Starting /dee2/code/volunteer_pipeline.sh SRR7171050 current disk space = 3088512380928 free memory = 1580119448 SRR7171050 SRAfilesize 3a2b4ef0daffebb8740cab682464c34a SRR7171050.sra SRR7171050.sra file validated SRR7171050 is paired end SRR7171050 is conventional basespace SRR7171050 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171050_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.142 32.0 18.0 33.0 18.0 33.0 2 29.38 31.0 27.0 33.0 18.0 33.0 3 30.2855 31.0 29.0 33.0 27.0 33.0 4 30.244 31.0 29.0 33.0 27.0 33.0 5 31.70225 33.0 31.0 33.0 29.0 33.0 6 34.908 38.0 35.0 38.0 28.0 38.0 7 36.5055 38.0 37.0 38.0 33.0 38.0 8 37.29 38.0 38.0 38.0 36.0 38.0 9 37.53975 38.0 38.0 38.0 37.0 38.0 10-14 37.4867 38.0 38.0 38.0 37.6 38.0 15-19 37.51535 38.0 38.0 38.0 37.8 38.0 20-24 37.54545 38.0 38.0 38.0 38.0 38.0 25-29 37.5846 38.0 38.0 38.0 38.0 38.0 30-34 37.5064 38.0 38.0 38.0 38.0 38.0 35-39 37.4793 38.0 38.0 38.0 38.0 38.0 40-44 37.464549999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.489149999999995 38.0 38.0 38.0 37.8 38.0 50-54 37.37595 38.0 38.0 38.0 37.0 38.0 55-59 37.2538 38.0 38.0 38.0 37.0 38.0 60-64 37.27815 38.0 38.0 38.0 37.0 38.0 65-69 36.47005 38.0 37.6 38.0 33.8 38.0 70-74 36.357749999999996 38.0 37.0 38.0 31.4 38.0 75-79 37.1238 38.0 38.0 38.0 36.0 38.0 80-84 37.08485 38.0 38.0 38.0 36.0 38.0 85-89 36.9643 38.0 38.0 38.0 36.0 38.0 90-94 36.85685 38.0 38.0 38.0 35.4 38.0 95-99 36.83075 38.0 38.0 38.0 35.4 38.0 100-104 36.76004999999999 38.0 38.0 38.0 35.0 38.0 105-109 36.6179 38.0 38.0 38.0 34.4 38.0 110-114 36.5266 38.0 38.0 38.0 34.2 38.0 115-119 36.30095 38.0 38.0 38.0 34.0 38.0 120-124 36.17855 38.0 37.2 38.0 33.4 38.0 125-129 35.75875 38.0 36.6 38.0 31.4 38.0 130-134 35.2547 38.0 36.0 38.0 29.8 38.0 135-139 35.0774 38.0 36.0 38.0 29.8 38.0 140-144 34.408100000000005 38.0 34.6 38.0 26.6 38.0 145-149 33.7472 38.0 33.4 38.0 23.6 38.0 150-151 28.423125000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 3.0 18 1.0 19 3.0 20 1.0 21 5.0 22 3.0 23 6.0 24 7.0 25 12.0 26 9.0 27 27.0 28 9.0 29 30.0 30 27.0 31 52.0 32 71.0 33 101.0 34 177.0 35 312.0 36 856.0 37 2282.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.863133521996396 12.6575765371752 9.956264471314638 41.52302546951376 2 19.504876219054765 18.629657414353588 35.708927231807955 26.156539134783696 3 17.775 24.349999999999998 28.825 29.049999999999997 4 24.099999999999998 30.975 22.15 22.775000000000002 5 21.75 36.6 23.724999999999998 17.925 6 18.0 36.75 24.025 21.224999999999998 7 13.350000000000001 23.7 45.0 17.95 8 17.525 23.425 32.2 26.85 9 17.724999999999998 23.7 33.375 25.2 10-14 19.97 30.044999999999998 26.85 23.135 15-19 20.195 28.935 27.62 23.25 20-24 20.105 29.080000000000002 27.450000000000003 23.365 25-29 20.125 28.939999999999998 27.625 23.31 30-34 20.015 29.185 28.155 22.645 35-39 20.135 28.305000000000003 27.76 23.799999999999997 40-44 20.044999999999998 28.49 27.73 23.735 45-49 20.4 28.405 27.46 23.735 50-54 20.29 27.860000000000003 28.21 23.64 55-59 20.39 28.810000000000002 27.605 23.195 60-64 20.305 