Starting /dee2/code/volunteer_pipeline.sh SRR7171054 current disk space = 3088555696128 free memory = 1472376332 SRR7171054 SRAfilesize 46957134979bc50e20e7a7f115767736 SRR7171054.sra SRR7171054.sra file validated SRR7171054 is paired end SRR7171054 is conventional basespace SRR7171054 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171054_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.0985 27.0 18.0 33.0 18.0 33.0 2 26.4005 28.0 18.0 31.0 18.0 33.0 3 29.94725 31.0 29.0 33.0 27.0 33.0 4 31.845 33.0 31.0 33.0 29.0 33.0 5 32.61325 33.0 33.0 33.0 32.0 34.0 6 36.39825 38.0 37.0 38.0 34.0 38.0 7 36.90025 38.0 37.0 38.0 35.0 38.0 8 37.3625 38.0 38.0 38.0 36.0 38.0 9 37.5115 38.0 38.0 38.0 37.0 38.0 10-14 37.474000000000004 38.0 38.0 38.0 36.8 38.0 15-19 37.51324999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.47865 38.0 38.0 38.0 37.2 38.0 25-29 37.465599999999995 38.0 38.0 38.0 37.2 38.0 30-34 37.4798 38.0 38.0 38.0 37.2 38.0 35-39 37.519499999999994 38.0 38.0 38.0 37.4 38.0 40-44 37.4208 38.0 38.0 38.0 37.0 38.0 45-49 37.383950000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.137649999999994 38.0 38.0 38.0 36.0 38.0 55-59 36.13054999999999 38.0 36.8 38.0 30.4 38.0 60-64 37.104949999999995 38.0 38.0 38.0 36.0 38.0 65-69 37.0925 38.0 38.0 38.0 36.0 38.0 70-74 36.919349999999994 38.0 38.0 38.0 35.2 38.0 75-79 36.83565 38.0 38.0 38.0 35.0 38.0 80-84 36.743249999999996 38.0 38.0 38.0 35.0 38.0 85-89 36.51545 38.0 38.0 38.0 34.2 38.0 90-94 36.369299999999996 38.0 37.4 38.0 33.8 38.0 95-99 36.255449999999996 38.0 37.0 38.0 33.8 38.0 100-104 36.30995 38.0 37.0 38.0 34.0 38.0 105-109 36.13905 38.0 37.0 38.0 33.4 38.0 110-114 35.91244999999999 38.0 37.0 38.0 32.2 38.0 115-119 35.31395 38.0 36.0 38.0 29.0 38.0 120-124 35.2628 38.0 36.0 38.0 28.8 38.0 125-129 35.1592 38.0 35.6 38.0 28.6 38.0 130-134 31.6714 35.2 28.6 38.0 19.8 38.0 135-139 33.8125 38.0 34.0 38.0 22.6 38.0 140-144 33.436800000000005 38.0 33.8 38.0 21.4 38.0 145-149 32.5307 37.4 32.8 38.0 14.4 38.0 150-151 27.883499999999998 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 3.0 17 1.0 18 3.0 19 8.0 20 5.0 21 2.0 22 3.0 23 4.0 24 9.0 25 11.0 26 11.0 27 17.0 28 34.0 29 30.0 30 45.0 31 73.0 32 94.0 33 138.0 34 238.0 35 512.0 36 1386.0 37 1369.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.97856575813707 12.33130457793067 8.229690394284201 40.460439269648056 2 18.928392588883327 19.278918377566352 37.08062093139709 24.71206810215323 3 19.1 23.625 27.450000000000003 29.825000000000003 4 22.025 32.025 23.05 22.900000000000002 5 22.5 35.125 24.474999999999998 17.9 6 17.625 37.55 26.450000000000003 18.375 7 14.825 22.075 45.675 17.424999999999997 8 17.7 23.625 30.95 27.725 9 18.025 23.150000000000002 33.525 25.3 10-14 20.22 29.709999999999997 26.369999999999997 23.7 15-19 20.145 27.97 28.09 23.794999999999998 20-24 19.685 28.53 28.18 23.605 25-29 19.96 28.95 27.68 23.41 30-34 19.82 29.099999999999998 27.785 23.294999999999998 35-39 19.38 28.59 28.26 23.77 40-44 20.380000000000003 28.634999999999998 27.91 23.075000000000003 45-49 20.285 28.4 27.939999999999998 23.375 50-54 20.11 28.895 27.534999999999997 23.46 55-59 19.34 28.735 27.87 24.055 60-64 20.225 28.599999999999998 28.185 22.99 65-69 20.21 28.775000000000002 27.855 23.16 70-74 19.945 28.985 27.72 23.35 