Starting /dee2/code/volunteer_pipeline.sh SRR7171052 current disk space = 3088555290624 free memory = 1461522904 SRR7171052 SRAfilesize 81fbdf69be4c43a857f6bdb0b56af6a1 SRR7171052.sra SRR7171052.sra file validated SRR7171052 is paired end SRR7171052 is conventional basespace SRR7171052 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171052_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.05975 28.0 18.0 33.0 18.0 33.0 2 30.4855 31.0 29.0 33.0 27.0 33.0 3 31.3865 33.0 31.0 33.0 27.0 33.0 4 31.41875 33.0 31.0 33.0 29.0 33.0 5 32.57875 33.0 33.0 33.0 32.0 34.0 6 36.61 38.0 37.0 38.0 34.0 38.0 7 37.27675 38.0 38.0 38.0 36.0 38.0 8 37.53575 38.0 38.0 38.0 37.0 38.0 9 37.568 38.0 38.0 38.0 38.0 38.0 10-14 37.589150000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.6173 38.0 38.0 38.0 38.0 38.0 20-24 37.56245 38.0 38.0 38.0 37.6 38.0 25-29 37.501 38.0 38.0 38.0 37.6 38.0 30-34 37.533500000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.519000000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.4612 38.0 38.0 38.0 37.2 38.0 45-49 37.39545 38.0 38.0 38.0 37.0 38.0 50-54 37.21775000000001 38.0 38.0 38.0 36.6 38.0 55-59 36.523849999999996 38.0 37.4 38.0 33.6 38.0 60-64 37.20955 38.0 38.0 38.0 36.2 38.0 65-69 37.19525 38.0 38.0 38.0 36.2 38.0 70-74 37.0606 38.0 38.0 38.0 36.0 38.0 75-79 36.990300000000005 38.0 38.0 38.0 35.8 38.0 80-84 36.9836 38.0 38.0 38.0 36.0 38.0 85-89 36.638 38.0 38.0 38.0 34.6 38.0 90-94 36.5322 38.0 38.0 38.0 34.2 38.0 95-99 36.568900000000006 38.0 38.0 38.0 34.4 38.0 100-104 36.4519 38.0 38.0 38.0 34.0 38.0 105-109 36.454049999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.2274 38.0 37.4 38.0 33.8 38.0 115-119 35.71565 38.0 37.0 38.0 31.0 38.0 120-124 35.769099999999995 38.0 36.6 38.0 32.2 38.0 125-129 35.6588 38.0 36.0 38.0 31.4 38.0 130-134 32.287850000000006 35.8 28.8 38.0 22.2 38.0 135-139 34.5486 38.0 35.0 38.0 26.4 38.0 140-144 34.16925 38.0 35.0 38.0 23.4 38.0 145-149 33.3172 38.0 33.6 38.0 19.0 38.0 150-151 29.261125 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 2.0 15 0.0 16 1.0 17 3.0 18 2.0 19 1.0 20 3.0 21 4.0 22 2.0 23 5.0 24 13.0 25 13.0 26 14.0 27 9.0 28 29.0 29 35.0 30 50.0 31 48.0 32 57.0 33 116.0 34 196.0 35 345.0 36 1013.0 37 2034.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.51282051282051 13.354700854700855 9.428418803418804 31.704059829059826 2 21.206810215322985 17.1507260891337 35.45317976965448 26.189283925888834 3 17.525 25.275 29.9 27.3 4 23.525 30.4 24.25 21.825 5 21.15 35.4 24.7 18.75 6 17.5 35.4 27.3 19.8 7 15.299999999999999 23.549999999999997 43.225 17.925 8 17.175 24.15 33.025 25.650000000000002 9 17.599999999999998 22.425 33.45 26.525 10-14 19.900000000000002 29.57 26.91 23.62 15-19 20.26 28.935 27.675 23.13 20-24 20.0 28.92 27.775 23.305 25-29 19.42 29.25 27.589999999999996 23.74 30-34 19.655 29.115000000000002 27.800000000000004 23.43 35-39 19.63 28.95 27.365000000000002 24.055 40-44 19.91 28.970000000000002 27.875 23.244999999999997 45-49 20.119999999999997 28.970000000000002 27.224999999999998 23.685000000000002 50-54 19.825 28.485 27.865000000000002 23.825 55-59 19.55 29.075 27.525 23.849999999999998 60-64 19.965 28.28 27.700000000000003 24.055 65-69 19.72 28.634999999999998 28.095 23.549999999999997 70-74 20.26 28.57 27.47 23.7 75-79 20.375 