Starting /dee2/code/volunteer_pipeline.sh SRR7171057 current disk space = 3088788406272 free memory = 1497797968 SRR7171057 SRAfilesize 2c8d42ce05a68a1f5d9c921f4aee066d SRR7171057.sra SRR7171057.sra file validated SRR7171057 is paired end SRR7171057 is conventional basespace SRR7171057 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171057_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.97375 27.0 18.0 33.0 18.0 33.0 2 28.615 29.0 27.0 31.0 18.0 33.0 3 31.62075 33.0 31.0 33.0 28.0 33.0 4 32.24025 33.0 33.0 33.0 31.0 34.0 5 32.71075 33.0 33.0 33.0 31.0 34.0 6 37.19475 38.0 37.0 38.0 36.0 38.0 7 37.542 38.0 38.0 38.0 37.0 38.0 8 37.604 38.0 38.0 38.0 38.0 38.0 9 37.03975 38.0 38.0 38.0 37.0 38.0 10-14 37.63275 38.0 38.0 38.0 37.8 38.0 15-19 37.6707 38.0 38.0 38.0 38.0 38.0 20-24 37.63484999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.5924 38.0 38.0 38.0 38.0 38.0 30-34 37.579499999999996 38.0 38.0 38.0 38.0 38.0 35-39 36.72195000000001 38.0 37.4 38.0 32.6 38.0 40-44 37.02655 38.0 37.8 38.0 35.6 38.0 45-49 37.2986 38.0 38.0 38.0 36.6 38.0 50-54 37.41415 38.0 38.0 38.0 37.0 38.0 55-59 36.08395 38.0 35.6 38.0 31.0 38.0 60-64 37.3408 38.0 38.0 38.0 37.0 38.0 65-69 37.28325 38.0 38.0 38.0 36.8 38.0 70-74 37.179500000000004 38.0 38.0 38.0 36.0 38.0 75-79 37.120799999999996 38.0 38.0 38.0 36.0 38.0 80-84 37.07115 38.0 38.0 38.0 36.0 38.0 85-89 36.82965 38.0 38.0 38.0 35.2 38.0 90-94 36.6223 38.0 38.0 38.0 34.4 38.0 95-99 36.762100000000004 38.0 38.0 38.0 35.0 38.0 100-104 36.7651 38.0 38.0 38.0 35.0 38.0 105-109 36.669050000000006 38.0 38.0 38.0 34.8 38.0 110-114 36.33675 38.0 37.6 38.0 33.8 38.0 115-119 36.213849999999994 38.0 37.2 38.0 33.8 38.0 120-124 36.1533 38.0 37.2 38.0 33.6 38.0 125-129 36.008500000000005 38.0 37.0 38.0 33.0 38.0 130-134 33.294 37.8 31.6 38.0 19.8 38.0 135-139 35.1077 38.0 35.4 38.0 29.0 38.0 140-144 35.02255 38.0 35.2 38.0 29.2 38.0 145-149 34.436749999999996 38.0 34.4 38.0 27.8 38.0 150-151 30.47775 35.5 28.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 1.0 15 0.0 16 0.0 17 3.0 18 1.0 19 6.0 20 4.0 21 2.0 22 2.0 23 6.0 24 7.0 25 14.0 26 4.0 27 15.0 28 24.0 29 24.0 30 30.0 31 34.0 32 49.0 33 99.0 34 161.0 35 356.0 36 1068.0 37 2087.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.18602804974861 13.07224133368616 9.050013231013496 34.69171738555173 2 20.530132533133283 18.829707426856714 36.459114778694676 24.18104526131533 3 18.7 25.575 28.075 27.650000000000002 4 22.45 31.275 23.075000000000003 23.200000000000003 5 21.3 36.425000000000004 24.349999999999998 17.925 6 17.8 36.449999999999996 26.625 19.125 7 15.299999999999999 22.6 43.5 18.6 8 17.474999999999998 24.5 31.900000000000002 26.125 9 17.2 24.95 32.0 25.85 10-14 19.580000000000002 30.209999999999997 26.314999999999998 23.895 15-19 20.25 29.459999999999997 27.36 22.93 20-24 19.950000000000003 28.854999999999997 28.025 23.169999999999998 25-29 20.5 28.725 27.76 23.015 30-34 19.939999999999998 28.994999999999997 28.060000000000002 23.005 35-39 20.015 29.035 27.365000000000002 23.585 40-44 20.465 29.565 27.045 22.925 45-49 20.4 28.189999999999998 28.050000000000004 23.36 