Starting /dee2/code/volunteer_pipeline.sh SRR7171055 current disk space = 3088662880256 free memory = 1579369800 SRR7171055 SRAfilesize 0b5d58b008ce043ddd8a6a394fd6cf7b SRR7171055.sra SRR7171055.sra file validated SRR7171055 is paired end SRR7171055 is conventional basespace SRR7171055 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171055_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.58925 32.0 27.0 33.0 18.0 33.0 2 31.233 33.0 31.0 33.0 27.0 34.0 3 31.527 33.0 31.0 33.0 28.0 33.0 4 31.204 33.0 31.0 33.0 29.0 33.0 5 32.3265 33.0 33.0 33.0 31.0 34.0 6 36.613 38.0 37.0 38.0 34.0 38.0 7 36.864 38.0 37.0 38.0 35.0 38.0 8 37.43975 38.0 38.0 38.0 37.0 38.0 9 35.954 38.0 38.0 38.0 31.0 38.0 10-14 37.35195 38.0 38.0 38.0 36.2 38.0 15-19 37.50630000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.565250000000006 38.0 38.0 38.0 37.8 38.0 25-29 37.55825 38.0 38.0 38.0 38.0 38.0 30-34 37.51965 38.0 38.0 38.0 37.8 38.0 35-39 37.4565 38.0 38.0 38.0 37.6 38.0 40-44 37.4346 38.0 38.0 38.0 37.0 38.0 45-49 37.30165 38.0 38.0 38.0 36.8 38.0 50-54 35.964099999999995 38.0 35.6 38.0 30.6 38.0 55-59 37.173100000000005 38.0 38.0 38.0 36.2 38.0 60-64 37.1535 38.0 38.0 38.0 36.0 38.0 65-69 37.167649999999995 38.0 38.0 38.0 36.0 38.0 70-74 37.16265 38.0 38.0 38.0 36.0 38.0 75-79 37.0456 38.0 38.0 38.0 36.0 38.0 80-84 36.41515 38.0 37.8 38.0 33.4 38.0 85-89 36.7168 38.0 38.0 38.0 34.8 38.0 90-94 36.643100000000004 38.0 38.0 38.0 34.2 38.0 95-99 36.6424 38.0 38.0 38.0 34.8 38.0 100-104 36.60145 38.0 38.0 38.0 34.0 38.0 105-109 36.572950000000006 38.0 38.0 38.0 34.2 38.0 110-114 36.0772 38.0 37.0 38.0 33.2 38.0 115-119 35.9145 38.0 37.0 38.0 32.2 38.0 120-124 35.839099999999995 38.0 36.6 38.0 32.0 38.0 125-129 35.480450000000005 38.0 36.0 38.0 31.0 38.0 130-134 33.8975 38.0 33.2 38.0 23.4 38.0 135-139 34.627900000000004 38.0 34.2 38.0 27.8 38.0 140-144 34.263999999999996 38.0 33.6 38.0 26.4 38.0 145-149 33.14215 38.0 33.0 38.0 19.6 38.0 150-151 27.696624999999997 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 2.0 16 0.0 17 2.0 18 3.0 19 4.0 20 1.0 21 4.0 22 6.0 23 8.0 24 11.0 25 10.0 26 14.0 27 12.0 28 27.0 29 21.0 30 35.0 31 66.0 32 71.0 33 121.0 34 175.0 35 353.0 36 1052.0 37 1997.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.23690383111806 12.32733906697941 9.512640083398487 34.923117018504044 2 19.675 17.5 35.65 27.175 3 17.8 23.7 30.2 28.299999999999997 4 22.2 29.549999999999997 24.5 23.75 5 20.860430215107552 36.14307153576789 24.212106053026513 18.78439219609805 6 16.825000000000003 36.175000000000004 26.55 20.45 7 14.45 22.900000000000002 44.25 18.4 8 16.950000000000003 23.799999999999997 31.574999999999996 27.675 9 16.6 24.925 32.4 26.075 10-14 19.36 29.630000000000003 27.27 23.74 15-19 19.61 28.505000000000003 27.925 23.96 20-24 19.91 28.95 28.115000000000002 23.025000000000002 25-29 19.435 29.270000000000003 27.694999999999997 23.599999999999998 30-34 19.655 29.01 27.74 23.595 35-39 19.825 28.910000000000004 27.91 23.355 40-44 20.046002300115006 28.72143607180359 27.551377568878443 23.68118405920296 45-49 