28.705000000000002 27.465 23.455000000000002 80-84 20.0 28.499999999999996 28.15 23.35 85-89 20.47 28.38 27.51 23.64 90-94 20.474999999999998 28.63 27.355 23.54 95-99 20.474999999999998 28.725 27.395000000000003 23.405 100-104 20.585 28.7 27.439999999999998 23.275000000000002 105-109 20.935000000000002 28.610000000000003 26.955000000000002 23.5 110-114 21.044999999999998 28.395 27.61 22.95 115-119 20.794999999999998 28.265 27.32 23.62 120-124 20.14 28.895 27.034999999999997 23.93 125-129 21.265 27.98 26.669999999999998 24.085 130-134 21.17 28.62 26.87 23.34 135-139 21.7 28.33 26.13 23.84 140-144 21.545 27.700000000000003 27.145000000000003 23.61 145-149 20.669999999999998 28.785 26.334999999999997 24.21 150-151 21.087500000000002 29.062500000000004 25.724999999999998 24.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 2.5 16 2.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.5 23 3.0 24 3.5 25 5.5 26 7.5 27 9.0 28 14.5 29 19.0 30 26.5 31 31.5 32 34.5 33 53.0 34 70.5 35 79.0 36 85.0 37 109.5 38 157.5 39 168.0 40 178.5 41 215.5 42 245.0 43 250.5 44 240.5 45 254.5 46 247.5 47 230.5 48 223.0 49 205.0 50 176.0 51 138.5 52 114.0 53 86.5 54 71.5 55 66.0 56 48.5 57 33.0 58 25.0 59 20.5 60 14.5 61 9.5 62 6.5 63 5.0 64 2.0 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.4 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29435483870968 98.5 2 0.6048387096774194 1.2 3 0.10080645161290322 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1625 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.2625 0.0 0.0 0.0 0.0 102-103 1.55 0.0 0.0 0.0 0.0 104-105 1.85 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.2750000000000004 0.0 0.0 0.0 0.0 110-111 2.5999999999999996 0.0 0.0 0.0 0.0 112-113 2.9375 0.0 0.0 0.0 0.0 114-115 3.3625 0.0 0.0 0.0 0.0 116-117 3.8 0.0 0.0 0.0 0.0 118-119 4.2125 0.0 0.0 0.0 0.0 120-121 4.5875 0.0 0.0 0.0 0.0 122-123 4.987500000000001 0.0 0.0 0.0 0.0 124-125 5.45 0.0 0.0 0.0 0.0 126-127 6.112500000000001 0.0 0.0 0.0 0.0 128-129 6.6375 0.0 0.0 0.0 0.0 130-131 7.3 0.0 0.0 0.0 0.0 132-133 7.925 0.0 0.0 0.0 0.0 134-135 8.5375 0.0 0.0 0.0 0.0 136-137 9.2125 0.0 0.0 0.0 0.0 138-139 10.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171052 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171052_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.37575 33.0 33.0 34.0 31.0 34.0 2 32.61225 33.0 33.0 34.0 32.0 34.0 3 30.82775 33.0 32.0 34.0 18.0 34.0 4 32.001 33.0 32.0 34.0 27.0 34.0 5 32.45175 33.0 33.0 34.0 32.0 34.0 6 36.74075 38.0 38.0 38.0 35.0 38.0 7 36.58975 38.0 38.0 38.0 35.0 38.0 8 36.88875 38.0 38.0 38.0 36.0 38.0 9 36.873 38.0 38.0 38.0 36.0 38.0 10-14 36.9472 38.0 38.0 38.0 36.0 38.0 15-19 36.86755 38.0 38.0 38.0 36.0 38.0 20-24 36.4184 38.0 37.8 38.0 33.8 38.0 25-29 36.2062 38.0 37.6 38.0 32.4 38.0 30-34 36.59779999999999 38.0 38.0 38.0 34.6 38.0 35-39 36.70205 38.0 38.0 38.0 35.6 38.0 40-44 36.7875 38.0 38.0 38.0 35.8 38.0 45-49 36.70649999999999 38.0 38.0 38.0 35.4 38.0 50-54 36.72235 38.0 38.0 38.0 35.6 38.0 55-59 36.67614999999999 38.0 38.0 38.0 35.4 38.0 60-64 36.505849999999995 38.0 38.0 38.0 34.4 38.0 65-69 36.536899999999996 38.0 38.0 38.0 34.6 38.0 70-74 36.434200000000004 38.0 38.0 38.0 34.0 38.0 75-79 36.4878 38.0 38.0 38.0 34.4 38.0 80-84 36.179700000000004 38.0 37.8 38.0 32.8 38.0 85-89 