75-79 20.19 29.07 27.900000000000002 22.84 80-84 20.195 28.605000000000004 27.505000000000003 23.695 85-89 20.59 28.595 27.82 22.994999999999997 90-94 20.705000000000002 29.110000000000003 27.275 22.91 95-99 20.215 28.59 27.275 23.919999999999998 100-104 20.765 28.51 27.58 23.145 105-109 20.505000000000003 28.794999999999998 27.97 22.73 110-114 20.8 28.694999999999997 27.32 23.185 115-119 20.825 29.035 27.339999999999996 22.8 120-124 20.69 28.599999999999998 27.22 23.49 125-129 20.724999999999998 28.804999999999996 27.93 22.54 130-134 20.96 28.205000000000002 27.41 23.425 135-139 20.630000000000003 28.73 26.974999999999998 23.665 140-144 21.215 28.24 27.325 23.22 145-149 21.36 28.465 26.71 23.465 150-151 21.349999999999998 28.575 26.1625 23.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 0.0 21 0.5 22 1.5 23 2.0 24 5.0 25 5.0 26 4.5 27 9.0 28 12.5 29 18.0 30 17.0 31 24.0 32 42.5 33 56.0 34 74.0 35 89.0 36 87.0 37 108.5 38 149.5 39 180.0 40 192.0 41 225.0 42 258.5 43 249.0 44 252.5 45 259.0 46 250.0 47 230.5 48 206.5 49 196.5 50 175.5 51 134.5 52 104.0 53 84.5 54 70.0 55 56.5 56 42.5 57 34.5 58 27.5 59 20.0 60 15.5 61 8.5 62 6.0 63 5.5 64 2.0 65 1.0 66 1.0 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.525 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59748427672956 98.97500000000001 2 0.37735849056603776 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025157232704402514 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 27 (97% over 39bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.38749999999999996 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.2 0.0 0.0 0.0 0.0 104-105 1.4249999999999998 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 2.0 0.0 0.0 0.0 0.0 110-111 2.2249999999999996 0.0 0.0 0.0 0.0 112-113 2.4875 0.0 0.0 0.0 0.0 114-115 2.775 0.0 0.0 0.0 0.0 116-117 3.25 0.0 0.0 0.0 0.0 118-119 3.6125 0.0 0.0 0.0 0.0 120-121 3.9375 0.0 0.0 0.0 0.0 122-123 4.275 0.0 0.0 0.0 0.0 124-125 4.5875 0.0 0.0 0.0 0.0 126-127 4.9375 0.0 0.0 0.0 0.0 128-129 5.375 0.0 0.0 0.0 0.0 130-131 5.75 0.0 0.0 0.0 0.0 132-133 6.3125 0.0 0.0 0.0 0.0 134-135 7.0625 0.0 0.0 0.0 0.0 136-137 7.800000000000001 0.0 0.0 0.0 0.0 138-139 8.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171054 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171054_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.534 33.0 33.0 34.0 32.0 34.0 2 32.8425 33.0 33.0 34.0 32.0 34.0 3 30.539 33.0 31.0 34.0 18.0 34.0 4 32.11375 33.0 32.0 34.0 28.0 34.0 5 32.65 33.0 33.0 34.0 32.0 34.0 6 37.13525 38.0 38.0 38.0 37.0 38.0 7 37.10675 38.0 38.0 38.0 37.0 38.0 8 37.2805 38.0 38.0 38.0 37.0 38.0 9 37.367 38.0 38.0 38.0 37.0 38.0 10-14 37.288650000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.2666 38.0 38.0 38.0 37.0 38.0 20-24 36.90825 38.0 38.0 38.0 36.2 38.0 25-29 36.786649999999995 38.0 38.0 38.0 35.8 38.0 30-34 37.04365 38.0 38.0 38.0 36.8 38.0 35-39 37.17115 38.0 38.0 38.0 37.0 38.0 40-44 37.16044999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.138549999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.1178 38.0 38.0 38.0 36.8 38.0 55-59 37.080650000000006 38.0 38.0 38.0 36.8 38.0 60-64 36.978350000000006 38.0 38.0 38.0 36.0 38.0 65-69 36.9388 38.0 38.0 38.0 36.0 38.0 70-74 36.907500000000006 38.0 38.0 38.0 36.0 