.89% 140 143908 0.97% 141 157960 1.07% 142 176647 1.19% 143 199622 1.35% 144 232127 1.57% 145 277106 1.87% 146 348310 2.35% 147 462691 3.12% 148 678455 4.58% 149 1193687 8.05% 150 3790273 25.56% 151 4712940 31.78% 14828305 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=4.22 fanout-score-rank=14 prefix-density=0.57 prefix-fanout=3.2 sequence=CCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=116.12 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=27 prefix-density=0.86 prefix-fanout=2.3 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=66.68 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.4 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR7170886 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:39:51 Started mapping on | Feb 13 21:39:51 Finished on | Feb 13 21:41:14 Mapping speed, Million of reads per hour | 643.16 Number of input reads | 14828305 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 14202234 Uniquely mapped reads % | 95.78% Average mapped length | 288.89 Number of splices: Total | 13403750 Number of splices: Annotated (sjdb) | 13067901 Number of splices: GT/AG | 13147410 Number of splices: GC/AG | 194424 Number of splices: AT/AC | 8820 Number of splices: Non-canonical | 53096 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 359031 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 21431 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.61% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 281464 281464 281464 N_multimapping 359031 359031 359031 N_noFeature 566402 13932843 668029 N_ambiguous 267719 986 99475 UnstrandedReadsAssigned:13368113 PositiveStrandReadsAssigned:268405 NegativeStrandReadsAssigned:13434730 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR7170886 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170886-trimmed-pair1.fastq SRR7170886-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,828,305 reads, 13,336,967 reads pseudoaligned [quant] estimated average fragment length: 231.416 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,013 rounds 52401 SRR7170886.ke.tsv 34699 SRR7170886.se.tsv 87100 total ==> SRR7170886.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.58 601 20.8438 Potri.005G024800.1.v4.1 1035 804.584 310 23.8869 Potri.004G059700.1.v4.1 961 730.623 18 1.52739 Potri.007G009000.2.v4.1 1416 1185.58 0 0 Potri.003G141000.2.v4.1 2943 2712.58 689 15.7473 Potri.016G087400.1.v4.1 270 88.9649 1063 740.771 Potri.015G069301.1.v4.1 564 338.422 0 0 Potri.010G195200.1.v4.1 1773 1542.58 82.5716 3.31857 Potri.012G127500.1.v4.1 977 746.604 314 26.0741 ==> SRR7170886.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1151 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 349 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 11 SRR7170886 completed mapping pipeline successfully