36.1229 38.0 38.0 38.0 33.4 38.0 90-94 36.237350000000006 38.0 38.0 38.0 34.0 38.0 95-99 36.11345 38.0 38.0 38.0 33.2 38.0 100-104 35.775150000000004 38.0 37.2 38.0 31.8 38.0 105-109 35.4138 38.0 37.0 38.0 29.2 38.0 110-114 33.36505 36.8 30.2 38.0 23.2 38.0 115-119 34.788 37.8 35.4 38.0 27.0 38.0 120-124 34.9405 38.0 36.0 38.0 27.6 38.0 125-129 34.64155 38.0 35.0 38.0 26.2 38.0 130-134 34.280100000000004 38.0 35.0 38.0 24.2 38.0 135-139 33.861399999999996 38.0 33.0 38.0 22.8 38.0 140-144 33.09155 38.0 33.2 38.0 18.6 38.0 145-149 32.03765 38.0 33.0 38.0 10.8 38.0 150-151 27.016875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 7.0 4 2.0 5 0.0 6 1.0 7 1.0 8 2.0 9 3.0 10 3.0 11 0.0 12 2.0 13 0.0 14 0.0 15 4.0 16 8.0 17 6.0 18 8.0 19 6.0 20 6.0 21 13.0 22 17.0 23 9.0 24 20.0 25 27.0 26 27.0 27 32.0 28 45.0 29 43.0 30 68.0 31 71.0 32 105.0 33 117.0 34 181.0 35 330.0 36 798.0 37 2031.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.975 21.4 11.025 21.6 2 27.213606803401703 23.736868434217108 30.06503251625813 18.98449224612306 3 21.410705352676338 28.639319659829916 31.340670335167587 18.609304652326163 4 25.632040050062578 33.516896120150186 22.60325406758448 18.247809762202756 5 24.56184276414622 37.48122183274912 19.32899349023535 18.627941912869304 6 20.225 38.574999999999996 22.75 18.45 7 19.575 19.650000000000002 39.1 21.675 8 20.7 24.975 27.950000000000003 26.375 9 22.225 25.525 29.425 22.825 10-14 23.77 28.27 26.52 21.44 15-19 23.347334733473346 28.462846284628462 27.687768776877686 20.502050205020502 20-24 23.652095628688606 28.383515054516355 27.558267480244076 20.406121836550966 25-29 23.219287715086033 28.47639055622249 27.89115646258503 20.413165266106443 30-34 23.196159807990398 27.876393819690986 28.146407320366016 20.7810390519526 35-39 23.15578894723681 28.237059264816207 27.87696924231058 20.730182545636406 40-44 22.55563890972743 28.24206051512878 28.267066766691674 20.935233808452114 45-49 23.135 28.325 27.99 20.549999999999997 50-54 22.911145557277866 27.326366318315916 28.706435321766087 21.05605280264013 55-59 23.47 27.365000000000002 28.12 21.044999999999998 60-64 22.958443766564983 27.97919687953193 28.364254638195728 20.698104715707355 65-69 23.717371737173718 26.927692769276927 28.452845284528454 20.9020902090209 70-74 23.170792698174544 27.4368592148037 27.941985496374095 21.45036259064766 75-79 22.82570642660665 27.966991747936987 27.991997999499873 21.21530382595649 80-84 23.350837709427356 27.22180545136284 28.762190547636905 20.66516629157289 85-89 23.175 27.894999999999996 27.935 20.995 90-94 23.572357235723572 27.69276927692769 27.87778777877788 20.857085708570857 95-99 23.745 27.860000000000003 27.445000000000004 20.95 100-104 24.23121156057803 27.546377318865943 27.881394069703486 20.341017050852543 105-109 24.269561737042224 27.55153091855113 28.046828096858118 20.13207924754853 110-114 23.95979195839168 28.34066813362672 27.470494098819763 20.229045809161832 115-119 24.273641046156925 27.83417512626894 27.99419912986948 19.897984697704658 120-124 24.273641046156925 27.93919087863179 27.76916537480622 20.01800270040506 125-129 25.233785067760163 27.86918037705656 27.029054358153726 19.867980197029556 130-134 24.926246312315616 27.68638431921596 27.566378318915945 19.82099104955248 135-139 24.823723558533782 