Starting /dee2/code/volunteer_pipeline.sh SRR7171058 current disk space = 3088892735488 free memory = 1491388232 SRR7171058 SRAfilesize 08b4425eea6a4f30cef4df8f3878988f SRR7171058.sra SRR7171058.sra file validated SRR7171058 is paired end SRR7171058 is conventional basespace SRR7171058 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171058_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.11975 18.0 18.0 25.0 18.0 31.0 2 29.75225 30.0 28.0 31.0 27.0 33.0 3 30.61375 31.0 29.0 33.0 27.0 33.0 4 31.49375 33.0 31.0 33.0 29.0 33.0 5 32.54075 33.0 33.0 33.0 31.0 34.0 6 36.869 38.0 37.0 38.0 35.0 38.0 7 37.34375 38.0 38.0 38.0 36.0 38.0 8 37.4145 38.0 38.0 38.0 37.0 38.0 9 36.8115 38.0 38.0 38.0 35.0 38.0 10-14 37.407799999999995 38.0 38.0 38.0 36.8 38.0 15-19 37.51545 38.0 38.0 38.0 37.0 38.0 20-24 37.5017 38.0 38.0 38.0 37.0 38.0 25-29 37.3507 38.0 38.0 38.0 37.0 38.0 30-34 37.36645 38.0 38.0 38.0 37.0 38.0 35-39 36.50975 38.0 37.4 38.0 31.8 38.0 40-44 36.6831 38.0 37.6 38.0 32.4 38.0 45-49 36.98925 38.0 37.8 38.0 35.4 38.0 50-54 37.05995 38.0 38.0 38.0 36.0 38.0 55-59 35.49355 37.8 35.2 38.0 29.8 38.0 60-64 36.90605 38.0 38.0 38.0 35.4 38.0 65-69 36.80825 38.0 38.0 38.0 35.0 38.0 70-74 36.69905 38.0 38.0 38.0 34.4 38.0 75-79 36.7139 38.0 38.0 38.0 34.8 38.0 80-84 36.6269 38.0 38.0 38.0 34.2 38.0 85-89 36.257799999999996 38.0 37.2 38.0 33.6 38.0 90-94 35.97025 38.0 37.0 38.0 32.2 38.0 95-99 36.2127 38.0 37.0 38.0 33.4 38.0 100-104 36.27845 38.0 37.2 38.0 33.8 38.0 105-109 36.0675 38.0 37.0 38.0 33.2 38.0 110-114 35.5176 38.0 36.2 38.0 30.2 38.0 115-119 35.40455000000001 38.0 36.0 38.0 29.4 38.0 120-124 35.37195 38.0 36.0 38.0 29.8 38.0 125-129 35.172000000000004 38.0 35.4 38.0 28.8 38.0 130-134 32.095949999999995 36.6 28.2 38.0 18.2 38.0 135-139 33.89345 37.8 34.0 38.0 23.6 38.0 140-144 33.769600000000004 38.0 33.8 38.0 22.6 38.0 145-149 32.772 38.0 33.2 38.0 16.8 38.0 150-151 28.33575 35.0 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 1.0 13 0.0 14 2.0 15 2.0 16 2.0 17 0.0 18 5.0 19 4.0 20 1.0 21 6.0 22 7.0 23 4.0 24 11.0 25 14.0 26 17.0 27 20.0 28 31.0 29 44.0 30 52.0 31 70.0 32 106.0 33 177.0 34 263.0 35 511.0 36 1209.0 37 1437.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.63081009296149 13.678618857901725 10.305444887118194 30.385126162018594 2 19.42985746436609 17.75443860965241 34.433608402100525 28.382095523880967 3 16.6 23.799999999999997 30.625000000000004 28.975 4 21.75 32.025 24.55 21.675 5 22.35 35.225 23.849999999999998 18.575 6 16.75 35.225 27.500000000000004 20.525 7 13.325000000000001 22.725 45.175 18.775 8 16.950000000000003 22.975 31.75 28.325 9 16.900000000000002 22.975 33.7 26.424999999999997 10-14 20.1 29.225 27.33 23.345 15-19 20.055 28.035 28.110000000000003 23.799999999999997 20-24 19.8 28.525 28.544999999999998 23.13 25-29 20.14 28.720000000000002 27.62 23.52 30-34 19.705000000000002 28.720000000000002 27.644999999999996 23.93 35-39 20.11 27.88 28.194999999999997 