Starting /dee2/code/volunteer_pipeline.sh SRR7171053 current disk space = 3088979062784 free memory = 1582375336 SRR7171053 SRAfilesize d3ec8a444a31073466e32140838f1667 SRR7171053.sra SRR7171053.sra file validated SRR7171053 is paired end SRR7171053 is conventional basespace SRR7171053 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171053_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.775 25.0 18.0 33.0 18.0 33.0 2 26.203 27.0 18.0 31.0 18.0 33.0 3 29.58725 31.0 28.0 33.0 25.0 33.0 4 31.80325 33.0 31.0 33.0 29.0 33.0 5 32.7215 33.0 33.0 33.0 32.0 34.0 6 36.513 38.0 37.0 38.0 34.0 38.0 7 36.88275 38.0 37.0 38.0 35.0 38.0 8 37.24675 38.0 38.0 38.0 36.0 38.0 9 37.46825 38.0 38.0 38.0 37.0 38.0 10-14 37.43195 38.0 38.0 38.0 36.8 38.0 15-19 37.486149999999995 38.0 38.0 38.0 37.4 38.0 20-24 37.4439 38.0 38.0 38.0 37.2 38.0 25-29 37.445299999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.395500000000006 38.0 38.0 38.0 37.2 38.0 35-39 37.20655000000001 38.0 38.0 38.0 36.8 38.0 40-44 37.33245 38.0 38.0 38.0 37.0 38.0 45-49 37.257549999999995 38.0 38.0 38.0 37.0 38.0 50-54 36.65445 38.0 38.0 38.0 34.0 38.0 55-59 36.9964 38.0 38.0 38.0 36.0 38.0 60-64 36.97305 38.0 38.0 38.0 36.0 38.0 65-69 36.8768 38.0 38.0 38.0 36.0 38.0 70-74 36.7605 38.0 38.0 38.0 35.0 38.0 75-79 36.70825 38.0 38.0 38.0 35.0 38.0 80-84 36.573449999999994 38.0 38.0 38.0 34.8 38.0 85-89 36.3679 38.0 38.0 38.0 34.0 38.0 90-94 36.06305 38.0 37.4 38.0 33.4 38.0 95-99 36.1922 38.0 37.8 38.0 33.8 38.0 100-104 36.106449999999995 38.0 37.4 38.0 33.8 38.0 105-109 35.94415 38.0 37.0 38.0 33.2 38.0 110-114 35.61135 38.0 36.8 38.0 31.0 38.0 115-119 35.3158 38.0 36.2 38.0 29.6 38.0 120-124 35.23315 38.0 36.0 38.0 29.2 38.0 125-129 34.919850000000004 38.0 35.6 38.0 28.2 38.0 130-134 31.638799999999996 35.4 28.2 38.0 19.4 38.0 135-139 33.99855000000001 38.0 33.8 38.0 23.6 38.0 140-144 33.53705 38.0 33.6 38.0 21.8 38.0 145-149 32.6437 38.0 33.0 38.0 13.8 38.0 150-151 28.472375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 3.0 9 0.0 10 1.0 11 5.0 12 3.0 13 0.0 14 6.0 15 2.0 16 5.0 17 7.0 18 9.0 19 5.0 20 6.0 21 5.0 22 6.0 23 14.0 24 8.0 25 11.0 26 14.0 27 21.0 28 40.0 29 32.0 30 45.0 31 59.0 32 95.0 33 104.0 34 183.0 35 388.0 36 1246.0 37 1676.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.522968197879855 11.029782937910145 9.565875820292781 34.881373043917215 2 19.179794948737182 14.87871967991998 32.15803950987747 33.78344586146537 3 17.5 23.549999999999997 28.1 30.85 4 21.224999999999998 28.675 25.074999999999996 25.025 5 21.125 33.300000000000004 26.450000000000003 19.125 6 18.525 35.65 26.1 19.725 7 14.224999999999998 22.975 44.15 18.65 8 16.425 24.875 32.65 26.05 9 16.225 25.275 34.725 23.775 10-14 19.11 30.175 27.544999999999998 23.169999999999998 15-19 19.965 29.525000000000002 27.91 22.6 20-24 19.72 29.330000000000002 27.63 23.32 25-29 19.689999999999998 29.53 27.925 22.855 30-34 19.43 29.060000000000002 28.365000000000002 23.145 35-39 19.91 29.54 27.139999999999997 23.41 40-44 19.395 29.14 28.48 22.985 45-49 20.305 29.354999999999997 27.18 23.16 50-54 19.71 29.115000000000002 27.595 23.580000000000002 55-59 19.475 28.435 28.249999999999996 23.84 60-64 19.615 28.07 28.475 23.84 65-69 19.38 29.304999999999996 