27.474121118167727 26.88903335500325 20.813121968295246 140-144 25.587676302890866 27.668300490147047 27.123136941082326 19.620886265879765 145-149 26.19892983947592 27.734160124018604 26.498974846226936 19.567935190278543 150-151 26.9625 27.712500000000002 26.424999999999997 18.9 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 0.5 20 1.5 21 1.5 22 1.0 23 1.0 24 1.0 25 2.5 26 3.0 27 5.5 28 9.5 29 11.0 30 15.5 31 20.5 32 23.0 33 35.5 34 52.0 35 69.5 36 80.0 37 96.0 38 121.5 39 153.0 40 194.0 41 229.0 42 272.5 43 282.5 44 246.0 45 259.5 46 279.0 47 255.5 48 243.0 49 204.0 50 165.0 51 135.5 52 105.0 53 104.5 54 94.0 55 66.0 56 41.0 57 26.0 58 23.5 59 20.0 60 13.0 61 11.5 62 9.0 63 3.5 64 2.5 65 2.5 66 1.0 67 1.0 68 1.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.05 4 0.125 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.03 25-29 0.04 30-34 0.005 35-39 0.025 40-44 0.025 45-49 0.0 50-54 0.005 55-59 0.0 60-64 0.015 65-69 0.01 70-74 0.025 75-79 0.025 80-84 0.025 85-89 0.0 90-94 0.01 95-99 0.0 100-104 0.005 105-109 0.06 110-114 0.02 115-119 0.015 120-124 0.015 125-129 0.015 130-134 0.005 135-139 0.015 140-144 0.03 145-149 0.015 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34193874968362 98.125 2 0.4302708175145533 0.8500000000000001 3 0.10124019235636549 0.3 4 0.05062009617818274 0.2 5 0.02531004808909137 0.125 6 0.02531004808909137 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02531004808909137 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 10 0.25 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 6 0.15 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1625 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.1125 0.0 0.0 0.0 0.0 100-101 1.3375 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.9 0.0 0.0 0.0 0.0 106-107 2.125 0.0 0.0 0.0 0.0 108-109 2.325 0.0 0.0 0.0 0.0 110-111 2.6375 0.0 0.0 0.0 0.0 112-113 2.9875 0.0 0.0 0.0 0.0 114-115 3.4124999999999996 0.0 0.0 0.0 0.0 116-117 3.85 0.0 0.0 0.0 0.0 118-119 4.2 0.0 0.0 0.0 0.0 120-121 4.6125 0.0 0.0 0.0 0.0 122-123 5.112500000000001 0.0 0.0 0.0 0.0 124-125 5.7375 0.0 0.0 0.0 0.0 126-127 6.45 0.0 0.0 0.0 0.0 128-129 7.0 0.0 0.0 0.0 0.0 130-131 7.7125 0.0 0.0 0.0 0.0 132-133 8.325 0.0 0.0 0.0 0.0 134-135 8.9125 0.0 0.0 0.0 0.0 136-137 9.55 0.0 0.0 0.0 0.0 138-139 10.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGACA 10 0.006830828 145.0 1 >>END_MODULE Read 987442 spots for SRR7171052.sra Written 987442 spots for SRR7171052.sra Read 987442 spots for SRR7171052.sra Written 987442 spots for SRR7171052.sra Read 987442 spots for SRR7171052.sra Written 987442 spots for SRR7171052.sra Read 987442 spots for SRR7171052.sra Written 987442 spots for SRR7171052.sra Read 987442 spots for SRR7171052.sra Written 987442 spots for SRR7171052.sra Read 987442 spots for SRR7171052.sra Written 987442 spots for SRR7171052.sra Read 987442 spots for SRR7171052.sra Written 987442 spots for SRR7171052.sra Read 987442 spots for SRR7171052.sra Written 987442 spots for SRR7171052.sra Read 987442 spots for SRR7171052.sra Written 987442 spots for SRR7171052.sra Read 987442 spots for SRR7171052.sra Written 987442 spots for SRR7171052.sra Read 987442 spots for SRR7171052.sra Written 987442 spots for SRR7171052.sra Read 987460 spots for SRR7171052.sra Written 987460 spots for