50-54 20.605 28.925 27.515 22.955000000000002 55-59 20.13 28.999999999999996 27.339999999999996 23.53 60-64 20.305 29.104999999999997 27.284999999999997 23.305 65-69 19.975 28.95 27.73 23.345 70-74 20.150000000000002 28.64 27.48 23.73 75-79 19.994999999999997 28.555000000000003 28.225 23.225 80-84 20.560000000000002 28.28 27.79 23.369999999999997 85-89 20.525 28.57 27.605 23.3 90-94 20.685000000000002 28.13 27.625 23.56 95-99 20.715 28.08 27.99 23.215 100-104 20.974999999999998 28.685 27.195000000000004 23.145 105-109 21.04 28.105000000000004 27.705000000000002 23.150000000000002 110-114 21.035 28.03 27.775 23.16 115-119 20.685000000000002 28.565 27.265 23.485 120-124 21.285 28.055000000000003 27.33 23.330000000000002 125-129 21.36 28.720000000000002 26.474999999999998 23.445 130-134 21.224999999999998 28.26 26.369999999999997 24.145 135-139 21.32 28.615000000000002 26.490000000000002 23.575 140-144 20.9 27.845 26.784999999999997 24.47 145-149 20.965 27.779999999999998 26.69 24.565 150-151 21.475 27.575 26.375 24.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 3.5 25 3.5 26 7.0 27 13.0 28 17.5 29 20.5 30 22.5 31 29.5 32 41.5 33 58.5 34 74.5 35 85.0 36 108.0 37 136.5 38 144.5 39 161.0 40 189.0 41 207.0 42 235.5 43 251.0 44 241.0 45 241.5 46 237.5 47 233.5 48 224.0 49 195.5 50 156.0 51 126.0 52 108.5 53 88.0 54 71.5 55 54.5 56 51.5 57 44.5 58 29.0 59 24.0 60 21.5 61 14.0 62 8.0 63 5.0 64 3.5 65 3.0 66 1.0 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.525 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.4524886877828055 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.025138260432378077 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 5 0.125 TruSeq Adapter, Index 19 (97% over 38bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.7749999999999999 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.1375 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.6 0.0 0.0 0.0 0.0 102-103 1.8125 0.0 0.0 0.0 0.0 104-105 2.0875000000000004 0.0 0.0 0.0 0.0 106-107 2.5 0.0 0.0 0.0 0.0 108-109 2.6375 0.0 0.0 0.0 0.0 110-111 2.95 0.0 0.0 0.0 0.0 112-113 3.2875 0.0 0.0 0.0 0.0 114-115 3.7750000000000004 0.0 0.0 0.0 0.0 116-117 4.3 0.0 0.0 0.0 0.0 118-119 4.7875 0.0 0.0 0.0 0.0 120-121 5.225 0.0 0.0 0.0 0.0 122-123 5.6125 0.0 0.0 0.0 0.0 124-125 6.0375 0.0 0.0 0.0 0.0 126-127 6.5375 0.0 0.0 0.0 0.0 128-129 7.075 0.0 0.0 0.0 0.0 130-131 7.65 0.0 0.0 0.0 0.0 132-133 8.2375 0.0 0.0 0.0 0.0 134-135 8.85 0.0 0.0 0.0 0.0 136-137 9.5875 0.0 0.0 0.0 0.0 138-139 10.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTAAGAT 10 0.0060887975 150.61038 1 ATGGTGA 10 0.006836113 144.9625 6 CTAATGT 10 0.006836113 144.9625 3 AATCCAA 20 0.005942617 28.992498 140-144 >>END_MODULE SRR7171057 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171057_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97925 33.0 33.0 34.0 32.0 34.0 2 32.998 34.0 33.0 34.0 32.0 34.0 3 33.0135 34.0 33.0 34.0 32.0 34.0 4 32.969 34.0 33.0 34.0 33.0 34.0 5 32.92 34.0 33.0 34.0 32.0 34.0 6 36.96375 38.0 38.0 38.0 37.0 38.0 7 36.865 38.0 38.0 38.0 36.0 38.0 8 36.98425 38.0 38.0 38.0 37.0 38.0 9 37.01425 