27.61 23.705000000000002 70-74 19.689999999999998 28.660000000000004 27.715 23.935000000000002 75-79 19.830000000000002 29.185 27.825 23.16 80-84 19.79 28.804999999999996 27.395000000000003 24.01 85-89 19.825 29.439999999999998 26.905 23.830000000000002 90-94 19.91 28.360000000000003 27.755000000000003 23.974999999999998 95-99 19.7 28.565 27.794999999999998 23.94 100-104 20.09 28.775000000000002 27.134999999999998 24.0 105-109 20.62 28.08 27.529999999999998 23.77 110-114 20.5 28.134999999999998 27.48 23.885 115-119 20.979999999999997 28.04 27.42 23.56 120-124 20.52 28.439999999999998 26.840000000000003 24.2 125-129 20.1 28.46 26.985 24.455 130-134 21.065 28.475 26.334999999999997 24.125 135-139 21.21 28.38 26.52 23.89 140-144 20.64 28.199999999999996 26.490000000000002 24.67 145-149 21.44 28.515 25.855 24.19 150-151 20.7 29.6375 25.637500000000003 24.025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 3.5 2 3.5 3 4.0 4 3.5 5 1.5 6 1.5 7 1.0 8 0.0 9 1.5 10 1.5 11 0.0 12 0.5 13 0.5 14 0.5 15 1.5 16 1.0 17 0.0 18 1.0 19 1.5 20 0.5 21 1.5 22 3.0 23 4.0 24 5.5 25 5.5 26 9.5 27 19.0 28 24.5 29 29.0 30 28.5 31 35.5 32 45.0 33 59.5 34 83.0 35 95.5 36 104.5 37 110.0 38 133.5 39 167.0 40 189.5 41 186.5 42 198.5 43 227.0 44 221.5 45 216.0 46 226.5 47 224.0 48 206.0 49 200.5 50 175.0 51 138.5 52 117.5 53 106.0 54 96.0 55 78.0 56 61.5 57 43.0 58 32.5 59 25.0 60 14.0 61 9.5 62 7.0 63 2.5 64 1.0 65 1.5 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.95 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.36358987471236 96.175 2 1.2528765021733572 2.45 3 0.17898235745333674 0.525 4 0.17898235745333674 0.7000000000000001 5 0.0 0.0 6 0.025568908207619537 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTAT 6 0.15 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.38749999999999996 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.7875 0.0 0.0 0.0 0.0 90-91 0.975 0.0 0.0 0.0 0.0 92-93 1.1 0.0 0.0 0.0 0.0 94-95 1.2625 0.0 0.0 0.0 0.0 96-97 1.475 0.0 0.0 0.0 0.0 98-99 1.65 0.0 0.0 0.0 0.0 100-101 2.0625 0.0 0.0 0.0 0.0 102-103 2.4 0.0 0.0 0.0 0.0 104-105 2.6500000000000004 0.0 0.0 0.0 0.0 106-107 2.8625 0.0 0.0 0.0 0.0 108-109 3.3625 0.0 0.0 0.0 0.0 110-111 3.7875 0.0 0.0 0.0 0.0 112-113 4.1875 0.0 0.0 0.0 0.0 114-115 4.75 0.0 0.0 0.0 0.0 116-117 5.3375 0.0 0.0 0.0 0.0 118-119 5.9 0.0 0.0 0.0 0.0 120-121 6.55 0.0 0.0 0.0 0.0 122-123 7.0125 0.0 0.0 0.0 0.0 124-125 7.512499999999999 0.0 0.0 0.0 0.0 126-127 8.125 0.0 0.0 0.0 0.0 128-129 8.7 0.0 0.0 0.0 0.0 130-131 9.2375 0.0 0.0 0.0 0.0 132-133 10.0 0.0 0.0 0.0 0.0 134-135 10.6875 0.0 0.0 0.0 0.0 136-137 11.25 0.0 0.0 0.0 0.0 138-139 12.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTTCA 10 0.0068343505 144.975 7 >>END_MODULE SRR7171053 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171053_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82575 33.0 33.0 34.0 32.0 34.0 2 32.37775 33.0 33.0 34.0 31.0 34.0 3 32.89275 34.0 33.0 34.0 32.0 34.0 4 32.93825 34.0 33.0 34.0 32.0 34.0 5 33.0165 34.0 33.0 34.0 32.0 34.0 6 37.1745 38.0 38.0 38.0 37.0 38.0 7 37.162 38.0 38.0 38.0 37.0 38.0 8 37.1835 38.0 38.0 38.0 37.0 38.0 9 37.16325 38.0 38.0 38.0 37.0 38.0 10-14 37.14815 38.0 38.0 38.0 37.0 38.0 15-19 37.0911 38.0 38.0 38.0 