28.955 27.229999999999997 23.51 65-69 20.325 28.575 27.675 23.425 70-74 20.275000000000002 28.694999999999997 27.55 23.48 75-79 20.205000000000002 28.24 28.07 23.485 80-84 20.375 28.265 27.810000000000002 23.549999999999997 85-89 20.32 28.935 27.43 23.315 90-94 20.27 28.29 27.689999999999998 23.75 95-99 20.42204220422042 28.322832283228323 27.73777377737774 23.517351735173516 100-104 20.79 27.88 27.565 23.765 105-109 20.13 28.139999999999997 28.044999999999998 23.685000000000002 110-114 20.54 28.189999999999998 27.32 23.95 115-119 21.165 28.384999999999998 26.985 23.465 120-124 20.79 28.52 26.755000000000003 23.935000000000002 125-129 20.94 28.189999999999998 27.16 23.71 130-134 21.535 28.16 26.965 23.34 135-139 21.085 28.43 26.515 23.97 140-144 21.615000000000002 27.884999999999998 26.255 24.245 145-149 21.145 28.425 26.700000000000003 23.73 150-151 21.075672295184493 27.85490931832395 26.6166353971232 24.452782989368355 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 0.0 22 1.5 23 1.5 24 1.0 25 2.5 26 4.5 27 8.5 28 14.5 29 19.0 30 22.0 31 30.0 32 35.5 33 44.0 34 65.0 35 78.0 36 90.5 37 116.5 38 154.0 39 174.0 40 181.0 41 209.0 42 236.0 43 245.0 44 247.0 45 247.5 46 252.0 47 252.0 48 227.0 49 216.5 50 185.0 51 137.0 52 122.0 53 100.5 54 69.5 55 49.5 56 42.5 57 35.0 58 26.0 59 18.0 60 11.5 61 8.0 62 7.0 63 4.0 64 1.0 65 0.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.825 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11526794742164 98.02499999999999 2 0.7330637007077857 1.4500000000000002 3 0.10111223458038424 0.3 4 0.02527805864509606 0.1 5 0.02527805864509606 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGTTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0125 0.0 76-77 0.075 0.0 0.0 0.025 0.0 78-79 0.1375 0.0 0.0 0.025 0.0 80-81 0.225 0.0 0.0 0.025 0.0 82-83 0.25 0.0 0.0 0.025 0.0 84-85 0.3125 0.0 0.0 0.025 0.0 86-87 0.4 0.0 0.0 0.025 0.0 88-89 0.425 0.0 0.0 0.025 0.0 90-91 0.4375 0.0 0.0 0.025 0.0 92-93 0.5125 0.0 0.0 0.025 0.0 94-95 0.6125 0.0 0.0 0.025 0.0 96-97 0.7250000000000001 0.0 0.0 0.025 0.0 98-99 0.8375 0.0 0.0 0.025 0.0 100-101 0.95 0.0 0.0 0.025 0.0 102-103 1.075 0.0 0.0 0.025 0.0 104-105 1.2875 0.0 0.0 0.025 0.0 106-107 1.5 0.0 0.0 0.025 0.0 108-109 1.8375 0.0 0.0 0.025 0.0 110-111 2.1875 0.0 0.0 0.025 0.0 112-113 2.5 0.0 0.0 0.025 0.0 114-115 2.7 0.0 0.0 0.025 0.0 116-117 3.0 0.0 0.0 0.025 0.0 118-119 3.4000000000000004 0.0 0.0 0.025 0.0 120-121 3.7125 0.0 0.0 0.025 0.0 122-123 4.199999999999999 0.0 0.0 0.025 0.0 124-125 4.550000000000001 0.0 0.0 0.025 0.0 126-127 4.9625 0.0 0.0 0.025 0.0 128-129 5.525 0.0 0.0 0.025 0.0 130-131 6.1625 0.0 0.0 0.025 0.0 132-133 6.875 0.0 0.0 0.025 0.0 134-135 7.4 0.0 0.0 0.025 0.0 136-137 8.037500000000001 0.0 0.0 0.025 0.0 138-139 8.75 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCTTG 10 0.006836113 144.9625 9 >>END_MODULE SRR7171050 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171050_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.08125 33.0 33.0 34.0 30.0 34.0 2 32.6305 33.0 33.0 34.0 32.0 34.0 3 32.72925 