Starting /dee2/code/volunteer_pipeline.sh SRR7171056 current disk space = 3088535191552 free memory = 1449936800 SRR7171056 SRAfilesize 6b42d975dd3997c40b18834e45c4648a SRR7171056.sra SRR7171056.sra file validated SRR7171056 is paired end SRR7171056 is conventional basespace SRR7171056 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171056_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.172 18.0 18.0 18.0 18.0 32.0 2 27.3095 27.0 27.0 29.0 25.0 31.0 3 29.1125 29.0 27.0 31.0 25.0 33.0 4 31.6795 33.0 31.0 33.0 29.0 33.0 5 32.48625 33.0 33.0 33.0 32.0 33.0 6 36.402 38.0 36.0 38.0 34.0 38.0 7 37.023 38.0 37.0 38.0 35.0 38.0 8 37.27975 38.0 38.0 38.0 36.0 38.0 9 37.50275 38.0 38.0 38.0 37.0 38.0 10-14 37.45525 38.0 38.0 38.0 37.0 38.0 15-19 37.489050000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.5056 38.0 38.0 38.0 37.4 38.0 25-29 37.4461 38.0 38.0 38.0 37.0 38.0 30-34 37.47964999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.4749 38.0 38.0 38.0 37.0 38.0 40-44 37.42545 38.0 38.0 38.0 37.0 38.0 45-49 37.3858 38.0 38.0 38.0 37.0 38.0 50-54 36.994749999999996 38.0 38.0 38.0 35.4 38.0 55-59 35.966049999999996 38.0 36.4 38.0 29.8 38.0 60-64 36.989850000000004 38.0 38.0 38.0 35.6 38.0 65-69 37.0043 38.0 38.0 38.0 35.8 38.0 70-74 36.83630000000001 38.0 38.0 38.0 35.0 38.0 75-79 36.773 38.0 38.0 38.0 34.8 38.0 80-84 36.69605 38.0 38.0 38.0 34.4 38.0 85-89 36.3997 38.0 37.2 38.0 33.8 38.0 90-94 36.33555 38.0 37.0 38.0 33.8 38.0 95-99 36.205 38.0 37.0 38.0 33.6 38.0 100-104 36.19154999999999 38.0 37.0 38.0 33.2 38.0 105-109 36.155550000000005 38.0 37.0 38.0 33.0 38.0 110-114 35.857 38.0 36.8 38.0 31.6 38.0 115-119 35.16375000000001 38.0 35.8 38.0 28.4 38.0 120-124 35.271 38.0 35.8 38.0 29.4 38.0 125-129 35.198249999999994 38.0 35.2 38.0 29.4 38.0 130-134 31.78705 35.6 28.4 38.0 20.0 38.0 135-139 33.837450000000004 38.0 34.0 38.0 22.6 38.0 140-144 33.2905 38.0 33.6 38.0 18.6 38.0 145-149 32.4876 37.6 32.6 38.0 14.4 38.0 150-151 27.749625 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 3.0 17 0.0 18 2.0 19 4.0 20 2.0 21 6.0 22 5.0 23 8.0 24 8.0 25 13.0 26 10.0 27 26.0 28 37.0 29 32.0 30 36.0 31 64.0 32 96.0 33 146.0 34 268.0 35 591.0 36 1381.0 37 1259.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.88830208608397 38.104040137311856 7.393715341959335 25.613942434644837 2 20.705176294073517 17.05426356589147 35.58389597399349 26.65666416604151 3 17.7 25.4 28.549999999999997 28.349999999999998 4 22.625 31.825 23.775 21.775 5 21.275 36.449999999999996 23.575 18.7 6 17.125 36.9 25.324999999999996 20.65 7 14.499999999999998 22.6 44.375 18.525 8 15.9 22.775000000000002 32.625 28.7 9 18.025 23.200000000000003 34.5 24.275 10-14 20.035 29.82 26.625 23.52 15-19 20.200000000000003 28.884999999999998 28.044999999999998 22.869999999999997 20-24 19.994999999999997 28.76 27.82 23.425 25-29 20.555 28.854999999999997 27.675 22.915 30-34 19.869999999999997 29.235 27.644999999999996 23.25 35-39 20.615 29.49 27.0 22.895 40-44 20.560000000000002 29.285 27.644999999999996 22.509999999999998 45-49 20.235 29.235 27.384999999999998 23.145 50-54 20.695 28.494999999999997 27.46 23.35 55-59 20.1 28.389999999999997 27.655 23.855 