SRR7171052.sra Read 987442 spots for SRR7171052.sra Written 987442 spots for SRR7171052.sra Read 987442 spots for SRR7171052.sra Written 987442 spots for SRR7171052.sra Read 987442 spots for SRR7171052.sra Written 987442 spots for SRR7171052.sra Read 987442 spots for SRR7171052.sra Written 987442 spots for SRR7171052.sra Read 987442 spots for SRR7171052.sra Written 987442 spots for SRR7171052.sra Read 987442 spots for SRR7171052.sra Written 987442 spots for SRR7171052.sra Read 987442 spots for SRR7171052.sra Written 987442 spots for SRR7171052.sra Read 987442 spots for SRR7171052.sra Written 987442 spots for SRR7171052.sra SRR ids: ['SRR7171052.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kadxxjra SRR7171052.sra spots: 19748858 blocks: [[1, 987442], [987443, 1974884], [1974885, 2962326], [2962327, 3949768], [3949769, 4937210], [4937211, 5924652], [5924653, 6912094], [6912095, 7899536], [7899537, 8886978], [8886979, 9874420], [9874421, 10861862], [10861863, 11849304], [11849305, 12836746], [12836747, 13824188], [13824189, 14811630], [14811631, 15799072], [15799073, 16786514], [16786515, 17773956], [17773957, 18761398], [18761399, 19748858]] SRR7171052 file size 6670539 SRR7171052 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171052 SRR7171052_1.fastq SRR7171052_2.fastq Input file: SRR7171052_1.fastq Paired file: SRR7171052_2.fastq trimmed: SRR7171052-trimmed-pair1.fastq, SRR7171052-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:56:04 2025 >> started Thu Feb 13 21:56:39 2025 >> done (34.999s) 19748858 read pairs processed; of these: 24257 ( 0.12%) short read pairs filtered out after trimming by size control 36369 ( 0.18%) empty read pairs filtered out after trimming by size control 19688232 (99.69%) read pairs available; of these: 11406034 (57.93%) trimmed read pairs available after processing 8282198 (42.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 9 0.00% 20 8 0.00% 21 9 0.00% 22 16 0.00% 23 13 0.00% 24 23 0.00% 25 27 0.00% 26 16 0.00% 27 13 0.00% 28 14 0.00% 29 17 0.00% 30 15 0.00% 31 18 0.00% 32 17 0.00% 33 18 0.00% 34 12 0.00% 35 23 0.00% 36 21 0.00% 37 25 0.00% 38 30 0.00% 39 42 0.00% 40 39 0.00% 41 53 0.00% 42 45 0.00% 43 60 0.00% 44 61 0.00% 45 69 0.00% 46 75 0.00% 47 93 0.00% 48 89 0.00% 49 105 0.00% 50 154 0.00% 51 163 0.00% 52 180 0.00% 53 198 0.00% 54 236 0.00% 55 231 0.00% 56 263 0.00% 57 260 0.00% 58 345 0.00% 59 376 0.00% 60 479 0.00% 61 510 0.00% 62 609 0.00% 63 672 0.00% 64 748 0.00% 65 806 0.00% 66 819 0.00% 67 949 0.00% 68 1005 0.01% 69 1135 0.01% 70 1421 0.01% 71 1634 0.01% 72 1881 0.01% 73 2151 0.01% 74 2397 0.01% 75 2830 0.01% 76 3614 0.02% 77 3796 0.02% 78 3510 0.02% 79 3973 0.02% 80 4375 0.02% 81 5069 0.03% 82 5785 0.03% 83 6655 0.03% 84 8479 0.04% 85 9512 0.05% 86 10397 0.05% 87 11382 0.06% 88 12063 0.06% 89 12463 0.06% 90 13352 0.07% 91 14631 0.07% 92 15607 0.08% 93 17109 0.09% 94 18274 0.09% 95 19800 0.10% 96 20746 0.11% 97 21712 0.11% 98 22564 0.11% 99 23559 0.12% 100 25980 0.13% 101 26704 0.14% 102 29274 0.15% 103 31187 0.16% 104 33069 0.17% 105 35673 0.18% 106 36319 0.18% 107 37755 0.19% 108 39100 0.20% 109 40397 0.21% 110 42129 0.21% 111 44062 0.22% 112 46724 0.24% 113 48961 0.25% 114 50802 0.26% 115 52969 0.27% 116 55479 0.28% 117 56845 0.29% 118 57876 0.29% 119 58780 0.30% 120 60780 