33.0 33.0 34.0 32.0 34.0 4 32.868 34.0 33.0 34.0 32.0 34.0 5 32.92175 34.0 33.0 34.0 32.0 34.0 6 37.1275 38.0 38.0 38.0 37.0 38.0 7 37.2295 38.0 38.0 38.0 37.0 38.0 8 37.09075 38.0 38.0 38.0 37.0 38.0 9 37.1445 38.0 38.0 38.0 37.0 38.0 10-14 36.86125 38.0 38.0 38.0 35.4 38.0 15-19 36.989549999999994 38.0 38.0 38.0 36.2 38.0 20-24 35.16325 38.0 34.8 38.0 26.8 38.0 25-29 36.87 38.0 37.8 38.0 35.8 38.0 30-34 37.0918 38.0 38.0 38.0 37.0 38.0 35-39 37.10675 38.0 38.0 38.0 36.6 38.0 40-44 36.9657 38.0 38.0 38.0 36.0 38.0 45-49 36.85850000000001 38.0 38.0 38.0 36.0 38.0 50-54 36.23965 38.0 37.6 38.0 32.8 38.0 55-59 36.8377 38.0 38.0 38.0 36.0 38.0 60-64 36.81419999999999 38.0 38.0 38.0 35.8 38.0 65-69 36.7306 38.0 38.0 38.0 35.6 38.0 70-74 36.7176 38.0 38.0 38.0 35.2 38.0 75-79 36.682050000000004 38.0 38.0 38.0 35.0 38.0 80-84 35.830949999999994 38.0 36.8 38.0 29.8 38.0 85-89 36.4892 38.0 38.0 38.0 34.4 38.0 90-94 36.53735 38.0 38.0 38.0 34.6 38.0 95-99 36.44125 38.0 38.0 38.0 34.2 38.0 100-104 36.1626 38.0 38.0 38.0 34.0 38.0 105-109 35.325599999999994 38.0 36.4 38.0 27.4 38.0 110-114 35.61685 38.0 37.0 38.0 30.8 38.0 115-119 35.62955 38.0 37.0 38.0 31.0 38.0 120-124 35.42255 38.0 36.6 38.0 31.0 38.0 125-129 35.21085 38.0 36.2 38.0 30.0 38.0 130-134 34.44605 38.0 35.4 38.0 26.0 38.0 135-139 33.89075 38.0 33.4 38.0 22.6 38.0 140-144 32.9231 38.0 33.0 38.0 17.0 38.0 145-149 32.16945 38.0 33.0 38.0 10.6 38.0 150-151 26.039749999999998 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 3.0 4 1.0 5 2.0 6 0.0 7 0.0 8 1.0 9 1.0 10 2.0 11 1.0 12 2.0 13 3.0 14 5.0 15 4.0 16 3.0 17 3.0 18 7.0 19 6.0 20 4.0 21 9.0 22 8.0 23 14.0 24 14.0 25 16.0 26 23.0 27 33.0 28 35.0 29 34.0 30 65.0 31 49.0 32 96.0 33 124.0 34 168.0 35 371.0 36 793.0 37 2093.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.275 20.075000000000003 13.15 28.499999999999996 2 24.15 26.400000000000002 33.175 16.275000000000002 3 20.424999999999997 29.175 30.65 19.75 4 23.925 35.949999999999996 21.45 18.675 5 23.9 38.550000000000004 21.05 16.5 6 18.925 39.775 22.7 18.6 7 18.125 18.9 42.625 20.349999999999998 8 20.925 23.575 28.425 27.075 9 22.900000000000002 24.224999999999998 30.15 22.725 10-14 23.95 29.299999999999997 25.435000000000002 21.315 15-19 22.939999999999998 28.43 27.900000000000002 20.73 20-24 23.355 28.105000000000004 27.48 21.060000000000002 25-29 23.145 28.665000000000003 27.334999999999997 20.855 30-34 22.66 27.98 28.849999999999998 20.51 35-39 23.005 27.375 28.615000000000002 21.005 40-44 23.185 27.839999999999996 27.55 21.425 45-49 22.64 28.27 28.24 20.849999999999998 50-54 22.89 27.575 28.349999999999998 21.185000000000002 55-59 23.794999999999998 27.575 27.83 20.8 60-64 22.945 27.450000000000003 28.27 21.335 65-69 23.66 27.439999999999998 28.37 20.53 70-74 23.66 27.73 27.500000000000004 21.11 75-79 23.28 28.310000000000002 27.495000000000005 20.915 80-84 23.32 28.07 27.705000000000002 20.905 85-89 23.26 28.095 28.23 20.415 90-94 24.295 27.205000000000002 27.43 21.07 95-99 23.43 27.99 27.650000000000002 20.93 100-104 23.885 27.474999999999998 