Starting /dee2/code/volunteer_pipeline.sh SRR7171061 current disk space = 3089345236992 free memory = 1580084140 SRR7171061 SRAfilesize 5dc23ae54ed10e465824c0a3620457ca SRR7171061.sra SRR7171061.sra file validated SRR7171061 is paired end SRR7171061 is conventional basespace SRR7171061 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171061_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.68075 27.0 18.0 32.0 18.0 33.0 2 30.81125 31.0 30.0 33.0 27.0 33.0 3 31.82725 33.0 31.0 33.0 29.0 33.0 4 32.168 33.0 33.0 33.0 31.0 34.0 5 32.6295 33.0 33.0 34.0 31.0 34.0 6 36.64175 38.0 37.0 38.0 34.0 38.0 7 37.00625 38.0 38.0 38.0 35.0 38.0 8 37.10975 38.0 38.0 38.0 36.0 38.0 9 37.226 38.0 38.0 38.0 36.0 38.0 10-14 37.3821 38.0 38.0 38.0 37.0 38.0 15-19 37.37975 38.0 38.0 38.0 37.0 38.0 20-24 37.415600000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.08565 38.0 38.0 38.0 35.4 38.0 30-34 37.162850000000006 38.0 38.0 38.0 36.0 38.0 35-39 36.11149999999999 38.0 36.4 38.0 30.8 38.0 40-44 37.19115 38.0 38.0 38.0 36.2 38.0 45-49 36.6836 38.0 37.6 38.0 34.0 38.0 50-54 37.0225 38.0 38.0 38.0 36.0 38.0 55-59 37.075 38.0 38.0 38.0 36.0 38.0 60-64 36.33969999999999 38.0 37.4 38.0 32.6 38.0 65-69 36.0892 38.0 36.6 38.0 30.4 38.0 70-74 36.317449999999994 38.0 37.6 38.0 32.6 38.0 75-79 36.657650000000004 38.0 37.8 38.0 34.4 38.0 80-84 36.5694 38.0 38.0 38.0 34.2 38.0 85-89 35.555499999999995 38.0 36.0 38.0 30.2 38.0 90-94 35.745 38.0 36.2 38.0 31.4 38.0 95-99 34.5318 38.0 34.2 38.0 25.2 38.0 100-104 35.84495 38.0 36.8 38.0 31.6 38.0 105-109 35.8441 38.0 37.0 38.0 32.2 38.0 110-114 34.47130000000001 38.0 34.6 38.0 25.0 38.0 115-119 32.32685 35.8 28.6 38.0 22.6 38.0 120-124 35.003499999999995 38.0 35.4 38.0 28.0 38.0 125-129 34.668600000000005 38.0 34.4 38.0 27.4 38.0 130-134 33.38845 37.6 32.4 38.0 21.4 38.0 135-139 33.688900000000004 38.0 33.0 38.0 23.0 38.0 140-144 32.96 38.0 33.0 38.0 18.4 38.0 145-149 29.493750000000006 35.2 25.0 38.0 7.8 38.0 150-151 25.476125 33.5 16.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 1.0 15 4.0 16 1.0 17 0.0 18 1.0 19 8.0 20 9.0 21 3.0 22 7.0 23 5.0 24 8.0 25 15.0 26 22.0 27 31.0 28 45.0 29 55.0 30 75.0 31 102.0 32 142.0 33 198.0 34 304.0 35 662.0 36 1379.0 37 920.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.377036462373933 11.455908973364364 18.463925523661754 43.70312904059995 2 20.599999999999998 19.7 36.9 22.8 3 19.925 24.099999999999998 25.900000000000002 30.075000000000003 4 22.825 31.974999999999998 22.400000000000002 22.8 5 20.79059294470853 36.5774330748061 24.993745308981737 17.63822867150363 6 17.8 36.1 25.900000000000002 20.200000000000003 7 13.875000000000002 21.525 45.550000000000004 19.05 8 18.4 23.825 30.599999999999998 27.175 9 17.375 23.674999999999997 32.625 26.325 10-14 19.595000000000002 29.49 27.445000000000004 23.47 15-19 19.435 28.38 28.384999999999998 23.799999999999997 20-24 19.215 28.465 28.64 23.68 25-29 19.53 28.535 28.139999999999997 23.794999999999998 30-34 19.52 28.365000000000002 28.305000000000003 23.810000000000002 35-39 20.28804320648097 28.234235135270293 28.284242636395458 23.19347902185328 40-44 19.606960696069606 28.79287928792879 28.422842284228423 23.17731773177318 45-49 19.505 28.794999999999998 27.815 23.885 50-54 19.595000000000002 27.98 28.294999999999998 24.13 55-59 19.445 28.53 28.715000000000003 23.31 60-64 19.895 28.475 28.355000000000004 23.275000000000002 65-69 19.735 28.549999999999997 28.37 23.345 70-74 19.401940194019403 29.092909290929093 28.03780378037804 23.467346734673466 75-79 20.075000000000003 27.865000000000002 28.215 23.845 80-84 19.947992198829827 29.15937390608591 