23.815 40-44 19.75 28.58 28.09 23.580000000000002 45-49 20.415 28.389999999999997 27.485 23.71 50-54 20.595 28.125 28.050000000000004 23.23 55-59 20.235 28.525 28.02 23.22 60-64 20.155 28.24 27.93 23.674999999999997 65-69 20.24 28.68 27.685 23.395 70-74 20.205000000000002 28.225 28.015 23.555 75-79 20.16 27.52 28.38 23.94 80-84 19.495 28.49 28.1 23.915 85-89 20.365 28.555000000000003 27.900000000000002 23.18 90-94 19.98 28.345 28.199999999999996 23.474999999999998 95-99 20.3 28.53 27.71 23.46 100-104 20.175 28.389999999999997 28.425 23.01 105-109 20.705000000000002 28.055000000000003 27.73 23.51 110-114 20.74 28.144999999999996 28.360000000000003 22.755 115-119 20.575 28.994999999999997 27.200000000000003 23.23 120-124 20.555 28.48 27.474999999999998 23.49 125-129 21.34 28.139999999999997 27.125 23.395 130-134 20.22 28.975 26.979999999999997 23.825 135-139 21.37 28.125 26.855 23.65 140-144 20.974999999999998 28.215 26.810000000000002 24.0 145-149 21.4 28.249999999999996 26.82 23.53 150-151 21.8125 27.487499999999997 26.974999999999998 23.724999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.5 20 1.0 21 0.0 22 0.5 23 2.0 24 3.5 25 3.0 26 5.0 27 7.0 28 9.5 29 15.0 30 21.0 31 30.5 32 40.0 33 43.0 34 63.0 35 80.0 36 85.0 37 120.5 38 152.5 39 168.5 40 182.5 41 218.0 42 248.5 43 262.0 44 265.0 45 260.5 46 250.5 47 229.5 48 223.5 49 211.5 50 180.0 51 139.5 52 109.0 53 85.0 54 70.0 55 54.5 56 42.5 57 36.5 58 21.0 59 15.0 60 12.0 61 6.0 62 5.5 63 3.0 64 2.0 65 3.0 66 2.0 67 1.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.875 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.48750000000000004 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.55 0.0 0.0 0.0 0.0 106-107 1.9625 0.0 0.0 0.0 0.0 108-109 2.2625 0.0 0.0 0.0 0.0 110-111 2.525 0.0 0.0 0.0 0.0 112-113 2.9125 0.0 0.0 0.0 0.0 114-115 3.2375 0.0 0.0 0.0 0.0 116-117 3.65 0.0 0.0 0.0 0.0 118-119 4.0 0.0 0.0 0.0 0.0 120-121 4.375 0.0 0.0 0.0 0.0 122-123 4.6875 0.0 0.0 0.0 0.0 124-125 5.225 0.0 0.0 0.0 0.0 126-127 5.5625 0.0 0.0 0.0 0.0 128-129 5.9 0.0 0.0 0.0 0.0 130-131 6.45 0.0 0.0 0.0 0.0 132-133 6.9625 0.0 0.0 0.0 0.0 134-135 7.5 0.0 0.0 0.0 0.0 136-137 8.0875 0.0 0.0 0.0 0.0 138-139 8.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171058 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171058_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96175 33.0 33.0 34.0 32.0 34.0 2 32.988 34.0 33.0 34.0 32.0 34.0 3 33.016 34.0 33.0 34.0 32.0 34.0 4 32.96325 34.0 33.0 34.0 32.0 34.0 5 32.918 34.0 33.0 34.0 32.0 34.0 6 37.13225 38.0 38.0 38.0 37.0 38.0 7 36.8665 38.0 38.0 38.0 36.0 38.0 8 37.01525 38.0 38.0 38.0 37.0 38.0 9 37.02375 38.0 38.0 38.0 37.0 38.0 10-14 37.09035 38.0 38.0 38.0 37.0 38.0 15-19 37.112350000000006 38.0 38.0 38.0 37.0 38.0 20-24 36.38895 38.0 37.8 38.0 33.6 38.0 25-29 36.650400000000005 38.0 38.0 38.0 35.6 38.0 30-34 36.8449 38.0 38.0 38.0 36.0 38.0 35-39 36.897000000000006 38.0 38.0 38.0 36.2 38.0 40-44 35.917649999999995 