38.0 38.0 38.0 37.0 38.0 10-14 37.068299999999994 38.0 38.0 38.0 36.8 38.0 15-19 37.11749999999999 38.0 38.0 38.0 37.0 38.0 20-24 36.4028 38.0 37.8 38.0 33.6 38.0 25-29 36.67385 38.0 38.0 38.0 35.8 38.0 30-34 36.841300000000004 38.0 38.0 38.0 36.2 38.0 35-39 36.902699999999996 38.0 38.0 38.0 36.2 38.0 40-44 35.9639 38.0 36.2 38.0 32.0 38.0 45-49 36.525349999999996 38.0 37.4 38.0 34.0 38.0 50-54 36.915099999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.849000000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.69425 38.0 38.0 38.0 35.8 38.0 65-69 36.62455 38.0 38.0 38.0 35.4 38.0 70-74 36.6755 38.0 38.0 38.0 35.2 38.0 75-79 36.59675 38.0 38.0 38.0 35.2 38.0 80-84 36.44375 38.0 38.0 38.0 34.6 38.0 85-89 36.3547 38.0 38.0 38.0 34.2 38.0 90-94 36.317750000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.18595 38.0 38.0 38.0 34.0 38.0 100-104 36.0658 38.0 38.0 38.0 33.6 38.0 105-109 35.641650000000006 38.0 37.4 38.0 31.2 38.0 110-114 35.420550000000006 38.0 36.8 38.0 30.0 38.0 115-119 35.514450000000004 38.0 37.0 38.0 31.4 38.0 120-124 35.16795 38.0 36.2 38.0 29.2 38.0 125-129 34.6446 38.0 35.4 38.0 27.0 38.0 130-134 34.47109999999999 38.0 35.2 38.0 26.6 38.0 135-139 33.951649999999994 38.0 33.6 38.0 23.6 38.0 140-144 33.2394 38.0 33.0 38.0 19.8 38.0 145-149 32.030899999999995 38.0 33.0 38.0 8.4 38.0 150-151 26.466749999999998 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 1.0 4 4.0 5 1.0 6 2.0 7 1.0 8 1.0 9 3.0 10 2.0 11 1.0 12 6.0 13 2.0 14 2.0 15 3.0 16 9.0 17 6.0 18 9.0 19 9.0 20 10.0 21 8.0 22 15.0 23 9.0 24 15.0 25 20.0 26 18.0 27 18.0 28 26.0 29 37.0 30 46.0 31 63.0 32 83.0 33 96.0 34 179.0 35 318.0 36 723.0 37 2243.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.8 19.925 11.25 27.025 2 25.724999999999998 25.7 31.55 17.025000000000002 3 20.325 27.875 32.375 19.425 4 23.849999999999998 34.9 22.475 18.775 5 24.625 35.65 22.675 17.05 6 20.025000000000002 36.95 23.3 19.725 7 19.125 18.9 40.925 21.05 8 20.125 24.825 27.725 27.325 9 22.075 25.224999999999998 28.075 24.625 10-14 23.745 28.09 26.71 21.455 15-19 23.05 27.860000000000003 27.57 21.52 20-24 22.935 27.894999999999996 28.134999999999998 21.035 25-29 22.64 28.915000000000003 27.805000000000003 20.64 30-34 23.645 27.68 27.825 20.849999999999998 35-39 23.125 28.59 27.42 20.865000000000002 40-44 23.56 28.110000000000003 27.750000000000004 20.580000000000002 45-49 23.39 27.61 28.15 20.849999999999998 50-54 22.63 28.13 28.16 21.08 55-59 23.59 27.42 27.589999999999996 21.4 60-64 23.830000000000002 27.189999999999998 27.915 21.065 65-69 23.29 27.41 27.975 21.325 70-74 23.22 27.665 28.37 20.745 75-79 23.255 26.950000000000003 28.185 21.61 80-84 23.145 28.294999999999998 27.675 20.885 85-89 23.27 27.875 28.01 20.845 90-94 23.39 27.345000000000002 28.544999999999998 20.72 95-99 23.57 27.725 27.93 20.775 100-104 24.26 27.779999999999998 27.575 20.385 105-109 23.16 28.52 27.229999999999997 21.09 110-114 23.835 28.04 27.884999999999998 20.24 115-119 24.695 27.805000000000003 27.38 20.119999999999997 120-124 24.005000000000003 28.389999999999997 27.295 20.31 125-129 24.545 27.97 27.24 20.244999999999997 130-134 24.474999999999998 28.21 27.13 20.185 135-139 24.87 27.900000000000002 27.474999999999998 19.755 140-144 25.555 28.13 26.645000000000003 19.67 145-149 25.88 27.855 26.745 19.52 150-151 26.150000000000002 27.575 26.8375 19.