36.8 38.0 20-24 35.5995 38.0 36.6 38.0 28.6 38.0 25-29 36.4831 38.0 37.8 38.0 34.6 38.0 30-34 36.8737 38.0 38.0 38.0 36.0 38.0 35-39 37.04275 38.0 38.0 38.0 36.8 38.0 40-44 37.0448 38.0 38.0 38.0 36.8 38.0 45-49 37.0034 38.0 38.0 38.0 36.4 38.0 50-54 37.00320000000001 38.0 38.0 38.0 36.6 38.0 55-59 36.981849999999994 38.0 38.0 38.0 36.0 38.0 60-64 36.9521 38.0 38.0 38.0 36.2 38.0 65-69 36.88244999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.84179999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.4833 38.0 37.8 38.0 34.2 38.0 80-84 35.008950000000006 37.8 35.2 38.0 28.2 38.0 85-89 36.52895 38.0 38.0 38.0 35.0 38.0 90-94 36.51520000000001 38.0 38.0 38.0 35.0 38.0 95-99 36.2778 38.0 38.0 38.0 34.2 38.0 100-104 36.2953 38.0 38.0 38.0 34.0 38.0 105-109 34.85575 38.0 35.2 38.0 28.2 38.0 110-114 35.70740000000001 38.0 36.8 38.0 31.8 38.0 115-119 35.20895 38.0 36.2 38.0 29.2 38.0 120-124 35.3483 38.0 36.2 38.0 30.0 38.0 125-129 34.99090000000001 38.0 36.0 38.0 28.2 38.0 130-134 34.788349999999994 38.0 35.6 38.0 27.8 38.0 135-139 34.3408 38.0 34.4 38.0 25.8 38.0 140-144 32.0043 36.6 29.0 38.0 19.8 38.0 145-149 30.486700000000003 35.8 29.2 38.0 8.6 38.0 150-151 26.508875 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 3.0 4 1.0 5 1.0 6 0.0 7 2.0 8 0.0 9 1.0 10 2.0 11 2.0 12 2.0 13 3.0 14 0.0 15 8.0 16 7.0 17 4.0 18 7.0 19 5.0 20 8.0 21 8.0 22 8.0 23 5.0 24 7.0 25 6.0 26 12.0 27 28.0 28 38.0 29 45.0 30 63.0 31 60.0 32 95.0 33 138.0 34 196.0 35 343.0 36 1052.0 37 1830.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.425000000000004 21.125 10.875 19.575 2 28.325 24.474999999999998 29.325000000000003 17.875 3 22.375 26.150000000000002 32.375 19.1 4 25.056264066016503 35.15878969742436 22.405601400350086 17.37934483620905 5 23.611805902951478 37.793896948474234 21.5607803901951 17.03351675837919 6 22.3 37.55 22.400000000000002 17.75 7 19.900000000000002 20.549999999999997 40.2 19.35 8 20.974999999999998 24.575 27.925 26.525 9 22.15 25.15 28.425 24.275 10-14 23.39 28.92 26.16 21.529999999999998 15-19 23.715 29.005 26.87 20.41 20-24 23.965 28.675 27.195000000000004 20.165 25-29 23.845 28.57 27.485 20.1 30-34 23.189999999999998 28.349999999999998 27.744999999999997 20.715 35-39 23.34 28.09 27.889999999999997 20.68 40-44 23.865 27.625 27.27 21.240000000000002 45-49 23.98 27.665 28.12 20.235 50-54 23.525 27.815 27.884999999999998 20.775 55-59 23.630000000000003 28.105000000000004 27.779999999999998 20.485 60-64 23.945 27.32 27.555000000000003 21.18 65-69 23.95 27.145000000000003 28.360000000000003 20.544999999999998 70-74 23.65 28.155 27.555000000000003 20.64 75-79 24.285 28.01 27.22 20.485 80-84 23.84 28.389999999999997 27.36 20.41 85-89 24.57 27.689999999999998 27.63 20.11 90-94 23.915 27.66 27.88 20.544999999999998 95-99 23.87 27.71 28.355000000000004 20.064999999999998 100-104 24.265 28.16 27.67 19.905 105-109 24.465 27.615000000000002 28.000000000000004 19.919999999999998 110-114 24.855 28.215 27.595 19.335 115-119 25.069999999999997 28.125 27.134999999999998 19.67 120-124 25.369999999999997 28.095 27.065 19.470000000000002 125-129 25.705 27.68 27.38 19.235 130-134 26.095000000000002 27.894999999999996 27.275 18.735 135-139 26.745 28.08 26.669999999999998 18.505 140-144 26.674999999999997 27.68 27.08 18.565 145-149 27.089999999999996 28.299999999999997 26.265 18.345 150-151 26.9625 29.0875 25.900000000000002 18.