27.615000000000002 21.025 105-109 23.66 27.495000000000005 28.075 20.77 110-114 24.12 27.83 27.345000000000002 20.705000000000002 115-119 24.12 28.24 27.33 20.31 120-124 23.974999999999998 27.794999999999998 27.785 20.445 125-129 24.01 27.82 27.439999999999998 20.73 130-134 24.705 27.83 26.945000000000004 20.52 135-139 25.045 27.58 27.77 19.605 140-144 25.019999999999996 27.560000000000002 27.134999999999998 20.285 145-149 25.45 28.605000000000004 26.16 19.785 150-151 25.968992248062015 27.7569392348087 26.644161040260066 19.629907476869217 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 2.0 23 2.0 24 1.5 25 3.0 26 5.5 27 8.0 28 9.0 29 11.5 30 13.0 31 18.0 32 29.5 33 42.5 34 51.0 35 67.0 36 87.5 37 95.5 38 134.5 39 167.5 40 188.5 41 224.0 42 249.5 43 261.0 44 266.5 45 263.5 46 258.0 47 253.0 48 226.0 49 203.0 50 176.0 51 138.0 52 106.5 53 94.5 54 89.0 55 72.0 56 52.0 57 35.0 58 26.0 59 20.5 60 16.0 61 14.5 62 10.0 63 3.5 64 0.5 65 0.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42109237352128 98.75 2 0.47822803926503904 0.95 3 0.10067958721369243 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.2374999999999998 0.0 0.0 0.0 0.0 106-107 1.45 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 2.1375 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.625 0.0 0.0 0.0 0.0 116-117 2.95 0.0 0.0 0.0 0.0 118-119 3.3499999999999996 0.0 0.0 0.0 0.0 120-121 3.6625 0.0 0.0 0.0 0.0 122-123 4.1625 0.0 0.0 0.0 0.0 124-125 4.525 0.0 0.0 0.0 0.0 126-127 4.9125 0.0 0.0 0.0 0.0 128-129 5.4625 0.0 0.0 0.0 0.0 130-131 6.0 0.0 0.0 0.0 0.0 132-133 6.7 0.0 0.0 0.0 0.0 134-135 7.225 0.0 0.0 0.0 0.0 136-137 7.8875 0.0 0.0 0.0 0.0 138-139 8.600000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 930682 spots for SRR7171050.sra Written 930682 spots for SRR7171050.sra Read 930682 spots for SRR7171050.sra Written 930682 spots for SRR7171050.sra Read 930682 spots for SRR7171050.sra Written 930682 spots for SRR7171050.sra Read 930682 spots for SRR7171050.sra Written 930682 spots for SRR7171050.sra Read 930682 spots for SRR7171050.sra Written 930682 spots for SRR7171050.sra Read 930682 spots for SRR7171050.sra Written 930682 spots for SRR7171050.sra Read 930682 spots for SRR7171050.sra Written 930682 spots for SRR7171050.sra Read 930682 spots for SRR7171050.sra Written 930682 spots for SRR7171050.sra Read 930682 spots for SRR7171050.sra Written 930682 spots for SRR7171050.sra Read 930682 spots for SRR7171050.sra Written 930682 spots for SRR7171050.sra Read 930682 spots for SRR7171050.sra Written 930682 spots for SRR7171050.sra Read 930682 spots for SRR7171050.sra Written 930682 spots for SRR7171050.sra Read 930682 spots for SRR7171050.sra Written 930682 spots for SRR7171050.sra Read 930682 spots for SRR7171050.sra Written 930682 spots for SRR7171050.sra Read 930685 spots for SRR7171050.sra Written 930685 spots for SRR7171050.sra Read 930682 spots for SRR7171050.sra Written 930682 spots for SRR7171050.sra Read 930682 spots for SRR7171050.sra Written 930682 spots for SRR7171050.sra Read 930682 spots for SRR7171050.sra Written 930682 spots for SRR7171050.sra Read 930682 spots for SRR7171050.sra Written 930682 spots for SRR7171050.sra Read 930682 spots for SRR7171050.sra Written 930682 spots for SRR7171050.sra SRR ids: ['SRR7171050.