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 1.5 24 3.5 25 3.0 26 2.0 27 5.0 28 6.5 29 13.0 30 17.0 31 20.0 32 29.0 33 40.5 34 52.5 35 69.0 36 82.5 37 107.5 38 134.5 39 146.0 40 174.5 41 210.0 42 249.5 43 262.0 44 255.0 45 265.0 46 272.5 47 263.0 48 231.0 49 194.0 50 168.5 51 141.5 52 104.0 53 93.0 54 96.5 55 78.5 56 60.0 57 43.0 58 27.5 59 22.5 60 17.0 61 11.0 62 8.5 63 4.5 64 1.5 65 1.5 66 1.0 67 0.0 68 0.5 69 0.5 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42080080584236 98.7 2 0.4784688995215311 0.95 3 0.07554772097708386 0.22499999999999998 4 0.0 0.0 5 0.02518257365902795 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.325 0.0 0.0 0.0 0.0 100-101 1.55 0.0 0.0 0.0 0.0 102-103 1.7625 0.0 0.0 0.0 0.0 104-105 2.025 0.0 0.0 0.0 0.0 106-107 2.4000000000000004 0.0 0.0 0.0 0.0 108-109 2.5375 0.0 0.0 0.0 0.0 110-111 2.8625 0.0 0.0 0.0 0.0 112-113 3.2125 0.0 0.0 0.0 0.0 114-115 3.6625 0.0 0.0 0.0 0.0 116-117 4.1625 0.0 0.0 0.0 0.0 118-119 4.6375 0.0 0.0 0.0 0.0 120-121 5.0625 0.0 0.0 0.0 0.0 122-123 5.4125 0.0 0.0 0.0 0.0 124-125 5.85 0.0 0.0 0.0 0.0 126-127 6.4 0.0 0.0 0.0 0.0 128-129 7.025 0.0 0.0 0.0 0.0 130-131 7.6875 0.0 0.0 0.0 0.0 132-133 8.325 0.0 0.0 0.0 0.0 134-135 8.925 0.0 0.0 0.0 0.0 136-137 9.6375 0.0 0.0 0.0 0.0 138-139 10.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTCTA 10 0.006830828 145.0 8 CTTGATT 10 0.006830828 145.0 2 >>END_MODULE Read 915814 spots for SRR7171057.sra Written 915814 spots for SRR7171057.sra Read 915814 spots for SRR7171057.sra Written 915814 spots for SRR7171057.sra Read 915814 spots for SRR7171057.sra Written 915814 spots for SRR7171057.sra Read 915814 spots for SRR7171057.sra Written 915814 spots for SRR7171057.sra Read 915814 spots for SRR7171057.sra Written 915814 spots for SRR7171057.sra Read 915814 spots for SRR7171057.sra Written 915814 spots for SRR7171057.sra Read 915814 spots for SRR7171057.sra Written 915814 spots for SRR7171057.sra Read 915814 spots for SRR7171057.sra Written 915814 spots for SRR7171057.sra Read 915814 spots for SRR7171057.sra Written 915814 spots for SRR7171057.sra Read 915814 spots for SRR7171057.sra Written 915814 spots for SRR7171057.sra Read 915814 spots for SRR7171057.sra Written 915814 spots for SRR7171057.sra Read 915814 spots for SRR7171057.sra Written 915814 spots for SRR7171057.sra Read 915814 spots for SRR7171057.sra Written 915814 spots for SRR7171057.sra Read 915814 spots for SRR7171057.sra Written 915814 spots for SRR7171057.sra Read 915814 spots for SRR7171057.sra Written 915814 spots for SRR7171057.sra Read 915814 spots for SRR7171057.sra Written 915814 spots for SRR7171057.sra Read 915818 spots for SRR7171057.sra Written 915818 spots for SRR7171057.sra Read 915814 spots for SRR7171057.sra Written 915814 spots for SRR7171057.sra Read 915814 spots for SRR7171057.sra Written 915814 spots for SRR7171057.sra Read 915814 spots for SRR7171057.sra Written 915814 spots for SRR7171057.sra SRR ids: ['SRR7171057.