28.324248637295597 22.568385257788666 85-89 20.159071582211997 28.63788704917213 27.627432344555046 23.575609024060828 90-94 19.94199419941994 28.82788278827883 27.747774777477748 23.482348234823483 95-99 20.03 28.444999999999997 27.61 23.915 100-104 20.230057514378593 28.73718429607402 27.631907976994246 23.400850212553138 105-109 20.595 27.985 27.894999999999996 23.525 110-114 19.855 28.76 28.015 23.369999999999997 115-119 20.875 28.645 27.915 22.564999999999998 120-124 20.547054705470547 28.412841284128415 27.95779577957796 23.08230823082308 125-129 20.28804320648097 28.39425913887083 27.71915787368105 23.598539780967144 130-134 20.74 28.555000000000003 26.955000000000002 23.75 135-139 20.122012201220123 28.782878287828783 27.06770677067707 24.027402740274027 140-144 21.013151972795917 28.4742711406711 27.639145871880782 22.873431014652198 145-149 20.445 28.37 27.49 23.695 150-151 20.515386539904927 27.77082812109082 27.52064048036027 24.193144858643983 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 1.0 20 2.5 21 3.0 22 2.5 23 4.5 24 6.0 25 4.0 26 7.5 27 11.0 28 13.0 29 14.5 30 24.5 31 35.5 32 38.0 33 50.0 34 67.5 35 83.0 36 97.0 37 122.5 38 148.5 39 174.5 40 194.0 41 220.0 42 243.0 43 254.5 44 279.0 45 264.5 46 238.5 47 238.5 48 217.5 49 187.0 50 163.0 51 131.0 52 107.0 53 84.5 54 62.0 55 52.0 56 42.0 57 27.0 58 17.0 59 16.5 60 16.5 61 12.0 62 6.5 63 3.5 64 1.5 65 0.5 66 1.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.325 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 0.0 80-84 0.015 85-89 0.045 90-94 0.01 95-99 0.0 100-104 0.025 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.01 125-129 0.015 130-134 0.0 135-139 0.01 140-144 0.015 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77426636568849 99.45 2 0.15048908954100826 0.3 3 0.05016302984700275 0.15 4 0.025081514923501375 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.8999999999999999 0.0 0.0 0.0 0.0 118-119 0.9875 0.0 0.0 0.0 0.0 120-121 1.0750000000000002 0.0 0.0 0.0 0.0 122-123 1.225 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.4249999999999998 0.0 0.0 0.0 0.0 128-129 1.5499999999999998 0.0 0.0 0.0 0.0 130-131 1.9249999999999998 0.0 0.0 0.0 0.0 132-133 2.1500000000000004 0.0 0.0 0.0 0.0 134-135 2.3125 0.0 0.0 0.0 0.0 136-137 2.4625 0.0 0.0 0.0 0.0 138-139 2.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171061 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171061_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9235 33.0 33.0 34.0 32.0 34.0 2 32.9505 34.0 33.0 34.0 32.0 34.0 3 33.11475 34.0 33.0 34.0 32.0 34.0 4 33.08775 34.0 33.0 34.0 32.0 34.0 5 33.05375 34.0 33.0 34.0 32.0 34.0 6 37.28025 38.0 38.0 38.0 37.0 38.0 7 37.27675 38.0 38.0 38.0 37.0 38.0 8 37.3085 38.0 38.0 38.0 37.0 38.0 9 37.2885 38.0 38.0 38.0 37.0 38.0 10-14 37.169200000000004 38.0 38.0 38.0 36.8 38.0 15-19 37.17045 38.0 38.0 38.0 36.8 38.0 20-24 36.760600000000004 38.0 38.0 38.0 34.6 38.0 25-29 37.18005000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.1796 38.0 38.0 38.0 36.8 38.0 35-39 37.1717 38.0 38.0 38.0 37.0 38.0 40-44 37.1077 38.0 38.0 38.0 36.6 38.0 45-49 36.9562 38.0 38.0 38.0 36.0 38.0 50-54 36.99485 38.0 38.0 38.0 36.0 38.0 55-59 36.986900000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.927049999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.99285 38.0 38.0 38.0 36.0 38.0 70-74 36.902649999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.77805 38.0 38.0 38.0 35.2 38.0 80-84 36.65015000000001 38.0 38.0 38.0 35.0 38.0 85-89 36.639300000000006 38.0 38.0 38.0 35.0 38.0 90-94 36.580499999999994 38.0 38.0 38.0 34.4 38.0 95-99 