38.0 75-79 36.87975 38.0 38.0 38.0 36.0 38.0 80-84 36.61045 38.0 38.0 38.0 35.4 38.0 85-89 36.47355 38.0 38.0 38.0 34.4 38.0 90-94 36.544200000000004 38.0 38.0 38.0 35.0 38.0 95-99 36.4683 38.0 38.0 38.0 34.8 38.0 100-104 36.193400000000004 38.0 38.0 38.0 34.0 38.0 105-109 35.9077 38.0 37.6 38.0 33.2 38.0 110-114 34.1396 37.6 32.8 38.0 27.4 38.0 115-119 35.300799999999995 38.0 36.2 38.0 30.4 38.0 120-124 35.49655 38.0 36.8 38.0 31.0 38.0 125-129 35.241 38.0 36.0 38.0 29.8 38.0 130-134 34.92155 38.0 35.6 38.0 28.0 38.0 135-139 34.6038 38.0 35.2 38.0 27.8 38.0 140-144 33.987049999999996 38.0 33.6 38.0 23.8 38.0 145-149 33.003499999999995 38.0 33.0 38.0 17.2 38.0 150-151 27.650375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 2.0 5 1.0 6 0.0 7 4.0 8 1.0 9 1.0 10 3.0 11 4.0 12 0.0 13 3.0 14 3.0 15 6.0 16 1.0 17 6.0 18 6.0 19 7.0 20 8.0 21 6.0 22 4.0 23 11.0 24 5.0 25 5.0 26 18.0 27 22.0 28 29.0 29 35.0 30 49.0 31 56.0 32 64.0 33 102.0 34 150.0 35 292.0 36 768.0 37 2321.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.3 18.55 11.899999999999999 26.25 2 25.293970477858394 26.294721040780583 31.448586439829874 16.962722041531148 3 19.46459844883663 28.071053289967473 31.698774080560423 20.765574180635475 4 23.404255319148938 35.018773466833544 22.503128911138923 19.0738423028786 5 23.985978968452677 36.52979469203806 22.58387581372058 16.90035052578868 6 19.275000000000002 38.25 23.75 18.725 7 18.15 18.9 41.949999999999996 21.0 8 20.525 23.974999999999998 28.599999999999998 26.900000000000002 9 21.875 24.975 29.099999999999998 24.05 10-14 23.395 28.76 26.275 21.57 15-19 22.23222322232223 28.272827282728276 28.137813781378142 21.357135713571356 20-24 22.58516332349557 28.082637186734033 28.117652943824723 21.214546545945677 25-29 22.96648324162081 28.209104552276138 28.139069534767387 20.68534267133567 30-34 22.64113205660283 28.25141257062853 28.23641182059103 20.87104355217761 35-39 23.249649929985996 28.450690138027607 27.615523104620927 20.684136827365474 40-44 23.008052818486473 27.719701895663484 28.424948732056222 20.84729655379383 45-49 22.43 28.7 28.189999999999998 20.68 50-54 22.637263726372638 28.342834283428342 28.202820282028203 20.817081708170818 55-59 22.93 28.410000000000004 27.694999999999997 20.965 60-64 22.578386758013703 28.444266639996002 27.999199879981994 20.9781467220083 65-69 23.233485022753413 27.699154873230984 28.69930489573436 20.36805520828124 70-74 23.240810202550637 28.182045511377847 28.02700675168792 20.550137534383595 75-79 22.551765529658898 28.348504551365412 28.3184955486646 20.781234370311093 80-84 23.224289715886353 28.51640656262505 27.410964385754298 20.848339335734295 85-89 23.565 28.194999999999997 27.54 20.7 90-94 23.275818954738682 27.47686921730433 28.18704676169042 21.060265066266567 95-99 23.381169058452922 28.006400320016 28.271413570678533 20.341017050852543 100-104 23.746187309365467 28.286414320716034 27.336366818340917 20.63103155157758 105-109 23.67920752451471 28.352011206724036 27.746647988793278 20.22213327996798 110-114 23.948592288843326 27.999199879981994 28.144221633244985 19.907986197929688 115-119 23.523528529279393 28.149222383357504 28.04420663099465 20.283042456368456 120-124 24.10102525631408 28.11202800700175 27.901975493873472 19.884971242810703 125-129 24.087226167850357 28.26347904371311 27.773331999599883 19.875962788836652 130-134 24.636231811590577 28.22641132056603 27.481374068703435 19.655982799139956 135-139 25.14380033011554 27.949782423848347 27.07447606662332 19.831941179412794 140-144 25.23630907726932 28.11702925731433 27.486871717929485 19.15978994748687 145-149 25.258788818322746 28.359253888083213 26.819022853428017 19.562934440166025 150-151 26.924999999999997 27.4125 26.6625 19.