38.0 36.0 38.0 32.2 38.0 45-49 36.48005 38.0 37.4 38.0 34.0 38.0 50-54 36.89815 38.0 38.0 38.0 36.2 38.0 55-59 36.884249999999994 38.0 38.0 38.0 36.0 38.0 60-64 36.66525 38.0 38.0 38.0 35.8 38.0 65-69 36.667449999999995 38.0 38.0 38.0 35.6 38.0 70-74 36.6106 38.0 38.0 38.0 35.2 38.0 75-79 36.541450000000005 38.0 38.0 38.0 35.0 38.0 80-84 36.4554 38.0 38.0 38.0 34.6 38.0 85-89 36.378400000000006 38.0 38.0 38.0 34.4 38.0 90-94 36.30575 38.0 38.0 38.0 34.0 38.0 95-99 36.18705 38.0 38.0 38.0 34.0 38.0 100-104 36.098 38.0 38.0 38.0 34.0 38.0 105-109 35.578900000000004 38.0 37.4 38.0 31.0 38.0 110-114 35.325900000000004 38.0 36.4 38.0 29.6 38.0 115-119 35.5856 38.0 37.0 38.0 31.8 38.0 120-124 35.100199999999994 38.0 36.2 38.0 29.2 38.0 125-129 34.650800000000004 38.0 35.4 38.0 26.2 38.0 130-134 34.430949999999996 38.0 35.0 38.0 26.4 38.0 135-139 33.956450000000004 38.0 33.4 38.0 23.6 38.0 140-144 33.3358 38.0 33.0 38.0 20.2 38.0 145-149 32.22025 38.0 33.0 38.0 12.6 38.0 150-151 26.562625 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 2.0 4 5.0 5 1.0 6 0.0 7 3.0 8 1.0 9 5.0 10 2.0 11 2.0 12 4.0 13 4.0 14 1.0 15 4.0 16 2.0 17 9.0 18 7.0 19 5.0 20 7.0 21 2.0 22 7.0 23 7.0 24 15.0 25 9.0 26 21.0 27 23.0 28 29.0 29 29.0 30 53.0 31 61.0 32 92.0 33 132.0 34 184.0 35 320.0 36 738.0 37 2198.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.449999999999996 19.8 9.55 22.2 2 23.275000000000002 25.624999999999996 33.525 17.575 3 20.674999999999997 25.4 33.675 20.25 4 24.0 35.65 22.8 17.549999999999997 5 22.980745186296573 38.98474618654664 21.48037009252313 16.55413853463366 6 19.375 38.35 23.674999999999997 18.6 7 20.925 18.675 40.325 20.075000000000003 8 18.7 25.6 29.125 26.575 9 21.125 24.75 30.975 23.150000000000002 10-14 23.275000000000002 28.794999999999998 26.195 21.735 15-19 22.82 28.53 28.32 20.330000000000002 20-24 22.52 28.725 27.939999999999998 20.815 25-29 23.025000000000002 28.225 27.925 20.825 30-34 22.645 28.285 28.77 20.3 35-39 22.555 28.065 28.585 20.794999999999998 40-44 23.05 27.450000000000003 28.904999999999998 20.595 45-49 22.64 27.865000000000002 28.634999999999998 20.86 50-54 22.395 28.475 28.23 20.9 55-59 23.35 27.860000000000003 28.110000000000003 20.68 60-64 23.56 27.875 27.82 20.745 65-69 23.035 27.345000000000002 28.37 21.25 70-74 23.01 28.610000000000003 27.46 20.919999999999998 75-79 23.655 28.325 27.189999999999998 20.830000000000002 80-84 23.02 28.055000000000003 28.16 20.765 85-89 23.599999999999998 27.72 27.665 21.015 90-94 23.52 27.98 27.67 20.830000000000002 95-99 23.385 28.765 26.945000000000004 20.905 100-104 23.565 28.044999999999998 27.839999999999996 20.549999999999997 105-109 23.69 28.34 27.889999999999997 20.080000000000002 110-114 23.46 28.99 27.41 20.14 115-119 24.365000000000002 28.555000000000003 27.32 19.759999999999998 120-124 23.805 28.425 27.73 20.04 125-129 23.95 28.410000000000004 27.810000000000002 19.830000000000002 130-134 24.36 28.435 27.42 19.785 135-139 24.695 28.48 27.389999999999997 19.435 140-144 25.124999999999996 28.12 27.255000000000003 19.5 145-149 25.45 28.199999999999996 27.200000000000003 19.15 150-151 25.7625 28.9125 26.8 18.