Starting /dee2/code/volunteer_pipeline.sh SRR7171059 current disk space = 3089345937408 free memory = 1582376948 SRR7171059 SRAfilesize dcdbbe49272055d7974dd4c9c583741b SRR7171059.sra SRR7171059.sra file validated SRR7171059 is paired end SRR7171059 is conventional basespace SRR7171059 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171059_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.2705 28.0 18.0 33.0 18.0 33.0 2 30.0665 31.0 29.0 33.0 27.0 33.0 3 30.967 33.0 31.0 33.0 27.0 33.0 4 31.31525 33.0 31.0 33.0 29.0 33.0 5 32.242 33.0 33.0 33.0 31.0 34.0 6 36.72575 38.0 37.0 38.0 34.0 38.0 7 37.262 38.0 38.0 38.0 36.0 38.0 8 37.509 38.0 38.0 38.0 37.0 38.0 9 36.999 38.0 38.0 38.0 36.0 38.0 10-14 37.54115 38.0 38.0 38.0 37.6 38.0 15-19 37.60375 38.0 38.0 38.0 38.0 38.0 20-24 37.566700000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.48205 38.0 38.0 38.0 37.4 38.0 30-34 37.47144999999999 38.0 38.0 38.0 37.6 38.0 35-39 36.48400000000001 38.0 37.0 38.0 32.2 38.0 40-44 36.9656 38.0 37.8 38.0 35.0 38.0 45-49 37.21935 38.0 38.0 38.0 36.4 38.0 50-54 37.2778 38.0 38.0 38.0 37.0 38.0 55-59 36.013999999999996 38.0 35.8 38.0 30.4 38.0 60-64 37.12935 38.0 38.0 38.0 36.0 38.0 65-69 37.091449999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.95915000000001 38.0 38.0 38.0 35.8 38.0 75-79 36.95545 38.0 38.0 38.0 36.0 38.0 80-84 36.86050000000001 38.0 38.0 38.0 35.4 38.0 85-89 36.5809 38.0 38.0 38.0 34.2 38.0 90-94 36.302499999999995 38.0 38.0 38.0 33.8 38.0 95-99 36.49735 38.0 38.0 38.0 34.2 38.0 100-104 36.58 38.0 38.0 38.0 34.4 38.0 105-109 36.44155 38.0 38.0 38.0 34.0 38.0 110-114 36.0407 38.0 37.2 38.0 33.4 38.0 115-119 35.7961 38.0 37.0 38.0 31.4 38.0 120-124 35.7692 38.0 37.0 38.0 31.8 38.0 125-129 35.7076 38.0 36.6 38.0 31.4 38.0 130-134 33.2608 37.8 31.8 38.0 19.8 38.0 135-139 34.82445 38.0 35.0 38.0 27.6 38.0 140-144 34.541599999999995 38.0 34.6 38.0 26.8 38.0 145-149 33.860299999999995 38.0 33.8 38.0 24.2 38.0 150-151 29.82325 35.5 27.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 0.0 16 1.0 17 3.0 18 4.0 19 4.0 20 5.0 21 4.0 22 5.0 23 5.0 24 6.0 25 14.0 26 18.0 27 17.0 28 19.0 29 33.0 30 43.0 31 54.0 32 100.0 33 117.0 34 185.0 35 336.0 36 1005.0 37 2018.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.607730477931575 11.961347610342125 10.733873073909637 39.69704883781666 2 21.23716503881793 18.156774355121463 35.18657650889056 25.41948409717005 3 19.425 24.25 27.575 28.749999999999996 4 23.150000000000002 30.725 24.55 21.575 5 21.2 35.025 24.875 18.9 6 16.400000000000002 36.525 27.3 19.775000000000002 7 13.55 22.775000000000002 45.4 18.275 8 17.45 24.0 31.900000000000002 26.650000000000002 9 17.625 23.125 32.85 26.400000000000002 10-14 19.8 29.595 26.790000000000003 23.815 15-19 19.814999999999998 28.26 29.07 22.855 20-24 20.19 29.015 27.415 23.380000000000003 25-29 19.835 28.395 28.125 23.645 30-34 19.485 29.205 28.044999999999998 23.265 35-39 19.89 29.015 27.595 23.5 40-44 19.845 29.475 27.67 23.01 45-49 20.51 28.735 27.29 23.465 50-54 20.94 28.525 27.615000000000002 