60-64 20.41 28.810000000000002 27.095000000000002 23.685000000000002 65-69 20.330000000000002 28.715000000000003 27.485 23.47 70-74 20.105 29.195 27.51 23.189999999999998 75-79 20.575 29.025000000000002 27.325 23.075000000000003 80-84 20.59 29.115000000000002 27.544999999999998 22.75 85-89 21.025 29.085 26.735 23.155 90-94 20.645 28.38 27.485 23.49 95-99 20.91 28.035 27.97 23.085 100-104 20.93 28.744999999999997 27.025 23.3 105-109 20.885 28.605000000000004 27.794999999999998 22.715 110-114 21.654999999999998 28.754999999999995 26.575 23.015 115-119 21.08 29.134999999999998 26.705000000000002 23.080000000000002 120-124 20.905 28.575 27.04 23.48 125-129 20.77 28.57 27.125 23.535 130-134 21.185000000000002 28.965000000000003 26.685 23.165 135-139 21.240000000000002 28.575 26.8 23.385 140-144 21.355 27.715 27.38 23.549999999999997 145-149 21.305 28.605000000000004 26.405 23.685000000000002 150-151 19.85 29.1375 26.887499999999996 24.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 3.5 25 4.0 26 6.5 27 10.0 28 14.0 29 21.0 30 20.5 31 33.5 32 50.5 33 62.0 34 82.0 35 94.0 36 107.5 37 125.5 38 142.5 39 165.0 40 192.0 41 221.0 42 232.5 43 245.5 44 252.0 45 240.0 46 236.0 47 231.0 48 209.0 49 182.5 50 165.0 51 131.5 52 109.5 53 100.0 54 76.0 55 56.0 56 44.5 57 35.5 58 28.0 59 21.0 60 15.0 61 9.5 62 5.5 63 3.0 64 3.5 65 2.5 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.325 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19253091092607 98.275 2 0.7317688619732526 1.4500000000000002 3 0.05046681806712087 0.15 4 0.0 0.0 5 0.025233409033560434 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.7749999999999999 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.2625000000000002 0.0 0.0 0.0 0.0 100-101 1.4875 0.0 0.0 0.0 0.0 102-103 1.6375000000000002 0.0 0.0 0.0 0.0 104-105 1.9249999999999998 0.0 0.0 0.0 0.0 106-107 2.2375 0.0 0.0 0.0 0.0 108-109 2.525 0.0 0.0 0.0 0.0 110-111 2.8375 0.0 0.0 0.0 0.0 112-113 3.225 0.0 0.0 0.0 0.0 114-115 3.4625 0.0 0.0 0.0 0.0 116-117 3.725 0.0 0.0 0.0 0.0 118-119 4.175000000000001 0.0 0.0 0.0 0.0 120-121 4.5125 0.0 0.0 0.0 0.0 122-123 4.887499999999999 0.0 0.0 0.0 0.0 124-125 5.175000000000001 0.0 0.0 0.0 0.0 126-127 5.637499999999999 0.0 0.0 0.0 0.0 128-129 5.987500000000001 0.0 0.0 0.0 0.0 130-131 6.4625 0.0 0.0 0.0 0.0 132-133 6.925 0.0 0.0 0.0 0.0 134-135 7.5875 0.0 0.0 0.0 0.0 136-137 8.0625 0.0 0.0 0.0 0.0 138-139 8.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGGATC 10 0.006841402 144.925 2 >>END_MODULE SRR7171056 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171056_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5105 33.0 33.0 34.0 32.0 34.0 2 32.79525 33.0 33.0 34.0 32.0 34.0 3 30.44025 33.0 31.0 34.0 18.0 34.0 4 32.0855 33.0 32.0 34.0 28.0 34.0 5 32.6535 33.0 33.0 34.0 32.0 34.0 6 37.115 38.0 38.0 38.0 36.0 38.0 7 37.095 38.0 38.0 38.0 37.0 38.0 8 37.23225 38.0 38.0 38.0 37.0 38.0 9 37.27325 38.0 38.0 38.0 37.0 38.0 10-14 37.2869 38.0 38.0 38.0 37.2 38.0 15-19 37.2679 38.0 38.0 38.0 37.0 38.0 20-24 36.935050000000004 38.0 38.0 38.0 36.2 38.0 25-29 36.82115 38.0 38.0 38.0 35.8 38.0 30-34 37.0403 38.0 38.0 38.0 36.6 38.0 35-39 37.1052 38.0 38.0 38.0 37.0 38.0 