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 2.5 25 5.5 26 7.5 27 8.0 28 10.0 29 13.0 30 16.5 31 19.0 32 28.0 33 43.0 34 50.5 35 65.5 36 94.5 37 116.0 38 134.0 39 161.5 40 202.0 41 224.0 42 256.0 43 274.0 44 267.5 45 277.0 46 272.0 47 253.0 48 222.5 49 189.0 50 161.0 51 141.5 52 121.0 53 87.5 54 71.0 55 58.0 56 43.0 57 34.5 58 18.5 59 10.5 60 9.0 61 9.0 62 5.5 63 5.5 64 4.0 65 0.5 66 1.0 67 1.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49698189134809 98.9 2 0.4275653923541248 0.8500000000000001 3 0.05030181086519115 0.15 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.7875000000000001 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.2374999999999998 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.8375 0.0 0.0 0.0 0.0 108-109 2.1375 0.0 0.0 0.0 0.0 110-111 2.3875 0.0 0.0 0.0 0.0 112-113 2.7375 0.0 0.0 0.0 0.0 114-115 3.0125 0.0 0.0 0.0 0.0 116-117 3.375 0.0 0.0 0.0 0.0 118-119 3.7125 0.0 0.0 0.0 0.0 120-121 4.1625 0.0 0.0 0.0 0.0 122-123 4.487500000000001 0.0 0.0 0.0 0.0 124-125 5.05 0.0 0.0 0.0 0.0 126-127 5.5 0.0 0.0 0.0 0.0 128-129 5.9125 0.0 0.0 0.0 0.0 130-131 6.525 0.0 0.0 0.0 0.0 132-133 7.074999999999999 0.0 0.0 0.0 0.0 134-135 7.6 0.0 0.0 0.0 0.0 136-137 8.1875 0.0 0.0 0.0 0.0 138-139 8.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 873363 spots for SRR7171058.sra Written 873363 spots for SRR7171058.sra Read 873363 spots for SRR7171058.sra Written 873363 spots for SRR7171058.sra Read 873363 spots for SRR7171058.sra Written 873363 spots for SRR7171058.sra Read 873363 spots for SRR7171058.sra Written 873363 spots for SRR7171058.sra Read 873363 spots for SRR7171058.sra Written 873363 spots for SRR7171058.sra Read 873363 spots for SRR7171058.sra Written 873363 spots for SRR7171058.sra Read 873363 spots for SRR7171058.sra Written 873363 spots for SRR7171058.sra Read 873363 spots for SRR7171058.sra Written 873363 spots for SRR7171058.sra Read 873381 spots for SRR7171058.sra Written 873381 spots for SRR7171058.sra Read 873363 spots for SRR7171058.sra Written 873363 spots for SRR7171058.sra Read 873363 spots for SRR7171058.sra Written 873363 spots for SRR7171058.sra Read 873363 spots for SRR7171058.sra Written 873363 spots for SRR7171058.sra Read 873363 spots for SRR7171058.sra Written 873363 spots for SRR7171058.sra Read 873363 spots for SRR7171058.sra Written 873363 spots for SRR7171058.sra Read 873363 spots for SRR7171058.sra Written 873363 spots for SRR7171058.sra Read 873363 spots for SRR7171058.sra Written 873363 spots for SRR7171058.sra Read 873363 spots for SRR7171058.sra Written 873363 spots for SRR7171058.sra Read 873363 spots for SRR7171058.sra Written 873363 spots for SRR7171058.sra Read 873363 spots for SRR7171058.sra Written 873363 spots for SRR7171058.sra Read 873363 spots for SRR7171058.sra Written 873363 spots for SRR7171058.sra SRR ids: ['SRR7171058.