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 1.0 22 1.5 23 2.0 24 1.5 25 3.5 26 5.5 27 6.5 28 12.0 29 17.0 30 19.0 31 25.0 32 38.0 33 47.5 34 47.5 35 63.0 36 92.5 37 100.0 38 106.5 39 138.5 40 172.5 41 195.5 42 236.5 43 250.5 44 257.0 45 275.5 46 251.5 47 237.0 48 232.5 49 211.5 50 174.0 51 129.5 52 117.0 53 116.0 54 111.5 55 87.5 56 59.5 57 46.5 58 26.5 59 20.5 60 20.0 61 17.5 62 12.5 63 4.0 64 0.5 65 0.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.72351289251978 96.675 2 0.8935409752361502 1.7500000000000002 3 0.2297676793464386 0.675 4 0.025529742149604292 0.1 5 0.051059484299208584 0.25 6 0.0 0.0 7 0.051059484299208584 0.35000000000000003 8 0.025529742149604292 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (97% over 34bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 7 0.17500000000000002 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.38749999999999996 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.7875 0.0 0.0 0.0 0.0 90-91 0.975 0.0 0.0 0.0 0.0 92-93 1.1 0.0 0.0 0.0 0.0 94-95 1.2625 0.0 0.0 0.0 0.0 96-97 1.475 0.0 0.0 0.0 0.0 98-99 1.65 0.0 0.0 0.0 0.0 100-101 2.0625 0.0 0.0 0.0 0.0 102-103 2.4 0.0 0.0 0.0 0.0 104-105 2.6125 0.0 0.0 0.0 0.0 106-107 2.775 0.0 0.0 0.0 0.0 108-109 3.3 0.0 0.0 0.0 0.0 110-111 3.7249999999999996 0.0 0.0 0.0 0.0 112-113 4.137499999999999 0.0 0.0 0.0 0.0 114-115 4.675000000000001 0.0 0.0 0.0 0.0 116-117 5.25 0.0 0.0 0.0 0.0 118-119 5.85 0.0 0.0 0.0 0.0 120-121 6.65 0.0 0.0 0.0 0.0 122-123 7.275 0.0 0.0 0.0 0.0 124-125 7.8625 0.0 0.0 0.0 0.0 126-127 8.625 0.0 0.0 0.0 0.0 128-129 9.3125 0.0 0.0 0.0 0.0 130-131 9.9375 0.0 0.0 0.0 0.0 132-133 10.6875 0.0 0.0 0.0 0.0 134-135 11.275 0.0 0.0 0.0 0.0 136-137 11.675 0.0 0.0 0.0 0.0 138-139 12.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACATTC 10 0.006830828 145.0 3 ACACATT 10 0.006830828 145.0 2 ACATTCA 10 0.006830828 145.0 4 AACTTGA 10 0.006830828 145.0 4 GAACTTG 10 0.006830828 145.0 3 TGGACTT 10 0.006830828 145.0 2 TGGACCA 10 0.006830828 145.0 4 GTGGACT 10 0.006830828 145.0 1 AACACAT 10 0.006830828 145.0 1 AATCAAT 40 0.0076550315 18.125 45-49 >>END_MODULE Read 769407 spots for SRR7171053.sra Written 769407 spots for SRR7171053.sra Read 769407 spots for SRR7171053.sra Written 769407 spots for SRR7171053.sra Read 769407 spots for SRR7171053.sra Written 769407 spots for SRR7171053.sra Read 769407 spots for SRR7171053.sra Written 769407 spots for SRR7171053.sra Read 769407 spots for SRR7171053.sra Written 769407 spots for SRR7171053.sra Read 769407 spots for SRR7171053.sra Written 769407 spots for SRR7171053.sra Read 769407 spots for SRR7171053.sra Written 769407 spots for SRR7171053.sra Read 769407 spots for SRR7171053.sra Written 769407 spots for SRR7171053.sra Read 769407 spots for SRR7171053.sra Written 769407 spots for SRR7171053.sra Read 769407 spots for SRR7171053.sra Written 769407 spots for SRR7171053.sra Read 769426 spots for SRR7171053.sra Written 769426 spots for SRR7171053.sra Read 769407 spots for SRR7171053.sra Written 769407 spots for SRR7171053.sra Read 769407 spots for SRR7171053.sra Written 769407 spots for