22.919999999999998 55-59 20.0 28.305000000000003 27.955000000000002 23.74 60-64 20.62 28.125 27.435 23.82 65-69 20.225 28.475 27.435 23.865 70-74 20.724999999999998 28.255000000000003 27.474999999999998 23.544999999999998 75-79 20.145 29.095 27.465 23.294999999999998 80-84 20.4 29.110000000000003 26.924999999999997 23.565 85-89 20.119999999999997 28.749999999999996 27.605 23.525 90-94 19.945 28.749999999999996 27.725 23.580000000000002 95-99 20.11 27.975 27.825 24.09 100-104 20.785 28.435 27.555000000000003 23.225 105-109 20.805 27.79 27.63 23.775 110-114 21.105 27.975 27.474999999999998 23.445 115-119 21.455 28.720000000000002 27.04 22.785 120-124 21.310000000000002 28.84 26.855 22.994999999999997 125-129 21.205 28.685 26.529999999999998 23.580000000000002 130-134 20.405 28.970000000000002 26.490000000000002 24.135 135-139 21.145 28.09 27.105 23.66 140-144 21.41 27.889999999999997 26.645000000000003 24.055 145-149 21.135 28.29 26.284999999999997 24.29 150-151 21.0375 29.375 26.3125 23.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 1.0 20 1.0 21 0.0 22 0.5 23 2.0 24 3.5 25 6.5 26 7.5 27 6.5 28 12.5 29 20.0 30 29.0 31 37.0 32 43.0 33 48.5 34 67.0 35 99.0 36 114.0 37 124.5 38 145.5 39 155.5 40 167.5 41 195.5 42 205.5 43 233.5 44 260.0 45 250.0 46 242.0 47 231.0 48 222.0 49 201.5 50 174.5 51 143.0 52 117.0 53 101.5 54 77.0 55 62.0 56 46.5 57 34.0 58 32.0 59 25.5 60 18.5 61 11.5 62 6.5 63 3.5 64 1.0 65 1.0 66 0.5 67 1.0 68 1.5 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.275 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19273461150352 98.3 2 0.7315842583249244 1.4500000000000002 3 0.050454086781029264 0.15 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.11249999999999999 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.2875 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.6375 0.0 0.0 0.0 0.0 104-105 1.8875000000000002 0.0 0.0 0.0 0.0 106-107 2.3 0.0 0.0 0.0 0.0 108-109 2.6625 0.0 0.0 0.0 0.0 110-111 3.0125 0.0 0.0 0.0 0.0 112-113 3.35 0.0 0.0 0.0 0.0 114-115 3.9 0.0 0.0 0.0 0.0 116-117 4.425000000000001 0.0 0.0 0.0 0.0 118-119 5.0125 0.0 0.0 0.0 0.0 120-121 5.4375 0.0 0.0 0.0 0.0 122-123 5.9875 0.0 0.0 0.0 0.0 124-125 6.512499999999999 0.0 0.0 0.0 0.0 126-127 7.0 0.0 0.0 0.0 0.0 128-129 7.7 0.0 0.0 0.0 0.0 130-131 8.2375 0.0 0.0 0.0 0.0 132-133 8.625 0.0 0.0 0.0 0.0 134-135 9.3125 0.0 0.0 0.0 0.0 136-137 10.024999999999999 0.0 0.0 0.0 0.0 138-139 10.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCCAG 10 0.0068343505 144.975 145 >>END_MODULE SRR7171059 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171059_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84375 33.0 33.0 34.0 32.0 34.0 2 32.944 34.0 33.0 34.0 32.0 34.0 3 32.88075 34.0 33.0 34.0 32.0 34.0 4 32.90325 34.0 33.0 34.0 32.0 34.0 5 32.821 34.0 33.0 34.0 32.0 34.0 6 37.02125 38.0 38.0 38.0 36.0 38.0 7 36.7795 38.0 38.0 38.0 36.0 38.0 8 36.9285 38.0 38.0 38.0 36.0 38.0 9 36.986 38.0 38.0 38.0 36.0 38.0 10-14 37.04880000000001 38.0 38.0 38.0 36.4 38.0 15-19 37.05235 38.0 38.0 38.0 36.4 