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xvuow4ur SRR7171058.sra spots: 17467278 blocks: [[1, 873363], [873364, 1746726], [1746727, 2620089], [2620090, 3493452], [3493453, 4366815], [4366816, 5240178], [5240179, 6113541], [6113542, 6986904], [6986905, 7860267], [7860268, 8733630], [8733631, 9606993], [9606994, 10480356], [10480357, 11353719], [11353720, 12227082], [12227083, 13100445], [13100446, 13973808], [13973809, 14847171], [14847172, 15720534], [15720535, 16593897], [16593898, 17467278]] SRR7171058 file size 5897386 SRR7171058 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171058 SRR7171058_1.fastq SRR7171058_2.fastq Input file: SRR7171058_1.fastq Paired file: SRR7171058_2.fastq trimmed: SRR7171058-trimmed-pair1.fastq, SRR7171058-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:41:07 2025 >> started Thu Feb 13 22:41:35 2025 >> done (28.282s) 17467278 read pairs processed; of these: 25546 ( 0.15%) short read pairs filtered out after trimming by size control 29302 ( 0.17%) empty read pairs filtered out after trimming by size control 17412430 (99.69%) read pairs available; of these: 9992493 (57.39%) trimmed read pairs available after processing 7419937 (42.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 12 0.00% 20 8 0.00% 21 14 0.00% 22 13 0.00% 23 28 0.00% 24 10 0.00% 25 23 0.00% 26 30 0.00% 27 12 0.00% 28 21 0.00% 29 17 0.00% 30 16 0.00% 31 19 0.00% 32 18 0.00% 33 23 0.00% 34 23 0.00% 35 17 0.00% 36 24 0.00% 37 22 0.00% 38 28 0.00% 39 42 0.00% 40 39 0.00% 41 38 0.00% 42 45 0.00% 43 57 0.00% 44 51 0.00% 45 46 0.00% 46 59 0.00% 47 76 0.00% 48 113 0.00% 49 109 0.00% 50 109 0.00% 51 138 0.00% 52 168 0.00% 53 193 0.00% 54 205 0.00% 55 205 0.00% 56 218 0.00% 57 263 0.00% 58 283 0.00% 59 337 0.00% 60 394 0.00% 61 463 0.00% 62 518 0.00% 63 535 0.00% 64 627 0.00% 65 711 0.00% 66 804 0.00% 67 903 0.01% 68 964 0.01% 69 1077 0.01% 70 1278 0.01% 71 1413 0.01% 72 1697 0.01% 73 1854 0.01% 74 2067 0.01% 75 2346 0.01% 76 2717 0.02% 77 2994 0.02% 78 3056 0.02% 79 3559 0.02% 80 4005 0.02% 81 4543 0.03% 82 5160 0.03% 83 5660 0.03% 84 7583 0.04% 85 8446 0.05% 86 9202 0.05% 87 9934 0.06% 88 10852 0.06% 89 11306 0.06% 90 11693 0.07% 91 12762 0.07% 92 13576 0.08% 93 14743 0.08% 94 15770 0.09% 95 16718 0.10% 96 17613 0.10% 97 18214 0.10% 98 19054 0.11% 99 20070 0.12% 100 21361 0.12% 101 22140 0.13% 102 23921 0.14% 103 25803 0.15% 104 26670 0.15% 105 28254 0.16% 106 29414 0.17% 107 30243 0.17% 108 31355 0.18% 109 32890 0.19% 110 33568 0.19% 111 35374 0.20% 112 37044 0.21% 113 38698 0.22% 114 40000 0.23% 115 41553 0.24% 116 43076 0.25% 117 44544 0.26% 118 45327 0.26% 119 45676 0.26% 120 47092 0.27% 121 49077 0.28% 122 50467 0.29% 123 52453 0.30% 124 54690 0.31% 125 55949 0.32% 126 58243 0.33% 127 59452 0.34% 128 60390 0.35% 129 63028 0.36% 130 64323 0.37% 131 67077 0.39% 132 69830 0.40% 133 73396 0.42% 134 76766 0.44% 135 