SRR7171053.sra Read 769407 spots for SRR7171053.sra Written 769407 spots for SRR7171053.sra Read 769407 spots for SRR7171053.sra Written 769407 spots for SRR7171053.sra Read 769407 spots for SRR7171053.sra Written 769407 spots for SRR7171053.sra Read 769407 spots for SRR7171053.sra Written 769407 spots for SRR7171053.sra Read 769407 spots for SRR7171053.sra Written 769407 spots for SRR7171053.sra Read 769407 spots for SRR7171053.sra Written 769407 spots for SRR7171053.sra Read 769407 spots for SRR7171053.sra Written 769407 spots for SRR7171053.sra SRR ids: ['SRR7171053.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oy8bance SRR7171053.sra spots: 15388159 blocks: [[1, 769407], [769408, 1538814], [1538815, 2308221], [2308222, 3077628], [3077629, 3847035], [3847036, 4616442], [4616443, 5385849], [5385850, 6155256], [6155257, 6924663], [6924664, 7694070], [7694071, 8463477], [8463478, 9232884], [9232885, 10002291], [10002292, 10771698], [10771699, 11541105], [11541106, 12310512], [12310513, 13079919], [13079920, 13849326], [13849327, 14618733], [14618734, 15388159]] SRR7171053 file size 5192841 SRR7171053 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171053 SRR7171053_1.fastq SRR7171053_2.fastq Input file: SRR7171053_1.fastq Paired file: SRR7171053_2.fastq trimmed: SRR7171053-trimmed-pair1.fastq, SRR7171053-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:42:48 2025 >> started Thu Feb 13 22:43:07 2025 >> done (18.170s) 15388159 read pairs processed; of these: 23817 ( 0.15%) short read pairs filtered out after trimming by size control 60463 ( 0.39%) empty read pairs filtered out after trimming by size control 15303879 (99.45%) read pairs available; of these: 9617494 (62.84%) trimmed read pairs available after processing 5686385 (37.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 15 0.00% 20 21 0.00% 21 31 0.00% 22 38 0.00% 23 44 0.00% 24 49 0.00% 25 34 0.00% 26 49 0.00% 27 42 0.00% 28 40 0.00% 29 51 0.00% 30 56 0.00% 31 46 0.00% 32 41 0.00% 33 40 0.00% 34 43 0.00% 35 48 0.00% 36 47 0.00% 37 54 0.00% 38 56 0.00% 39 52 0.00% 40 59 0.00% 41 73 0.00% 42 69 0.00% 43 64 0.00% 44 79 0.00% 45 92 0.00% 46 111 0.00% 47 141 0.00% 48 154 0.00% 49 206 0.00% 50 203 0.00% 51 220 0.00% 52 241 0.00% 53 283 0.00% 54 269 0.00% 55 308 0.00% 56 338 0.00% 57 383 0.00% 58 426 0.00% 59 529 0.00% 60 602 0.00% 61 647 0.00% 62 763 0.00% 63 827 0.01% 64 832 0.01% 65 989 0.01% 66 999 0.01% 67 1087 0.01% 68 1294 0.01% 69 1313 0.01% 70 1693 0.01% 71 1828 0.01% 72 2109 0.01% 73 2360 0.02% 74 2599 0.02% 75 2890 0.02% 76 3467 0.02% 77 3807 0.02% 78 3837 0.03% 79 4290 0.03% 80 4699 0.03% 81 5443 0.04% 82 6232 0.04% 83 7373 0.05% 84 9343 0.06% 85 10659 0.07% 86 12208 0.08% 87 13422 0.09% 88 14723 0.10% 89 15347 0.10% 90 15514 0.10% 91 16194 0.11% 92 16428 0.11% 93 18111 0.12% 94 18941 0.12% 95 20626 0.13% 96 21077 0.14% 97 21689 0.14% 98 22417 0.15% 99 23728 0.16% 100 26289 0.17% 101 26425 0.17% 102 28439 0.19% 103 30165 0.20% 104 32736 0.21% 105 34805 0.23% 106 35840 0.23% 107 36620 0.24% 108 37766 0.25% 109 40368 0.26% 110 41933 0.27% 111 42256 0.28% 112 45277 0.30% 113 48068 0.31% 114 49294 0.32% 115 51343 0.34% 116 53021 0.35% 117 53663 0.35% 118 55531 0.36% 119 55219 0.36% 120 56865 0.37% 121 58924 