38.0 20-24 36.255250000000004 38.0 37.4 38.0 31.0 38.0 25-29 36.6163 38.0 38.0 38.0 35.0 38.0 30-34 36.837599999999995 38.0 38.0 38.0 35.8 38.0 35-39 36.86295 38.0 38.0 38.0 36.0 38.0 40-44 36.01669999999999 38.0 36.2 38.0 32.0 38.0 45-49 36.532349999999994 38.0 37.4 38.0 34.0 38.0 50-54 36.83575 38.0 38.0 38.0 36.0 38.0 55-59 36.79725 38.0 38.0 38.0 35.8 38.0 60-64 36.65145 38.0 38.0 38.0 35.2 38.0 65-69 36.634499999999996 38.0 38.0 38.0 35.0 38.0 70-74 36.62135 38.0 38.0 38.0 35.0 38.0 75-79 36.559450000000005 38.0 38.0 38.0 34.4 38.0 80-84 36.4226 38.0 38.0 38.0 34.0 38.0 85-89 36.37295 38.0 38.0 38.0 34.2 38.0 90-94 36.37365 38.0 38.0 38.0 34.0 38.0 95-99 36.2307 38.0 38.0 38.0 34.0 38.0 100-104 36.056200000000004 38.0 37.6 38.0 33.0 38.0 105-109 35.59545 38.0 36.8 38.0 31.0 38.0 110-114 35.3281 38.0 36.6 38.0 29.0 38.0 115-119 35.6013 38.0 37.0 38.0 31.0 38.0 120-124 35.1458 38.0 36.0 38.0 28.6 38.0 125-129 34.598650000000006 38.0 35.2 38.0 25.4 38.0 130-134 34.57275 38.0 34.6 38.0 26.8 38.0 135-139 33.968650000000004 38.0 33.4 38.0 23.2 38.0 140-144 33.2267 38.0 33.0 38.0 19.2 38.0 145-149 32.08565 38.0 33.0 38.0 10.4 38.0 150-151 26.395249999999997 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 2.0 5 0.0 6 3.0 7 2.0 8 1.0 9 2.0 10 1.0 11 3.0 12 1.0 13 2.0 14 3.0 15 2.0 16 4.0 17 3.0 18 6.0 19 7.0 20 5.0 21 10.0 22 16.0 23 17.0 24 11.0 25 21.0 26 21.0 27 37.0 28 35.0 29 38.0 30 70.0 31 74.0 32 88.0 33 113.0 34 190.0 35 294.0 36 765.0 37 2146.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.6 19.15 13.350000000000001 26.900000000000002 2 25.775 25.724999999999998 31.574999999999996 16.925 3 21.275 27.800000000000004 29.75 21.175 4 24.75 34.25 22.275 18.725 5 24.187093546773387 38.06903451725863 21.085542771385693 16.65832916458229 6 19.45 38.75 22.925 18.875 7 19.425 19.025 41.0 20.549999999999997 8 21.55 24.725 26.05 27.675 9 22.6 25.525 28.499999999999996 23.375 10-14 23.73 28.384999999999998 25.985000000000003 21.9 15-19 23.494999999999997 27.925 27.71 20.87 20-24 23.075000000000003 28.945 27.325 20.655 25-29 23.135 28.799999999999997 27.544999999999998 20.52 30-34 22.845 28.439999999999998 27.994999999999997 20.72 35-39 22.895 28.52 27.515 21.07 40-44 23.71 27.71 27.694999999999997 20.885 45-49 23.635 28.02 27.765 20.580000000000002 50-54 23.205000000000002 27.935 28.035 20.825 55-59 23.380000000000003 27.91 27.560000000000002 21.15 60-64 23.28 28.000000000000004 27.689999999999998 21.029999999999998 65-69 23.025000000000002 27.084999999999997 28.444999999999997 21.445 70-74 23.59 27.355 27.685 21.37 75-79 23.28 27.51 27.72 21.490000000000002 80-84 23.635 27.815 27.575 20.974999999999998 85-89 23.494999999999997 27.41 27.994999999999997 21.099999999999998 90-94 23.59 28.12 27.284999999999997 21.005 95-99 23.724999999999998 28.299999999999997 27.245 20.73 100-104 23.645 27.87 27.35 21.135 105-109 23.43 28.084999999999997 27.794999999999998 20.69 110-114 24.4 28.249999999999996 27.295 20.055 115-119 24.505 27.955000000000002 27.395000000000003 20.145 120-124 24.29 28.515 27.0 20.195 125-129 24.975 27.860000000000003 27.3 19.865 130-134 24.62 27.694999999999997 26.955000000000002 20.73 135-139 25.965 28.084999999999997 26.895000000000003 19.055 140-144 25.445 27.735 27.465 19.355 145-149 25.495 28.03 26.93 19.545 150-151 26.325 27.962500000000002 26.525 19.