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t6kgrdxs SRR7171050.sra spots: 18613643 blocks: [[1, 930682], [930683, 1861364], [1861365, 2792046], [2792047, 3722728], [3722729, 4653410], [4653411, 5584092], [5584093, 6514774], [6514775, 7445456], [7445457, 8376138], [8376139, 9306820], [9306821, 10237502], [10237503, 11168184], [11168185, 12098866], [12098867, 13029548], [13029549, 13960230], [13960231, 14890912], [14890913, 15821594], [15821595, 16752276], [16752277, 17682958], [17682959, 18613643]] SRR7171050 file size 6285852 SRR7171050 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171050 SRR7171050_1.fastq SRR7171050_2.fastq Input file: SRR7171050_1.fastq Paired file: SRR7171050_2.fastq trimmed: SRR7171050-trimmed-pair1.fastq, SRR7171050-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:55:36 2025 >> started Thu Feb 13 21:55:56 2025 >> done (20.183s) 18613643 read pairs processed; of these: 12791 ( 0.07%) short read pairs filtered out after trimming by size control 19525 ( 0.10%) empty read pairs filtered out after trimming by size control 18581327 (99.83%) read pairs available; of these: 11494098 (61.86%) trimmed read pairs available after processing 7087229 (38.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 8 0.00% 21 6 0.00% 22 7 0.00% 23 7 0.00% 24 9 0.00% 25 5 0.00% 26 8 0.00% 27 11 0.00% 28 11 0.00% 29 14 0.00% 30 16 0.00% 31 9 0.00% 32 17 0.00% 33 11 0.00% 34 14 0.00% 35 17 0.00% 36 12 0.00% 37 24 0.00% 38 26 0.00% 39 26 0.00% 40 43 0.00% 41 34 0.00% 42 38 0.00% 43 31 0.00% 44 28 0.00% 45 50 0.00% 46 58 0.00% 47 66 0.00% 48 62 0.00% 49 103 0.00% 50 108 0.00% 51 108 0.00% 52 131 0.00% 53 122 0.00% 54 126 0.00% 55 142 0.00% 56 150 0.00% 57 187 0.00% 58 222 0.00% 59 252 0.00% 60 260 0.00% 61 330 0.00% 62 396 0.00% 63 437 0.00% 64 548 0.00% 65 518 0.00% 66 605 0.00% 67 689 0.00% 68 740 0.00% 69 907 0.00% 70 961 0.01% 71 1108 0.01% 72 1351 0.01% 73 1466 0.01% 74 1684 0.01% 75 2084 0.01% 76 2811 0.02% 77 2652 0.01% 78 2610 0.01% 79 2964 0.02% 80 3275 0.02% 81 3625 0.02% 82 4235 0.02% 83 4927 0.03% 84 6178 0.03% 85 6723 0.04% 86 7291 0.04% 87 7821 0.04% 88 8483 0.05% 89 9346 0.05% 90 9765 0.05% 91 10988 0.06% 92 11707 0.06% 93 13012 0.07% 94 14051 0.08% 95 15079 0.08% 96 16035 0.09% 97 17059 0.09% 98 17665 0.10% 99 18696 0.10% 100 20220 0.11% 101 21201 0.11% 102 22447 0.12% 103 24032 0.13% 104 25766 0.14% 105 26890 0.14% 106 28457 0.15% 107 29326 0.16% 108 30530 0.16% 109 32089 0.17% 110 33212 0.18% 111 34597 0.19% 112 36294 0.20% 113 38637 0.21% 114 39905 0.21% 115 42192 0.23% 116 43792 0.24% 117 45518 0.24% 118 47126 0.25% 119 47983 0.26% 120 50258 0.27% 121 51939 0.28% 122 53886 0.29% 123 56806 0.31% 124 58993 0.32% 125 61629 0.33% 126 63882 0.34% 127 66724 0.36% 128 69596 0.37% 129 71896 0.39% 130 76205 0.41% 131 78400 0.42% 132 82672 0.44% 133 87971 0.47% 