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vj_ouy3b SRR7171057.sra spots: 18316284 blocks: [[1, 915814], [915815, 1831628], [1831629, 2747442], [2747443, 3663256], [3663257, 4579070], [4579071, 5494884], [5494885, 6410698], [6410699, 7326512], [7326513, 8242326], [8242327, 9158140], [9158141, 10073954], [10073955, 10989768], [10989769, 11905582], [11905583, 12821396], [12821397, 13737210], [13737211, 14653024], [14653025, 15568838], [15568839, 16484652], [16484653, 17400466], [17400467, 18316284]] SRR7171057 file size 6185087 SRR7171057 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171057 SRR7171057_1.fastq SRR7171057_2.fastq Input file: SRR7171057_1.fastq Paired file: SRR7171057_2.fastq trimmed: SRR7171057-trimmed-pair1.fastq, SRR7171057-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:32:27 2025 >> started Thu Feb 13 22:32:48 2025 >> done (21.626s) 18316284 read pairs processed; of these: 22492 ( 0.12%) short read pairs filtered out after trimming by size control 34813 ( 0.19%) empty read pairs filtered out after trimming by size control 18258979 (99.69%) read pairs available; of these: 10212928 (55.93%) trimmed read pairs available after processing 8046051 (44.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 8 0.00% 20 7 0.00% 21 11 0.00% 22 14 0.00% 23 11 0.00% 24 5 0.00% 25 10 0.00% 26 2 0.00% 27 6 0.00% 28 13 0.00% 29 16 0.00% 30 17 0.00% 31 19 0.00% 32 17 0.00% 33 11 0.00% 34 17 0.00% 35 14 0.00% 36 22 0.00% 37 17 0.00% 38 31 0.00% 39 35 0.00% 40 41 0.00% 41 52 0.00% 42 57 0.00% 43 53 0.00% 44 69 0.00% 45 71 0.00% 46 71 0.00% 47 81 0.00% 48 105 0.00% 49 135 0.00% 50 165 0.00% 51 174 0.00% 52 187 0.00% 53 209 0.00% 54 203 0.00% 55 236 0.00% 56 285 0.00% 57 330 0.00% 58 393 0.00% 59 412 0.00% 60 486 0.00% 61 597 0.00% 62 690 0.00% 63 751 0.00% 64 811 0.00% 65 882 0.00% 66 967 0.01% 67 1057 0.01% 68 1259 0.01% 69 1361 0.01% 70 1620 0.01% 71 1938 0.01% 72 2150 0.01% 73 2490 0.01% 74 2752 0.02% 75 3145 0.02% 76 3989 0.02% 77 4518 0.02% 78 4096 0.02% 79 4451 0.02% 80 4945 0.03% 81 5709 0.03% 82 6509 0.04% 83 7266 0.04% 84 9152 0.05% 85 10437 0.06% 86 10898 0.06% 87 11820 0.06% 88 12441 0.07% 89 12893 0.07% 90 13867 0.08% 91 15317 0.08% 92 16302 0.09% 93 18097 0.10% 94 19526 0.11% 95 20794 0.11% 96 21707 0.12% 97 22452 0.12% 98 23373 0.13% 99 24629 0.13% 100 26179 0.14% 101 27149 0.15% 102 29231 0.16% 103 31627 0.17% 104 33321 0.18% 105 34897 0.19% 106 36545 0.20% 107 37457 0.21% 108 38889 0.21% 109 39902 0.22% 110 41033 0.22% 111 42364 0.23% 112 44412 0.24% 113 46460 0.25% 114 47931 0.26% 115 50677 0.28% 116 51572 0.28% 117 52470 0.29% 118 53957 0.30% 119 54421 0.30% 120 55178 0.30% 121 56891 0.31% 122 59112 0.32% 123 61498 0.34% 124 63386 0.35% 125 64921 0.36% 126 68157 0.37% 127 69883 0.38% 128 70965 0.39% 129 73593 0.40% 130 74662 0.41% 131 76746 0.42% 132 80191 0.44% 133 84244 0.46% 134 86851 0.48% 135 91967 0.50% 136 95604 0.52% 137 100871 0.55% 138 106786 0.58% 139 113856 0.62% 140 120492 0.66% 141 131075 0.72% 142 143449 0.79% 143 161288 0.88% 144 185854 1.02% 145 218865 1.20% 146 