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 2.0 24 4.0 25 4.0 26 5.0 27 7.0 28 10.5 29 17.5 30 25.5 31 34.0 32 40.5 33 41.0 34 46.5 35 68.0 36 81.0 37 100.0 38 134.5 39 170.0 40 211.0 41 224.5 42 238.0 43 256.0 44 253.5 45 270.0 46 288.0 47 263.5 48 235.0 49 203.5 50 157.0 51 128.0 52 101.0 53 75.5 54 65.5 55 60.5 56 49.0 57 38.0 58 25.5 59 17.5 60 13.5 61 9.5 62 9.5 63 5.5 64 2.0 65 1.0 66 0.5 67 0.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.075 4 0.125 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.045 25-29 0.05 30-34 0.005 35-39 0.02 40-44 0.034999999999999996 45-49 0.0 50-54 0.01 55-59 0.0 60-64 0.015 65-69 0.015 70-74 0.025 75-79 0.03 80-84 0.04 85-89 0.0 90-94 0.025 95-99 0.005 100-104 0.005 105-109 0.06 110-114 0.015 115-119 0.015 120-124 0.025 125-129 0.03 130-134 0.005 135-139 0.034999999999999996 140-144 0.025 145-149 0.015 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64788732394366 99.05000000000001 2 0.30181086519114686 0.6 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025150905432595575 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 11 0.27499999999999997 Illumina Single End PCR Primer 1 (97% over 34bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.38749999999999996 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.175 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.825 0.0 0.0 0.0 0.0 110-111 2.05 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.6 0.0 0.0 0.0 0.0 116-117 3.075 0.0 0.0 0.0 0.0 118-119 3.4375 0.0 0.0 0.0 0.0 120-121 3.8125 0.0 0.0 0.0 0.0 122-123 4.1625 0.0 0.0 0.0 0.0 124-125 4.6 0.0 0.0 0.0 0.0 126-127 4.949999999999999 0.0 0.0 0.0 0.0 128-129 5.45 0.0 0.0 0.0 0.0 130-131 5.9 0.0 0.0 0.0 0.0 132-133 6.4375 0.0 0.0 0.0 0.0 134-135 7.237500000000001 0.0 0.0 0.0 0.0 136-137 7.975 0.0 0.0 0.0 0.0 138-139 8.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAACAT 10 0.006830828 145.0 1 TCTCCTA 10 0.006830828 145.0 7 ATATCAC 10 0.006830828 145.0 2 >>END_MODULE Read 863356 spots for SRR7171054.sra Written 863356 spots for SRR7171054.sra Read 863356 spots for SRR7171054.sra Written 863356 spots for SRR7171054.sra Read 863356 spots for SRR7171054.sra Written 863356 spots for SRR7171054.sra Read 863356 spots for SRR7171054.sra Written 863356 spots for SRR7171054.sra Read 863356 spots for SRR7171054.sra Written 863356 spots for SRR7171054.sra Read 863356 spots for SRR7171054.sra Written 863356 spots for SRR7171054.sra Read 863356 spots for SRR7171054.sra Written 863356 spots for SRR7171054.sra Read 863356 spots for SRR7171054.sra Written 863356 spots for SRR7171054.sra Read 863356 spots for SRR7171054.sra Written 863356 spots for SRR7171054.sra Read 863356 spots for SRR7171054.sra Written 863356 spots for SRR7171054.sra Read 863356 spots for SRR7171054.sra Written 863356 spots for SRR7171054.sra Read 863356 