40-44 37.13365 38.0 38.0 38.0 37.0 38.0 45-49 37.15015 38.0 38.0 38.0 37.0 38.0 50-54 37.149300000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.06859999999999 38.0 38.0 38.0 36.6 38.0 60-64 36.98375 38.0 38.0 38.0 36.2 38.0 65-69 36.952 38.0 38.0 38.0 36.4 38.0 70-74 36.9504 38.0 38.0 38.0 36.0 38.0 75-79 36.9288 38.0 38.0 38.0 36.0 38.0 80-84 36.68005 38.0 38.0 38.0 35.2 38.0 85-89 36.619 38.0 38.0 38.0 35.0 38.0 90-94 36.724599999999995 38.0 38.0 38.0 35.6 38.0 95-99 36.6303 38.0 38.0 38.0 35.2 38.0 100-104 36.395 38.0 38.0 38.0 34.4 38.0 105-109 36.03705 38.0 37.8 38.0 33.4 38.0 110-114 34.2813 37.6 33.4 38.0 27.4 38.0 115-119 35.44065 38.0 36.2 38.0 30.6 38.0 120-124 35.58715 38.0 36.8 38.0 31.4 38.0 125-129 35.2577 38.0 36.0 38.0 30.0 38.0 130-134 35.05315 38.0 35.8 38.0 28.6 38.0 135-139 34.695499999999996 38.0 35.4 38.0 28.0 38.0 140-144 34.20595 38.0 33.4 38.0 26.6 38.0 145-149 33.2396 38.0 33.0 38.0 21.0 38.0 150-151 27.9625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 5.0 4 2.0 5 0.0 6 2.0 7 1.0 8 0.0 9 2.0 10 1.0 11 0.0 12 1.0 13 3.0 14 1.0 15 6.0 16 2.0 17 1.0 18 8.0 19 5.0 20 4.0 21 5.0 22 5.0 23 9.0 24 7.0 25 8.0 26 15.0 27 24.0 28 25.0 29 24.0 30 39.0 31 37.0 32 75.0 33 105.0 34 149.0 35 321.0 36 791.0 37 2308.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.099999999999994 20.225 10.575 22.1 2 25.831457864466117 24.381095273818453 31.257814453613403 18.529632408102024 3 22.080520130032507 26.206551637909474 32.00800200050013 19.70492623155789 4 25.18129532383096 34.358589647411854 22.05551387846962 18.404601150287572 5 24.90622655663916 37.83445861465366 19.954988747186796 17.30432608152038 6 19.625 38.074999999999996 23.075000000000003 19.225 7 18.575 19.400000000000002 40.35 21.675 8 19.775000000000002 25.275 27.825 27.125 9 21.95 24.45 29.049999999999997 24.55 10-14 23.59 28.560000000000002 26.435 21.415 15-19 23.35116755837792 28.40642032101605 27.266363318165908 20.976048802440122 20-24 22.9634445166775 27.619142871430714 28.659298894834222 20.758113717057558 25-29 23.159631926385277 27.700540108021602 27.875575115023004 21.264252850570113 30-34 22.625 28.675 27.99 20.71 35-39 22.727272727272727 28.367836783678367 27.847784778477845 21.057105710571054 40-44 22.662266226622663 28.132813281328133 28.04280428042804 21.16211621162116 45-49 22.825 27.965 28.515 20.695 50-54 22.64 28.449999999999996 27.755000000000003 21.154999999999998 55-59 23.415 27.689999999999998 28.134999999999998 20.76 60-64 23.325000000000003 28.315 27.665 20.695 65-69 23.081154057702886 27.551377568878443 28.24641232061603 21.12105605280264 70-74 22.777277727772777 28.14281428142814 28.002800280028 21.077107710771077 75-79 22.967296729672967 28.422842284228423 27.437743774377438 21.172117211721172 80-84 22.772277227722775 27.49274927492749 28.44784478447845 21.287128712871286 85-89 22.95 27.55 28.025 21.475 90-94 23.576178808940448 27.901395069753487 28.0114005700285 20.511025551277566 95-99 22.79 27.875 28.025 21.310000000000002 100-104 23.45 27.68 28.055000000000003 20.815 105-109 23.527352735273528 27.317731773177318 28.48284828482848 20.672067206720673 110-114 23.705000000000002 27.74 28.03 20.525 115-119 