20.325 28.810000000000002 27.505000000000003 23.36 50-54 20.01 28.735 27.705000000000002 23.549999999999997 55-59 19.7 28.785 27.785 23.73 60-64 20.215 28.439999999999998 27.689999999999998 23.655 65-69 20.630000000000003 27.944999999999997 28.01 23.415 70-74 19.905 28.815 27.555000000000003 23.724999999999998 75-79 20.395 29.145 26.87 23.59 80-84 20.135 28.660000000000004 26.919999999999998 24.285 85-89 20.18 28.84 26.619999999999997 24.36 90-94 20.04 27.805000000000003 28.285 23.87 95-99 20.330000000000002 28.28 27.48 23.91 100-104 20.145 28.744999999999997 27.325 23.785 105-109 20.044999999999998 28.375 27.91 23.669999999999998 110-114 20.419999999999998 28.535 27.450000000000003 23.595 115-119 20.84 28.560000000000002 27.01 23.59 120-124 20.985 28.38 27.24 23.395 125-129 20.76 28.215 27.105 23.919999999999998 130-134 20.845 29.054999999999996 26.26 23.84 135-139 20.36 28.075 27.305 24.26 140-144 20.849999999999998 28.970000000000002 26.39 23.79 145-149 20.66 28.375 26.279999999999998 24.685000000000002 150-151 21.07174158006761 27.757606109928634 27.194190559659447 23.97646175034431 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 2.0 22 2.0 23 1.5 24 3.5 25 4.5 26 7.0 27 11.0 28 12.5 29 17.5 30 26.5 31 38.0 32 42.0 33 49.0 34 66.0 35 79.5 36 105.5 37 130.0 38 145.0 39 160.0 40 174.5 41 186.0 42 211.5 43 254.5 44 263.0 45 246.5 46 239.0 47 235.0 48 220.0 49 196.5 50 173.5 51 142.0 52 112.0 53 95.0 54 90.5 55 72.0 56 50.0 57 44.0 58 28.5 59 18.5 60 13.5 61 9.0 62 7.0 63 4.0 64 2.5 65 1.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.075 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85699771399543 97.3 2 0.8890017780035561 1.7500000000000002 3 0.12700025400050802 0.375 4 0.10160020320040639 0.4 5 0.0 0.0 6 0.0 0.0 7 0.025400050800101596 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.7625 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.3375000000000004 0.0 0.0 0.0 0.0 112-113 2.7625 0.0 0.0 0.0 0.0 114-115 3.1500000000000004 0.0 0.0 0.0 0.0 116-117 3.4625 0.0 0.0 0.0 0.0 118-119 3.8 0.0 0.0 0.0 0.0 120-121 4.050000000000001 0.0 0.0 0.0 0.0 122-123 4.475 0.0 0.0 0.0 0.0 124-125 4.9375 0.0 0.0 0.0 0.0 126-127 5.25 0.0 0.0 0.0 0.0 128-129 5.75 0.0 0.0 0.0 0.0 130-131 6.175000000000001 0.0 0.0 0.0 0.0 132-133 6.85 0.0 0.0 0.0 0.0 134-135 7.5875 0.0 0.0 0.0 0.0 136-137 8.1375 0.0 0.0 0.0 0.0 138-139 8.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 55 0.0025175211 15.816817 55-59 >>END_MODULE SRR7171055 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171055_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.34725 33.0 32.0 34.0 31.0 34.0 2 30.31975 33.0 30.0 34.0 18.0 34.0 3 32.0065 33.0 32.0 34.0 27.0 34.0 4 32.52 33.0 33.0 34.0 32.0 34.0 5 32.779 33.0 33.0 34.0 32.0 34.0 6 36.975 38.0 38.0 38.0 37.0 38.0 7 37.1225 38.0 38.0 38.0 37.0 38.0 8 37.145 38.0 38.0 38.0 37.0 38.0 9 37.09425 38.0 38.0 38.0 37.0 38.0 10-14 37.0252 38.0 38.0 38.0 37.0 38.0 15-19 37.0635 38.0 38.0 38.0 37.0 38.0 20-24 36.0199 38.0 37.6 38.0 31.6 38.0 25-29 36.766600000000004 38.0 38.0 38.0 35.4 38.0 30-34 37.00685 