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 1.5 21 1.5 22 1.5 23 2.0 24 2.5 25 3.0 26 4.5 27 6.0 28 8.0 29 7.5 30 11.5 31 18.5 32 21.5 33 36.0 34 51.0 35 59.5 36 75.0 37 104.5 38 138.5 39 162.5 40 185.0 41 209.0 42 233.5 43 252.0 44 276.0 45 286.5 46 249.5 47 234.5 48 235.0 49 207.0 50 173.5 51 154.0 52 129.5 53 97.5 54 87.0 55 73.5 56 57.5 57 42.5 58 31.0 59 19.5 60 11.0 61 9.5 62 7.5 63 5.5 64 4.5 65 3.5 66 0.5 67 0.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1411972720384 98.125 2 0.7577671129072998 1.5 3 0.07577671129072998 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.025258903763576663 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.11249999999999999 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.2374999999999998 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.8875000000000002 0.0 0.0 0.0 0.0 106-107 2.3 0.0 0.0 0.0 0.0 108-109 2.6125 0.0 0.0 0.0 0.0 110-111 2.9625 0.0 0.0 0.0 0.0 112-113 3.3375 0.0 0.0 0.0 0.0 114-115 3.9 0.0 0.0 0.0 0.0 116-117 4.4125 0.0 0.0 0.0 0.0 118-119 4.975 0.0 0.0 0.0 0.0 120-121 5.4 0.0 0.0 0.0 0.0 122-123 5.9625 0.0 0.0 0.0 0.0 124-125 6.512499999999999 0.0 0.0 0.0 0.0 126-127 7.0625 0.0 0.0 0.0 0.0 128-129 7.8125 0.0 0.0 0.0 0.0 130-131 8.425 0.0 0.0 0.0 0.0 132-133 8.85 0.0 0.0 0.0 0.0 134-135 9.55 0.0 0.0 0.0 0.0 136-137 10.274999999999999 0.0 0.0 0.0 0.0 138-139 10.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACCTT 10 0.006830828 145.0 2 >>END_MODULE Read 850696 spots for SRR7171059.sra Written 850696 spots for SRR7171059.sra Read 850696 spots for SRR7171059.sra Written 850696 spots for SRR7171059.sra Read 850696 spots for SRR7171059.sra Written 850696 spots for SRR7171059.sra Read 850696 spots for SRR7171059.sra Written 850696 spots for SRR7171059.sra Read 850696 spots for SRR7171059.sra Written 850696 spots for SRR7171059.sra Read 850696 spots for SRR7171059.sra Written 850696 spots for SRR7171059.sra Read 850696 spots for SRR7171059.sra Written 850696 spots for SRR7171059.sra Read 850696 spots for SRR7171059.sra Written 850696 spots for SRR7171059.sra Read 850696 spots for SRR7171059.sra Written 850696 spots for SRR7171059.sra Read 850696 spots for SRR7171059.sra Written 850696 spots for SRR7171059.sra Read 850696 spots for SRR7171059.sra Written 850696 spots for SRR7171059.sra Read 850696 spots for SRR7171059.sra Written 850696 spots for SRR7171059.sra Read 850696 spots for SRR7171059.sra Written 850696 spots for SRR7171059.sra Read 850696 spots for SRR7171059.sra Written 850696 spots for SRR7171059.sra Read 850696 spots for SRR7171059.sra Written 850696 spots for SRR7171059.sra Read 850696 spots for SRR7171059.sra Written 850696 spots for SRR7171059.sra Read 850696 spots for SRR7171059.sra Written 850696 spots for SRR7171059.sra Read 850711 spots for SRR7171059.sra Written 850711 spots for SRR7171059.sra Read 850696 spots for SRR7171059.sra Written 850696 spots for SRR7171059.sra Read 850696 spots for SRR7171059.sra Written 850696 spots for SRR7171059.sra SRR ids: ['SRR7171059.