spots for SRR7171054.sra Written 863356 spots for SRR7171054.sra Read 863356 spots for SRR7171054.sra Written 863356 spots for SRR7171054.sra Read 863356 spots for SRR7171054.sra Written 863356 spots for SRR7171054.sra Read 863356 spots for SRR7171054.sra Written 863356 spots for SRR7171054.sra Read 863356 spots for SRR7171054.sra Written 863356 spots for SRR7171054.sra Read 863356 spots for SRR7171054.sra Written 863356 spots for SRR7171054.sra Read 863356 spots for SRR7171054.sra Written 863356 spots for SRR7171054.sra Read 863356 spots for SRR7171054.sra Written 863356 spots for SRR7171054.sra Read 863369 spots for SRR7171054.sra Written 863369 spots for SRR7171054.sra SRR ids: ['SRR7171054.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iw7bblgn SRR7171054.sra spots: 17267133 blocks: [[1, 863356], [863357, 1726712], [1726713, 2590068], [2590069, 3453424], [3453425, 4316780], [4316781, 5180136], [5180137, 6043492], [6043493, 6906848], [6906849, 7770204], [7770205, 8633560], [8633561, 9496916], [9496917, 10360272], [10360273, 11223628], [11223629, 12086984], [12086985, 12950340], [12950341, 13813696], [13813697, 14677052], [14677053, 15540408], [15540409, 16403764], [16403765, 17267133]] SRR7171054 file size 5829564 SRR7171054 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171054 SRR7171054_1.fastq SRR7171054_2.fastq Input file: SRR7171054_1.fastq Paired file: SRR7171054_2.fastq trimmed: SRR7171054-trimmed-pair1.fastq, SRR7171054-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:56:04 2025 >> started Thu Feb 13 21:56:24 2025 >> done (20.491s) 17267133 read pairs processed; of these: 12322 ( 0.07%) short read pairs filtered out after trimming by size control 94341 ( 0.55%) empty read pairs filtered out after trimming by size control 17160470 (99.38%) read pairs available; of these: 10171034 (59.27%) trimmed read pairs available after processing 6989436 (40.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 9 0.00% 20 15 0.00% 21 5 0.00% 22 7 0.00% 23 6 0.00% 24 7 0.00% 25 8 0.00% 26 10 0.00% 27 11 0.00% 28 9 0.00% 29 13 0.00% 30 13 0.00% 31 14 0.00% 32 9 0.00% 33 15 0.00% 34 8 0.00% 35 15 0.00% 36 20 0.00% 37 20 0.00% 38 19 0.00% 39 20 0.00% 40 27 0.00% 41 34 0.00% 42 32 0.00% 43 45 0.00% 44 54 0.00% 45 45 0.00% 46 63 0.00% 47 71 0.00% 48 79 0.00% 49 99 0.00% 50 115 0.00% 51 108 0.00% 52 134 0.00% 53 140 0.00% 54 131 0.00% 55 166 0.00% 56 147 0.00% 57 206 0.00% 58 222 0.00% 59 286 0.00% 60 302 0.00% 61 401 0.00% 62 459 0.00% 63 438 0.00% 64 501 0.00% 65 558 0.00% 66 677 0.00% 67 692 0.00% 68 713 0.00% 69 828 0.00% 70 1005 0.01% 71 1161 0.01% 72 1260 0.01% 73 1641 0.01% 74 1806 0.01% 75 1951 0.01% 76 2250 0.01% 77 2424 0.01% 78 2547 0.01% 79 2919 0.02% 80 3276 0.02% 81 3601 0.02% 82 4269 0.02% 83 4781 0.03% 84 6034 0.04% 85 6693 0.04% 86 7111 0.04% 87 7558 0.04% 88 8230 0.05% 89 8614 0.05% 90 9486 0.06% 91 10319 0.06% 92 11214 0.07% 93 12148 0.07% 94 13269 0.08% 95 14472 0.08% 96 15102 0.09% 97 15862 0.09% 98 16579 0.10% 99 17775 0.10% 100 18597 0.11% 101 19430 0.11% 102 21067 0.12% 103 22399 0.13% 104 24133 0.14% 105 25428 0.15% 106 26619 0.16% 107 27591 0.16% 108 28730 0.17% 109 29900 0.17% 110 30733 0.18% 111 32210 0.19% 112 34019 0.20% 113 34892 0.20% 114 36869 0.21% 115 38585 0.22% 116 40197 0.23% 117 41740 0.24% 118 