38.0 38.0 38.0 37.0 38.0 35-39 36.9974 38.0 38.0 38.0 37.0 38.0 40-44 36.9499 38.0 38.0 38.0 36.8 38.0 45-49 36.3836 38.0 37.8 38.0 34.0 38.0 50-54 36.801 38.0 38.0 38.0 36.0 38.0 55-59 36.689800000000005 38.0 38.0 38.0 36.0 38.0 60-64 35.7247 38.0 37.0 38.0 30.0 38.0 65-69 36.62329999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.522149999999996 38.0 38.0 38.0 35.6 38.0 75-79 36.49665 38.0 38.0 38.0 35.2 38.0 80-84 34.85245 38.0 34.6 38.0 28.8 38.0 85-89 36.20235 38.0 37.8 38.0 34.2 38.0 90-94 36.3406 38.0 38.0 38.0 34.8 38.0 95-99 36.222 38.0 38.0 38.0 34.4 38.0 100-104 36.0224 38.0 38.0 38.0 33.6 38.0 105-109 35.1888 38.0 36.8 38.0 28.4 38.0 110-114 34.2419 38.0 34.4 38.0 24.2 38.0 115-119 35.345299999999995 38.0 37.0 38.0 31.0 38.0 120-124 35.19575 38.0 36.6 38.0 30.2 38.0 125-129 34.9776 38.0 36.0 38.0 29.0 38.0 130-134 34.6379 38.0 36.0 38.0 27.4 38.0 135-139 34.0323 38.0 34.4 38.0 24.2 38.0 140-144 33.2742 38.0 33.0 38.0 19.2 38.0 145-149 32.1375 38.0 33.0 38.0 10.4 38.0 150-151 25.90425 33.0 17.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 5.0 4 7.0 5 4.0 6 5.0 7 4.0 8 5.0 9 4.0 10 1.0 11 3.0 12 2.0 13 3.0 14 4.0 15 2.0 16 6.0 17 6.0 18 4.0 19 5.0 20 2.0 21 9.0 22 6.0 23 17.0 24 15.0 25 13.0 26 14.0 27 23.0 28 25.0 29 34.0 30 38.0 31 55.0 32 72.0 33 116.0 34 183.0 35 331.0 36 968.0 37 1993.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.725 22.3 12.025 22.95 2 26.724999999999998 24.15 32.375 16.75 3 22.54190642982237 25.869402051538653 32.17413059794846 19.41456092069052 4 23.549999999999997 35.425000000000004 22.225 18.8 5 23.325000000000003 37.425000000000004 21.825 17.424999999999997 6 20.0 38.675 23.05 18.275 7 19.900000000000002 20.25 38.4 21.45 8 19.950000000000003 25.324999999999996 28.075 26.650000000000002 9 22.400000000000002 25.05 29.25 23.3 10-14 23.555 28.325 26.479999999999997 21.64 15-19 23.415 28.494999999999997 27.705000000000002 20.385 20-24 23.18 27.88 28.23 20.71 25-29 23.075000000000003 28.15 28.515 20.26 30-34 23.085 28.144999999999996 28.199999999999996 20.57 35-39 23.305 27.88 28.15 20.665 40-44 22.755 28.310000000000002 28.560000000000002 20.375 45-49 22.535 28.4 28.165000000000003 20.9 50-54 23.04 28.605000000000004 27.700000000000003 20.655 55-59 23.175 27.815 27.975 21.035 60-64 23.330000000000002 27.644999999999996 27.985 21.04 65-69 23.815 27.839999999999996 27.27 21.075 70-74 23.02 27.744999999999997 28.199999999999996 21.035 75-79 23.625 27.310000000000002 27.944999999999997 21.12 80-84 24.03 27.229999999999997 27.87 20.87 85-89 24.175 27.400000000000002 28.000000000000004 20.424999999999997 90-94 24.5 27.46 27.76 20.28 95-99 23.57 28.26 27.29 20.880000000000003 100-104 23.57 27.845 27.855 20.73 105-109 24.13 27.715 28.07 20.085 110-114 23.7 28.694999999999997 27.27 20.335 115-119 24.565 28.494999999999997 26.924999999999997 20.015 120-124 24.485 28.255000000000003 27.525 19.735 125-129 24.42 27.500000000000004 27.55 20.53 130-134 25.590000000000003 28.360000000000003 26.700000000000003 19.35 135-139 25.27 27.67 26.93 20.13 140-144 25.515 27.589999999999996 27.61 