0.39% 122 59774 0.39% 123 62565 0.41% 124 65171 0.43% 125 66261 0.43% 126 68563 0.45% 127 69920 0.46% 128 72274 0.47% 129 74338 0.49% 130 76039 0.50% 131 77957 0.51% 132 81480 0.53% 133 85398 0.56% 134 89534 0.59% 135 94978 0.62% 136 98672 0.64% 137 104415 0.68% 138 109384 0.71% 139 116492 0.76% 140 122757 0.80% 141 134511 0.88% 142 145978 0.95% 143 162240 1.06% 144 186233 1.22% 145 218706 1.43% 146 267375 1.75% 147 352358 2.30% 148 524937 3.43% 149 986293 6.44% 150 3764480 24.60% 151 5686385 37.16% 15303879 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=18 prefix-density=0.83 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.16 sequence-density-rank=19 fanout-score=24.39 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=9.0 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=24 prefix-density=0.67 prefix-fanout=2.0 sequence=CTACCCATGTTTGGATGCACTGAGGCATCTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=29.91 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.9 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR7171053 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:44:02 Started mapping on | Feb 13 22:44:02 Finished on | Feb 13 22:46:05 Mapping speed, Million of reads per hour | 447.92 Number of input reads | 15303879 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 13966682 Uniquely mapped reads % | 91.26% Average mapped length | 288.48 Number of splices: Total | 12642732 Number of splices: Annotated (sjdb) | 12385562 Number of splices: GT/AG | 12392883 Number of splices: GC/AG | 196208 Number of splices: AT/AC | 9071 Number of splices: Non-canonical | 44570 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 382140 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 40259 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.85% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 992379 992379 992379 N_multimapping 382140 382140 382140 N_noFeature 445674 13605279 549123 N_ambiguous 359199 730 100966 UnstrandedReadsAssigned:13161809 PositiveStrandReadsAssigned:360673 NegativeStrandReadsAssigned:13316593 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR7171053 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171053-trimmed-pair1.fastq SRR7171053-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,303,879 reads, 13,316,845 reads pseudoaligned [quant] estimated average fragment length: 210.621 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52401 SRR7171053.ke.tsv 34699 SRR7171053.se.tsv 87100 total ==> SRR7171053.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1808.38 375 9.99178 Potri.005G024800.1.v4.1 1035 825.379 236 13.7772 Potri.004G059700.1.v4.1 961 751.379 32 2.05207 Potri.007G009000.2.v4.1 1416 1206.38 0 0 Potri.003G141000.2.v4.1 2943 2733.38 655 11.5463 Potri.016G087400.1.v4.1 270 93.391 1398 721.278 Potri.015G069301.1.v4.1 564 356.483 0 0 Potri.010G195200.1.v4.1 1773 1563.38 52 1.60265 Potri.012G127500.1.v4.1 977 767.379 117 7.34644 ==> SRR7171053.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 433 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 523 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 73 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7171053 completed mapping pipeline successfully