23.77618880944047 28.07140357017851 27.66638331916596 20.48602430121506 120-124 24.14620731036552 27.706385319265962 27.35136756837842 20.796039801990098 125-129 24.891244562228113 27.931396569828493 27.336366818340917 19.84099204960248 130-134 24.165 28.01 27.47 20.355 135-139 24.73623681184059 27.85639281964098 27.546377318865943 19.860993049652485 140-144 24.627462746274627 27.567756775677566 27.45274527452745 20.35203520352035 145-149 25.36 27.18 27.07 20.39 150-151 25.2625 28.225 26.4625 20.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 0.5 24 1.5 25 2.5 26 4.0 27 6.0 28 10.0 29 13.0 30 18.0 31 23.5 32 31.0 33 38.0 34 47.0 35 69.5 36 94.5 37 119.0 38 141.5 39 162.0 40 193.5 41 216.5 42 238.5 43 259.5 44 273.5 45 264.5 46 246.0 47 236.0 48 224.5 49 206.5 50 168.5 51 135.5 52 107.5 53 90.0 54 91.5 55 78.0 56 55.5 57 41.0 58 24.0 59 19.0 60 16.5 61 11.0 62 7.0 63 4.5 64 1.5 65 0.0 66 1.5 67 1.5 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.015 25-29 0.02 30-34 0.0 35-39 0.01 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.01 75-79 0.01 80-84 0.01 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.005 120-124 0.005 125-129 0.005 130-134 0.0 135-139 0.005 140-144 0.01 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19191919191918 98.2 2 0.6313131313131313 1.25 3 0.15151515151515152 0.44999999999999996 4 0.025252525252525252 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.65 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.2875 0.0 0.0 0.0 0.0 100-101 1.5125 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 1.9 0.0 0.0 0.0 0.0 106-107 2.0999999999999996 0.0 0.0 0.0 0.0 108-109 2.35 0.0 0.0 0.0 0.0 110-111 2.6625 0.0 0.0 0.0 0.0 112-113 3.05 0.0 0.0 0.0 0.0 114-115 3.2875 0.0 0.0 0.0 0.0 116-117 3.55 0.0 0.0 0.0 0.0 118-119 4.0125 0.0 0.0 0.0 0.0 120-121 4.4125 0.0 0.0 0.0 0.0 122-123 4.8625 0.0 0.0 0.0 0.0 124-125 5.35 0.0 0.0 0.0 0.0 126-127 6.0 0.0 0.0 0.0 0.0 128-129 6.4875 0.0 0.0 0.0 0.0 130-131 7.050000000000001 0.0 0.0 0.0 0.0 132-133 7.525 0.0 0.0 0.0 0.0 134-135 8.1875 0.0 0.0 0.0 0.0 136-137 8.675 0.0 0.0 0.0 0.0 138-139 9.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 30 0.0014437955 24.166668 140-144 >>END_MODULE Read 857944 spots for SRR7171056.sra Written 857944 spots for SRR7171056.sra Read 857944 spots for SRR7171056.sra Written 857944 spots for SRR7171056.sra Read 857944 spots for SRR7171056.sra Written 857944 spots for SRR7171056.sra Read 857944 spots for SRR7171056.sra Written 857944 spots for SRR7171056.sra Read 857944 spots for SRR7171056.sra Written 857944 spots for SRR7171056.sra Read 857944 spots for SRR7171056.sra Written 857944 spots for SRR7171056.sra Read 857944 spots for SRR7171056.sra Written 857944 spots for SRR7171056.sra Read 857944 spots for SRR7171056.sra Written 857944 spots for SRR7171056.sra Read 857944 spots for SRR7171056.sra Written 857944 spots for SRR7171056.sra Read 857944 spots for SRR7171056.sra Written 857944 spots for SRR7171056.sra Read 857944 spots for SRR7171056.sra Written 857944 spots for SRR7171056.sra Read 857944 spots for SRR7171056.sra Written 857944 spots for SRR7171056.sra Read 857944 spots for SRR7171056.sra Written 857944 