267936 1.47% 147 361474 1.98% 148 527424 2.89% 149 997099 5.46% 150 4390337 24.04% 151 8046051 44.07% 18258979 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=7.58 fanout-score-rank=10 prefix-density=0.45 prefix-fanout=4.4 sequence=CCAGCAGTGTCCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=41.55 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.8 sequence=AGATTTCAAGTGCATGGATTAAGGTTAATCGCCCGGTAACACCTTGAAATATCTCAATGAGATGTACAGTGCATTTAGATTATGAGTAGGGAACATCAAGAAAAGTAAAATCACAGAGAAGGAGCTCTCTCAGCAGAACCAGCAATGACAGTGAGCAAGTTGTTGCCAAAAGGATCGCTGAGATGTTTTGCGAGGTTCTCCACGGGACCTTCTCCAGTAACATAAGCTTGGAAGAAGAAACCCAGCATGGCAAACATTGCAAGTCTACCATT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=38 prefix-density=0.49 prefix-fanout=2.2 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=94.93 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=3.7 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT SRR7171057 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:33:32 Started mapping on | Feb 13 22:33:32 Finished on | Feb 13 22:35:32 Mapping speed, Million of reads per hour | 547.77 Number of input reads | 18258979 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 17077776 Uniquely mapped reads % | 93.53% Average mapped length | 289.98 Number of splices: Total | 15033484 Number of splices: Annotated (sjdb) | 14687094 Number of splices: GT/AG | 14738504 Number of splices: GC/AG | 234590 Number of splices: AT/AC | 10138 Number of splices: Non-canonical | 50252 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 548507 % of reads mapped to multiple loci | 3.00% Number of reads mapped to too many loci | 114101 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.67% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 653301 653301 653301 N_multimapping 548507 548507 548507 N_noFeature 616860 16837652 703672 N_ambiguous 280557 1145 126597 UnstrandedReadsAssigned:16180359 PositiveStrandReadsAssigned:238979 NegativeStrandReadsAssigned:16247507 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7171057 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171057-trimmed-pair1.fastq SRR7171057-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,258,979 reads, 16,312,460 reads pseudoaligned [quant] estimated average fragment length: 219.609 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,222 rounds 52401 SRR7171057.ke.tsv 34699 SRR7171057.se.tsv 87100 total ==> SRR7171057.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.39 579 18.579 Potri.005G024800.1.v4.1 1035 816.391 291 20.5808 Potri.004G059700.1.v4.1 961 742.4 28 2.17765 Potri.007G009000.2.v4.1 1416 1197.39 2 0.0964411 Potri.003G141000.2.v4.1 2943 2724.39 416 8.81642 Potri.016G087400.1.v4.1 270 89.956 1226.32 787.119 Potri.015G069301.1.v4.1 564 347.665 0 0 Potri.010G195200.1.v4.1 1773 1554.39 88.8541 3.30054 Potri.012G127500.1.v4.1 977 758.395 268 20.4036 ==> SRR7171057.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 239 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 344 Potri.001G212900.v4.1 760 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR7171057 completed mapping pipeline successfully