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9350lnu4 SRR7171059.sra spots: 17013935 blocks: [[1, 850696], [850697, 1701392], [1701393, 2552088], [2552089, 3402784], [3402785, 4253480], [4253481, 5104176], [5104177, 5954872], [5954873, 6805568], [6805569, 7656264], [7656265, 8506960], [8506961, 9357656], [9357657, 10208352], [10208353, 11059048], [11059049, 11909744], [11909745, 12760440], [12760441, 13611136], [13611137, 14461832], [14461833, 15312528], [15312529, 16163224], [16163225, 17013935]] SRR7171059 file size 5743763 SRR7171059 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171059 SRR7171059_1.fastq SRR7171059_2.fastq Input file: SRR7171059_1.fastq Paired file: SRR7171059_2.fastq trimmed: SRR7171059-trimmed-pair1.fastq, SRR7171059-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:11:18 2025 >> started Thu Feb 13 23:11:43 2025 >> done (25.360s) 17013935 read pairs processed; of these: 15813 ( 0.09%) short read pairs filtered out after trimming by size control 32445 ( 0.19%) empty read pairs filtered out after trimming by size control 16965677 (99.72%) read pairs available; of these: 9438647 (55.63%) trimmed read pairs available after processing 7527030 (44.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 11 0.00% 20 6 0.00% 21 6 0.00% 22 9 0.00% 23 7 0.00% 24 9 0.00% 25 8 0.00% 26 8 0.00% 27 9 0.00% 28 9 0.00% 29 8 0.00% 30 13 0.00% 31 12 0.00% 32 11 0.00% 33 10 0.00% 34 16 0.00% 35 11 0.00% 36 15 0.00% 37 26 0.00% 38 28 0.00% 39 26 0.00% 40 37 0.00% 41 36 0.00% 42 54 0.00% 43 33 0.00% 44 55 0.00% 45 58 0.00% 46 65 0.00% 47 84 0.00% 48 103 0.00% 49 98 0.00% 50 127 0.00% 51 152 0.00% 52 153 0.00% 53 180 0.00% 54 150 0.00% 55 184 0.00% 56 237 0.00% 57 234 0.00% 58 300 0.00% 59 354 0.00% 60 426 0.00% 61 490 0.00% 62 522 0.00% 63 574 0.00% 64 659 0.00% 65 663 0.00% 66 739 0.00% 67 884 0.01% 68 952 0.01% 69 1079 0.01% 70 1294 0.01% 71 1366 0.01% 72 1719 0.01% 73 1911 0.01% 74 2305 0.01% 75 2705 0.02% 76 3545 0.02% 77 3598 0.02% 78 3117 0.02% 79 3575 0.02% 80 3905 0.02% 81 4488 0.03% 82 4978 0.03% 83 5909 0.03% 84 7332 0.04% 85 8163 0.05% 86 8843 0.05% 87 9563 0.06% 88 10417 0.06% 89 10822 0.06% 90 11555 0.07% 91 12513 0.07% 92 13599 0.08% 93 15100 0.09% 94 16556 0.10% 95 17408 0.10% 96 18554 0.11% 97 19239 0.11% 98 20377 0.12% 99 20910 0.12% 100 22497 0.13% 101 23425 0.14% 102 25348 0.15% 103 26944 0.16% 104 28678 0.17% 105 30923 0.18% 106 32312 0.19% 107 32811 0.19% 108 34177 0.20% 109 35764 0.21% 110 36504 0.22% 111 37202 0.22% 112 39441 0.23% 113 41769 0.25% 114 43161 0.25% 115 45701 0.27% 116 46890 0.28% 117 48146 0.28% 118 48900 0.29% 119 49194 0.29% 120 50900 0.30% 121 52235 0.31% 122 53560 0.32% 123 55828 0.33% 124 57741 0.34% 125 59852 0.35% 126 61699 0.36% 127 63052 0.37% 128 65397 0.39% 129 67041 0.40% 130 