spots for SRR7171056.sra Read 857944 spots for SRR7171056.sra Written 857944 spots for SRR7171056.sra Read 857944 spots for SRR7171056.sra Written 857944 spots for SRR7171056.sra Read 857944 spots for SRR7171056.sra Written 857944 spots for SRR7171056.sra Read 857944 spots for SRR7171056.sra Written 857944 spots for SRR7171056.sra Read 857944 spots for SRR7171056.sra Written 857944 spots for SRR7171056.sra Read 857962 spots for SRR7171056.sra Written 857962 spots for SRR7171056.sra Read 857944 spots for SRR7171056.sra Written 857944 spots for SRR7171056.sra SRR ids: ['SRR7171056.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o1dgcy3h SRR7171056.sra spots: 17158898 blocks: [[1, 857944], [857945, 1715888], [1715889, 2573832], [2573833, 3431776], [3431777, 4289720], [4289721, 5147664], [5147665, 6005608], [6005609, 6863552], [6863553, 7721496], [7721497, 8579440], [8579441, 9437384], [9437385, 10295328], [10295329, 11153272], [11153273, 12011216], [12011217, 12869160], [12869161, 13727104], [13727105, 14585048], [14585049, 15442992], [15442993, 16300936], [16300937, 17158898]] SRR7171056 file size 5792887 SRR7171056 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171056 SRR7171056_1.fastq SRR7171056_2.fastq Input file: SRR7171056_1.fastq Paired file: SRR7171056_2.fastq trimmed: SRR7171056-trimmed-pair1.fastq, SRR7171056-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:04:29 2025 >> started Thu Feb 13 22:04:48 2025 >> done (18.209s) 17158898 read pairs processed; of these: 15497 ( 0.09%) short read pairs filtered out after trimming by size control 17429 ( 0.10%) empty read pairs filtered out after trimming by size control 17125972 (99.81%) read pairs available; of these: 10211732 (59.63%) trimmed read pairs available after processing 6914240 (40.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 16 0.00% 21 3 0.00% 22 12 0.00% 23 13 0.00% 24 11 0.00% 25 11 0.00% 26 7 0.00% 27 13 0.00% 28 12 0.00% 29 12 0.00% 30 16 0.00% 31 32 0.00% 32 18 0.00% 33 14 0.00% 34 13 0.00% 35 23 0.00% 36 18 0.00% 37 27 0.00% 38 41 0.00% 39 38 0.00% 40 32 0.00% 41 34 0.00% 42 52 0.00% 43 37 0.00% 44 50 0.00% 45 50 0.00% 46 64 0.00% 47 86 0.00% 48 109 0.00% 49 108 0.00% 50 120 0.00% 51 135 0.00% 52 156 0.00% 53 185 0.00% 54 191 0.00% 55 199 0.00% 56 267 0.00% 57 240 0.00% 58 293 0.00% 59 337 0.00% 60 396 0.00% 61 418 0.00% 62 490 0.00% 63 578 0.00% 64 658 0.00% 65 639 0.00% 66 747 0.00% 67 837 0.00% 68 927 0.01% 69 1052 0.01% 70 1242 0.01% 71 1364 0.01% 72 1741 0.01% 73 1907 0.01% 74 2067 0.01% 75 2280 0.01% 76 2753 0.02% 77 3140 0.02% 78 3111 0.02% 79 3411 0.02% 80 3817 0.02% 81 4452 0.03% 82 4943 0.03% 83 5654 0.03% 84 7013 0.04% 85 8047 0.05% 86 8718 0.05% 87 9515 0.06% 88 10195 0.06% 89 10528 0.06% 90 11250 0.07% 91 12076 0.07% 92 13222 0.08% 93 14326 0.08% 94 15607 0.09% 95 16824 0.10% 96 17475 0.10% 97 18329 0.11% 98 19215 0.11% 99 20343 0.12% 100 21515 0.13% 101 22684 0.13% 102 24668 0.14% 103 26067 0.15% 104 27819 0.16% 105 29240 0.17% 106 30375 0.18% 107 31546 0.18% 108 32418 0.19% 109 33948 0.20% 110 34740 0.20% 111 36817 0.21% 112 38366 0.22% 113 40133 0.23% 114 41569 0.24% 115 43551 0.25% 116 44875 0.26% 117 46325 0.27% 118 