42860 0.25% 119 43921 0.26% 120 45517 0.27% 121 46441 0.27% 122 47872 0.28% 123 50364 0.29% 124 52759 0.31% 125 55278 0.32% 126 56849 0.33% 127 58656 0.34% 128 60145 0.35% 129 61928 0.36% 130 64403 0.38% 131 66392 0.39% 132 69755 0.41% 133 73687 0.43% 134 77373 0.45% 135 81206 0.47% 136 85753 0.50% 137 91965 0.54% 138 97112 0.57% 139 105095 0.61% 140 114078 0.66% 141 126235 0.74% 142 141725 0.83% 143 161403 0.94% 144 193413 1.13% 145 233574 1.36% 146 293007 1.71% 147 405316 2.36% 148 624483 3.64% 149 1214343 7.08% 150 4471600 26.06% 151 6989436 40.73% 17160470 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=4.53 fanout-score-rank=8 prefix-density=0.48 prefix-fanout=3.4 sequence=CCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=377.79 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=17.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=4.36 fanout-score-rank=11 prefix-density=0.67 prefix-fanout=2.0 sequence=ATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=38.50 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.1 sequence=CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR7171054 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:57:09 Started mapping on | Feb 13 21:57:09 Finished on | Feb 13 21:59:03 Mapping speed, Million of reads per hour | 541.91 Number of input reads | 17160470 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16194283 Uniquely mapped reads % | 94.37% Average mapped length | 291.51 Number of splices: Total | 15125712 Number of splices: Annotated (sjdb) | 14763867 Number of splices: GT/AG | 14832604 Number of splices: GC/AG | 230918 Number of splices: AT/AC | 10209 Number of splices: Non-canonical | 51981 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 421701 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 97621 % of reads mapped to too many loci | 0.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.48% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 556860 556860 556860 N_multimapping 421701 421701 421701 N_noFeature 753433 15962569 842052 N_ambiguous 244005 1205 100164 UnstrandedReadsAssigned:15196845 PositiveStrandReadsAssigned:230509 NegativeStrandReadsAssigned:15252067 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7171054 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171054-trimmed-pair1.fastq SRR7171054-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,160,470 reads, 15,263,921 reads pseudoaligned [quant] estimated average fragment length: 222.022 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 SRR7171054.ke.tsv 34699 SRR7171054.se.tsv 87100 total ==> SRR7171054.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.98 577 20.4479 Potri.005G024800.1.v4.1 1035 813.978 200 15.6471 Potri.004G059700.1.v4.1 961 739.989 4 0.344231 Potri.007G009000.2.v4.1 1416 1194.98 0 0 Potri.003G141000.2.v4.1 2943 2721.98 890 20.8219 Potri.016G087400.1.v4.1 270 86.0415 989 731.989 Potri.015G069301.1.v4.1 564 345.284 0 0 Potri.010G195200.1.v4.1 1773 1551.98 34 1.39511 Potri.012G127500.1.v4.1 977 755.978 195 16.4263 ==> SRR7171054.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1583 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 355 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 8 SRR7171054 completed mapping pipeline successfully