68604 0.40% 131 70315 0.41% 132 73180 0.43% 133 76231 0.45% 134 79689 0.47% 135 85017 0.50% 136 88545 0.52% 137 93440 0.55% 138 98510 0.58% 139 105444 0.62% 140 111698 0.66% 141 122450 0.72% 142 133154 0.78% 143 149682 0.88% 144 173678 1.02% 145 205144 1.21% 146 250896 1.48% 147 338894 2.00% 148 493299 2.91% 149 931419 5.49% 150 4096953 24.15% 151 7527030 44.37% 16965677 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=12 prefix-density=0.68 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=77.64 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=10.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=25 prefix-density=0.57 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=45.08 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.2 sequence=AAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7171059 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:12:30 Started mapping on | Feb 13 23:12:37 Finished on | Feb 13 23:15:06 Mapping speed, Million of reads per hour | 409.91 Number of input reads | 16965677 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 15639892 Uniquely mapped reads % | 92.19% Average mapped length | 290.61 Number of splices: Total | 14916692 Number of splices: Annotated (sjdb) | 14594832 Number of splices: GT/AG | 14638108 Number of splices: GC/AG | 211547 Number of splices: AT/AC | 9998 Number of splices: Non-canonical | 57039 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 484382 % of reads mapped to multiple loci | 2.86% Number of reads mapped to too many loci | 45826 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.60% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 857419 857419 857419 N_multimapping 484382 484382 484382 N_noFeature 495936 15370041 577336 N_ambiguous 308648 847 119767 UnstrandedReadsAssigned:14835308 PositiveStrandReadsAssigned:269004 NegativeStrandReadsAssigned:14942789 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7171059 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171059-trimmed-pair1.fastq SRR7171059-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,965,677 reads, 14,940,374 reads pseudoaligned [quant] estimated average fragment length: 219.626 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52401 SRR7171059.ke.tsv 34699 SRR7171059.se.tsv 87100 total ==> SRR7171059.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.37 718 21.0872 Potri.005G024800.1.v4.1 1035 816.374 315 20.391 Potri.004G059700.1.v4.1 961 742.379 16 1.13897 Potri.007G009000.2.v4.1 1416 1197.37 0 0 Potri.003G141000.2.v4.1 2943 2724.37 695.283 13.4869 Potri.016G087400.1.v4.1 270 89.2307 1697 1005.04 Potri.015G069301.1.v4.1 564 347.258 0 0 Potri.010G195200.1.v4.1 1773 1554.37 175 5.94975 Potri.012G127500.1.v4.1 977 758.374 68 4.73851 ==> SRR7171059.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 849 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 489 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 25 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR7171059 completed mapping pipeline successfully