19.285 145-149 26.11 27.79 26.634999999999998 19.465 150-151 26.50557155377488 27.51971954425942 26.693376737197948 19.281332164767747 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 0.0 21 0.5 22 1.0 23 1.5 24 3.5 25 4.5 26 4.5 27 8.5 28 10.5 29 13.0 30 17.0 31 21.0 32 31.0 33 42.0 34 48.0 35 62.0 36 87.0 37 113.5 38 131.5 39 156.0 40 190.5 41 219.5 42 254.5 43 261.5 44 263.5 45 275.0 46 255.0 47 229.0 48 212.5 49 189.5 50 174.0 51 157.0 52 120.0 53 89.5 54 86.0 55 77.0 56 52.5 57 36.5 58 20.5 59 19.5 60 20.0 61 12.5 62 10.0 63 5.5 64 2.5 65 2.0 66 1.5 67 0.5 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11122397155917 97.575 2 0.7364144235652615 1.4500000000000002 3 0.050787201625190445 0.15 4 0.025393600812595223 0.1 5 0.025393600812595223 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.050787201625190445 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 13 0.325 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 11 0.27499999999999997 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 0.9875 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.8375 0.0 0.0 0.0 0.0 110-111 2.175 0.0 0.0 0.0 0.0 112-113 2.575 0.0 0.0 0.0 0.0 114-115 2.9625 0.0 0.0 0.0 0.0 116-117 3.2625 0.0 0.0 0.0 0.0 118-119 3.5999999999999996 0.0 0.0 0.0 0.0 120-121 3.8875 0.0 0.0 0.0 0.0 122-123 4.3625 0.0 0.0 0.0 0.0 124-125 4.85 0.0 0.0 0.0 0.0 126-127 5.1625 0.0 0.0 0.0 0.0 128-129 5.6625 0.0 0.0 0.0 0.0 130-131 6.1 0.0 0.0 0.0 0.0 132-133 6.775 0.0 0.0 0.0 0.0 134-135 7.5125 0.0 0.0 0.0 0.0 136-137 8.0625 0.0 0.0 0.0 0.0 138-139 8.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTAAG 10 0.006830828 145.0 7 CCTGGAA 10 0.006830828 145.0 1 >>END_MODULE Read 820881 spots for SRR7171055.sra Written 820881 spots for SRR7171055.sra Read 820881 spots for SRR7171055.sra Written 820881 spots for SRR7171055.sra Read 820881 spots for SRR7171055.sra Written 820881 spots for SRR7171055.sra Read 820881 spots for SRR7171055.sra Written 820881 spots for SRR7171055.sra Read 820881 spots for SRR7171055.sra Written 820881 spots for SRR7171055.sra Read 820881 spots for SRR7171055.sra Written 820881 spots for SRR7171055.sra Read 820881 spots for SRR7171055.sra Written 820881 spots for SRR7171055.sra Read 820881 spots for SRR7171055.sra Written 820881 spots for SRR7171055.sra Read 820881 spots for SRR7171055.sra Written 820881 spots for SRR7171055.sra Read 820881 spots for SRR7171055.sra Written 820881 spots for SRR7171055.sra Read 820881 spots for SRR7171055.sra Written 820881 spots for SRR7171055.sra Read 820881 spots for SRR7171055.sra Written 820881 spots for SRR7171055.sra Read 820881 spots for SRR7171055.sra Written 820881 spots for SRR7171055.sra Read 820881 spots for SRR7171055.sra Written 820881 spots for SRR7171055.sra Read 820896 spots for SRR7171055.sra Written 820896 spots for SRR7171055.sra Read 820881 spots for SRR7171055.sra Written 820881 spots for SRR7171055.sra Read 820881 spots for SRR7171055.sra Written 820881 spots for SRR7171055.sra Read 820881 spots for SRR7171055.sra Written 820881 spots for SRR7171055.sra Read 820881 spots for SRR7171055.sra Written 820881 spots for SRR7171055.sra Read 820881 spots for SRR7171055.sra Written 820881 spots for SRR7171055.sra SRR ids: ['SRR7171055.