134 92504 0.50% 135 98656 0.53% 136 105311 0.57% 137 113820 0.61% 138 121335 0.65% 139 129520 0.70% 140 137884 0.74% 141 151141 0.81% 142 165791 0.89% 143 182596 0.98% 144 210198 1.13% 145 251055 1.35% 146 305572 1.64% 147 413520 2.23% 148 640756 3.45% 149 1289864 6.94% 150 5250092 28.25% 151 7087229 38.14% 18581327 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=23 prefix-density=0.49 prefix-fanout=1.9 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=41.64 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.4 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGTTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=23 prefix-density=0.73 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=71.10 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.3 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATAAACCAGTGTACGGTTGCGGAAGGGGTAATCGATATTGCGT SRR7171050 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:56:40 Started mapping on | Feb 13 21:56:40 Finished on | Feb 13 21:59:06 Mapping speed, Million of reads per hour | 458.17 Number of input reads | 18581327 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17443195 Uniquely mapped reads % | 93.87% Average mapped length | 291.37 Number of splices: Total | 16127036 Number of splices: Annotated (sjdb) | 15791459 Number of splices: GT/AG | 15817258 Number of splices: GC/AG | 254943 Number of splices: AT/AC | 9921 Number of splices: Non-canonical | 44914 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 519550 % of reads mapped to multiple loci | 2.80% Number of reads mapped to too many loci | 47011 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.98% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 632555 632555 632555 N_multimapping 519550 519550 519550 N_noFeature 656370 17119074 762495 N_ambiguous 329539 1426 110714 UnstrandedReadsAssigned:16457286 PositiveStrandReadsAssigned:322695 NegativeStrandReadsAssigned:16569986 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7171050 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171050-trimmed-pair1.fastq SRR7171050-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,581,327 reads, 16,552,166 reads pseudoaligned [quant] estimated average fragment length: 231.413 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR7171050.ke.tsv 34699 SRR7171050.se.tsv 87100 total ==> SRR7171050.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.59 488.538 13.8494 Potri.005G024800.1.v4.1 1035 804.587 300 18.8951 Potri.004G059700.1.v4.1 961 730.597 19 1.31788 Potri.007G009000.2.v4.1 1416 1185.59 0 0 Potri.003G141000.2.v4.1 2943 2712.59 562.576 10.5099 Potri.016G087400.1.v4.1 270 86.459 1025 600.778 Potri.015G069301.1.v4.1 564 337.827 0 0 Potri.010G195200.1.v4.1 1773 1542.59 8 0.262809 Potri.012G127500.1.v4.1 977 746.592 120 8.14513 ==> SRR7171050.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1032 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 349 Potri.001G212900.v4.1 154 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7171050 completed mapping pipeline successfully