0.31% 121 62589 0.32% 122 64772 0.33% 123 68243 0.35% 124 71323 0.36% 125 73768 0.37% 126 76552 0.39% 127 78162 0.40% 128 81429 0.41% 129 83065 0.42% 130 85185 0.43% 131 87568 0.44% 132 91801 0.47% 133 95926 0.49% 134 101232 0.51% 135 107678 0.55% 136 111528 0.57% 137 118685 0.60% 138 124948 0.63% 139 133504 0.68% 140 142492 0.72% 141 154934 0.79% 142 171106 0.87% 143 192628 0.98% 144 224464 1.14% 145 265286 1.35% 146 322606 1.64% 147 427557 2.17% 148 634471 3.22% 149 1198631 6.09% 150 4731075 24.03% 151 8282198 42.07% 19688232 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=4.63 fanout-score-rank=15 prefix-density=0.46 prefix-fanout=3.4 sequence=CCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=140.97 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=11.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=32 prefix-density=0.42 prefix-fanout=2.3 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=39.38 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.5 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7171052 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:57:23 Started mapping on | Feb 13 21:57:23 Finished on | Feb 13 22:02:04 Mapping speed, Million of reads per hour | 252.23 Number of input reads | 19688232 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 18389609 Uniquely mapped reads % | 93.40% Average mapped length | 290.11 Number of splices: Total | 17534077 Number of splices: Annotated (sjdb) | 17109491 Number of splices: GT/AG | 17211469 Number of splices: GC/AG | 246519 Number of splices: AT/AC | 12500 Number of splices: Non-canonical | 63589 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 549298 % of reads mapped to multiple loci | 2.79% Number of reads mapped to too many loci | 60510 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.40% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 775216 775216 775216 N_multimapping 549298 549298 549298 N_noFeature 675513 18049543 778345 N_ambiguous 378402 1227 140712 UnstrandedReadsAssigned:17335694 PositiveStrandReadsAssigned:338839 NegativeStrandReadsAssigned:17470552 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7171052 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171052-trimmed-pair1.fastq SRR7171052-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,688,232 reads, 17,406,846 reads pseudoaligned [quant] estimated average fragment length: 225.395 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52401 SRR7171052.ke.tsv 34699 SRR7171052.se.tsv 87100 total ==> SRR7171052.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.6 1341 34.0348 Potri.005G024800.1.v4.1 1035 810.605 653 36.6712 Potri.004G059700.1.v4.1 961 736.643 2 0.123593 Potri.007G009000.2.v4.1 1416 1191.6 0 0 Potri.003G141000.2.v4.1 2943 2718.6 750.347 12.5643 Potri.016G087400.1.v4.1 270 90.5918 1860.81 935.047 Potri.015G069301.1.v4.1 564 343.058 0 0 Potri.010G195200.1.v4.1 1773 1548.6 821.906 24.1603 Potri.012G127500.1.v4.1 977 752.627 298 18.0242 ==> SRR7171052.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 475 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 476 Potri.001G212900.v4.1 25 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 37 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 276 SRR7171052 completed mapping pipeline successfully