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1ko1ybtp SRR7171055.sra spots: 16417635 blocks: [[1, 820881], [820882, 1641762], [1641763, 2462643], [2462644, 3283524], [3283525, 4104405], [4104406, 4925286], [4925287, 5746167], [5746168, 6567048], [6567049, 7387929], [7387930, 8208810], [8208811, 9029691], [9029692, 9850572], [9850573, 10671453], [10671454, 11492334], [11492335, 12313215], [12313216, 13134096], [13134097, 13954977], [13954978, 14775858], [14775859, 15596739], [15596740, 16417635]] SRR7171055 file size 5541697 SRR7171055 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171055 SRR7171055_1.fastq SRR7171055_2.fastq Input file: SRR7171055_1.fastq Paired file: SRR7171055_2.fastq trimmed: SRR7171055-trimmed-pair1.fastq, SRR7171055-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:24:15 2025 >> started Thu Feb 13 22:24:34 2025 >> done (18.848s) 16417635 read pairs processed; of these: 20921 ( 0.13%) short read pairs filtered out after trimming by size control 35151 ( 0.21%) empty read pairs filtered out after trimming by size control 16361563 (99.66%) read pairs available; of these: 9750908 (59.60%) trimmed read pairs available after processing 6610655 (40.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 6 0.00% 21 7 0.00% 22 5 0.00% 23 8 0.00% 24 8 0.00% 25 11 0.00% 26 9 0.00% 27 16 0.00% 28 9 0.00% 29 14 0.00% 30 21 0.00% 31 9 0.00% 32 16 0.00% 33 11 0.00% 34 6 0.00% 35 24 0.00% 36 19 0.00% 37 25 0.00% 38 23 0.00% 39 30 0.00% 40 38 0.00% 41 32 0.00% 42 45 0.00% 43 62 0.00% 44 54 0.00% 45 48 0.00% 46 72 0.00% 47 72 0.00% 48 80 0.00% 49 99 0.00% 50 106 0.00% 51 137 0.00% 52 118 0.00% 53 148 0.00% 54 175 0.00% 55 169 0.00% 56 202 0.00% 57 205 0.00% 58 272 0.00% 59 306 0.00% 60 363 0.00% 61 411 0.00% 62 436 0.00% 63 455 0.00% 64 544 0.00% 65 589 0.00% 66 633 0.00% 67 749 0.00% 68 818 0.00% 69 1024 0.01% 70 1183 0.01% 71 1250 0.01% 72 1493 0.01% 73 1704 0.01% 74 1993 0.01% 75 2414 0.01% 76 3360 0.02% 77 3646 0.02% 78 3129 0.02% 79 3231 0.02% 80 3607 0.02% 81 4117 0.03% 82 4862 0.03% 83 5435 0.03% 84 7085 0.04% 85 7992 0.05% 86 8557 0.05% 87 9084 0.06% 88 9944 0.06% 89 10353 0.06% 90 11282 0.07% 91 12334 0.08% 92 12954 0.08% 93 14599 0.09% 94 15508 0.09% 95 16639 0.10% 96 17370 0.11% 97 18065 0.11% 98 18698 0.11% 99 19520 0.12% 100 21278 0.13% 101 21522 0.13% 102 23643 0.14% 103 24991 0.15% 104 26489 0.16% 105 28356 0.17% 106 29279 0.18% 107 30015 0.18% 108 31184 0.19% 109 32687 0.20% 110 33529 0.20% 111 34565 0.21% 112 36083 0.22% 113 38567 0.24% 114 39934 0.24% 115 41865 0.26% 116 43184 0.26% 117 44101 0.27% 118 45050 0.28% 119 45744 0.28% 120 47239 0.29% 121 49002 0.30% 122 50392 0.31% 123 52752 0.32% 124 54612 0.33% 125 57008 0.35% 126 59293 0.36% 127 60884 0.37% 128 62137 0.38% 129 64494 0.39% 130 66329 0.41% 131 68314 0.42% 132 71393 0.44% 133 75001 0.46% 134 79601 0.49% 135 85385 0.52% 136 90560 0.55% 137 96745 0.59% 138 