46732 0.27% 119 48442 0.28% 120 49771 0.29% 121 51062 0.30% 122 52271 0.31% 123 54866 0.32% 124 56755 0.33% 125 58624 0.34% 126 60752 0.35% 127 61923 0.36% 128 64035 0.37% 129 66787 0.39% 130 67897 0.40% 131 69713 0.41% 132 72660 0.42% 133 76846 0.45% 134 80550 0.47% 135 85184 0.50% 136 88626 0.52% 137 95414 0.56% 138 101025 0.59% 139 108101 0.63% 140 116446 0.68% 141 127970 0.75% 142 143729 0.84% 143 163507 0.95% 144 195148 1.14% 145 236623 1.38% 146 294547 1.72% 147 403472 2.36% 148 619029 3.61% 149 1193003 6.97% 150 4329152 25.28% 151 6914240 40.37% 17125972 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=20 prefix-density=0.57 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=89.18 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAA criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=17 prefix-density=0.67 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.15 sequence-density-rank=21 fanout-score=12.19 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=6.1 sequence=TGGTTCAAGGCTGGAGC SRR7171056 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:05:56 Started mapping on | Feb 13 22:05:56 Finished on | Feb 13 22:07:43 Mapping speed, Million of reads per hour | 576.20 Number of input reads | 17125972 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16111893 Uniquely mapped reads % | 94.08% Average mapped length | 290.53 Number of splices: Total | 14939724 Number of splices: Annotated (sjdb) | 14612966 Number of splices: GT/AG | 14656274 Number of splices: GC/AG | 228917 Number of splices: AT/AC | 9237 Number of splices: Non-canonical | 45296 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 441980 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 87701 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.69% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 590596 590596 590596 N_multimapping 441980 441980 441980 N_noFeature 678175 15818465 789951 N_ambiguous 287484 1106 105173 UnstrandedReadsAssigned:15146234 PositiveStrandReadsAssigned:292322 NegativeStrandReadsAssigned:15216769 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7171056 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171056-trimmed-pair1.fastq SRR7171056-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,125,972 reads, 15,198,462 reads pseudoaligned [quant] estimated average fragment length: 219.47 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 SRR7171056.ke.tsv 34699 SRR7171056.se.tsv 87100 total ==> SRR7171056.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.53 613 19.4541 Potri.005G024800.1.v4.1 1035 816.53 253 17.6953 Potri.004G059700.1.v4.1 961 742.545 20 1.53821 Potri.007G009000.2.v4.1 1416 1197.53 0 0 Potri.003G141000.2.v4.1 2943 2724.53 915.335 19.1866 Potri.016G087400.1.v4.1 270 87.9682 858 557.02 Potri.015G069301.1.v4.1 564 347.897 0 0 Potri.010G195200.1.v4.1 1773 1554.53 46 1.68993 Potri.012G127500.1.v4.1 977 758.54 177 13.3261 ==> SRR7171056.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 614 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 435 Potri.001G212900.v4.1 84 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 3 SRR7171056 completed mapping pipeline successfully