81803 0.47% 136 85661 0.49% 137 89876 0.52% 138 95621 0.55% 139 103388 0.59% 140 110106 0.63% 141 122646 0.70% 142 135309 0.78% 143 154710 0.89% 144 182876 1.05% 145 219816 1.26% 146 279840 1.61% 147 389294 2.24% 148 575049 3.30% 149 1099611 6.32% 150 4417680 25.37% 151 7419937 42.61% 17412430 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=11 prefix-density=0.41 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=27.16 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.3 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=19 prefix-density=0.49 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=52.94 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.7 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7171058 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:42:20 Started mapping on | Feb 13 22:42:20 Finished on | Feb 13 22:44:11 Mapping speed, Million of reads per hour | 564.73 Number of input reads | 17412430 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16295981 Uniquely mapped reads % | 93.59% Average mapped length | 290.89 Number of splices: Total | 15247243 Number of splices: Annotated (sjdb) | 14866963 Number of splices: GT/AG | 14957640 Number of splices: GC/AG | 228597 Number of splices: AT/AC | 8943 Number of splices: Non-canonical | 52063 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 481381 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 53614 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.16% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 663641 663641 663641 N_multimapping 481381 481381 481381 N_noFeature 703753 16029259 816868 N_ambiguous 270215 1051 116042 UnstrandedReadsAssigned:15322013 PositiveStrandReadsAssigned:265671 NegativeStrandReadsAssigned:15363071 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7171058 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171058-trimmed-pair1.fastq SRR7171058-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,412,430 reads, 15,359,276 reads pseudoaligned [quant] estimated average fragment length: 222.566 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52401 SRR7171058.ke.tsv 34699 SRR7171058.se.tsv 87100 total ==> SRR7171058.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.43 1121 37.6827 Potri.005G024800.1.v4.1 1035 813.434 463 34.3721 Potri.004G059700.1.v4.1 961 739.449 8 0.653325 Potri.007G009000.2.v4.1 1416 1194.43 0 0 Potri.003G141000.2.v4.1 2943 2721.43 716 15.8878 Potri.016G087400.1.v4.1 270 86.1357 972.746 681.967 Potri.015G069301.1.v4.1 564 345.279 0 0 Potri.010G195200.1.v4.1 1773 1551.43 943.985 36.7434 Potri.012G127500.1.v4.1 977 755.444 83 6.63473 ==> SRR7171058.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 676 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 340 Potri.001G212900.v4.1 15 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 25 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 4 SRR7171058 completed mapping pipeline successfully