101752 0.62% 139 108788 0.66% 140 116078 0.71% 141 126222 0.77% 142 138713 0.85% 143 153854 0.94% 144 177385 1.08% 145 205764 1.26% 146 255801 1.56% 147 336929 2.06% 148 502643 3.07% 149 980734 5.99% 150 4422877 27.03% 151 6610655 40.40% 16361563 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=15 prefix-density=0.75 prefix-fanout=2.0 sequence=TGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTGTA criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=5.00 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=1.9 sequence=TGGAGAACTTTGCTTATTTTTCTCACATAAATAGTTCT criterion=sequence-density sequence-density=2.45 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=25 prefix-density=2.41 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=33.58 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.5 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR7171055 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:25:19 Started mapping on | Feb 13 22:25:19 Finished on | Feb 13 22:27:09 Mapping speed, Million of reads per hour | 535.47 Number of input reads | 16361563 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 15282714 Uniquely mapped reads % | 93.41% Average mapped length | 290.64 Number of splices: Total | 15197692 Number of splices: Annotated (sjdb) | 14878683 Number of splices: GT/AG | 14925256 Number of splices: GC/AG | 213120 Number of splices: AT/AC | 10045 Number of splices: Non-canonical | 49271 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 444210 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 49540 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.46% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 658413 658413 658413 N_multimapping 444210 444210 444210 N_noFeature 544566 14892870 649860 N_ambiguous 394634 980 109717 UnstrandedReadsAssigned:14343514 PositiveStrandReadsAssigned:388864 NegativeStrandReadsAssigned:14523137 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7171055 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171055-trimmed-pair1.fastq SRR7171055-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,361,563 reads, 14,347,299 reads pseudoaligned [quant] estimated average fragment length: 229.771 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52401 SRR7171055.ke.tsv 34699 SRR7171055.se.tsv 87100 total ==> SRR7171055.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.23 1346 32.2172 Potri.005G024800.1.v4.1 1035 806.229 826 43.8763 Potri.004G059700.1.v4.1 961 732.253 6 0.350912 Potri.007G009000.2.v4.1 1416 1187.23 0 0 Potri.003G141000.2.v4.1 2943 2714.23 662.804 10.458 Potri.016G087400.1.v4.1 270 88.5358 1337.07 646.762 Potri.015G069301.1.v4.1 564 339.748 0 0 Potri.010G195200.1.v4.1 1773 1544.23 440 12.2025 Potri.012G127500.1.v4.1 977 748.234 145 8.29925 ==> SRR7171055.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 179 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 318 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 47 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 38 SRR7171055 completed mapping pipeline successfully