36.459250000000004 38.0 38.0 38.0 34.2 38.0 100-104 36.251349999999995 38.0 37.6 38.0 33.8 38.0 105-109 36.015750000000004 38.0 37.6 38.0 33.2 38.0 110-114 35.908500000000004 38.0 37.0 38.0 32.8 38.0 115-119 35.5518 38.0 37.0 38.0 31.0 38.0 120-124 35.3938 38.0 36.4 38.0 31.0 38.0 125-129 34.978300000000004 38.0 36.0 38.0 28.8 38.0 130-134 34.7089 38.0 36.0 38.0 27.6 38.0 135-139 33.894999999999996 38.0 34.0 38.0 22.8 38.0 140-144 33.0824 38.0 33.0 38.0 18.4 38.0 145-149 31.8913 38.0 32.6 38.0 10.4 38.0 150-151 25.4085 33.0 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 1.0 5 2.0 6 1.0 7 0.0 8 4.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 2.0 15 0.0 16 2.0 17 3.0 18 4.0 19 9.0 20 8.0 21 3.0 22 5.0 23 12.0 24 11.0 25 13.0 26 21.0 27 26.0 28 30.0 29 47.0 30 52.0 31 80.0 32 90.0 33 120.0 34 182.0 35 282.0 36 746.0 37 2237.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.925 15.024999999999999 21.725 33.324999999999996 2 25.174999999999997 21.45 36.5 16.875 3 21.7 24.349999999999998 31.974999999999998 21.975 4 24.6 32.525 23.225 19.650000000000002 5 25.025 34.975 22.475 17.525 6 19.3 37.05 24.25 19.400000000000002 7 18.75 17.974999999999998 43.475 19.8 8 22.175 23.175 28.225 26.424999999999997 9 21.5 23.525 30.25 24.725 10-14 23.369999999999997 28.494999999999997 26.76 21.375 15-19 22.577257725772576 27.847784778477845 28.417841784178417 21.157115711571155 20-24 22.875 28.105000000000004 28.68 20.34 25-29 22.755 28.555000000000003 27.925 20.765 30-34 22.040000000000003 28.095 28.904999999999998 20.96 35-39 22.86 28.175 28.044999999999998 20.919999999999998 40-44 22.509999999999998 28.735 27.800000000000004 20.955 45-49 22.82 28.015 28.689999999999998 20.474999999999998 50-54 22.335 28.449999999999996 28.48 20.735 55-59 22.505 27.205000000000002 29.054999999999996 21.235 60-64 23.215 27.355 28.084999999999997 21.345 65-69 22.43 27.810000000000002 28.32 21.44 70-74 22.994999999999997 27.505000000000003 28.810000000000002 20.69 75-79 23.125 27.735 27.97 21.17 80-84 22.98 28.275 28.189999999999998 20.555 85-89 22.665 28.17 28.08 21.085 90-94 23.119999999999997 27.54 27.77 21.57 95-99 23.275000000000002 27.985 28.305000000000003 20.435 100-104 23.29 27.944999999999997 28.299999999999997 20.465 105-109 23.215 27.91 28.255000000000003 20.62 110-114 22.68 27.99 28.57 20.76 115-119 23.195 28.205000000000002 28.15 20.45 120-124 23.745 28.050000000000004 27.800000000000004 20.405 125-129 23.305 28.139999999999997 28.155 20.4 130-134 24.075 27.88 27.935 20.11 135-139 23.505000000000003 28.595 27.810000000000002 20.09 140-144 24.355 28.050000000000004 27.915 19.68 145-149 23.73 28.470000000000002 27.884999999999998 19.915 150-151 23.29246935201401 27.89592194145609 28.258694020515385 20.55291468601451 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 1.5 20 2.0 21 1.0 22 2.0 23 2.5 24 3.0 25 4.0 26 4.5 27 6.5 28 12.0 29 15.0 30 16.5 31 22.5 32 25.5 33 36.0 34 53.5 35 73.0 36 83.0 37 111.0 38 140.0 39 163.5 40 206.0 41 239.0 42 250.0 43 248.5 44 273.5 45 288.0 46 270.0 47 251.5 48 238.0 49 202.5 50 150.5 51 122.0 52 114.5 53 95.5 54 73.0 55 55.0 56 35.5 57 25.0 58 20.0 59 19.0 60 14.0 61 6.5 62 6.0 63 5.5 64 2.0 65 1.5 66 1.0 67 1.0 68 1.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52165156092649 98.825 2 0.3272910372608258 0.65 3 0.10070493454179255 0.3 4 0.025176233635448138 0.1 5 0.025176233635448138 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.65 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.9 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.1125 0.0 0.0 0.0 0.0 120-121 1.2000000000000002 0.0 0.0 0.0 0.0 122-123 1.35 0.0 0.0 0.0 0.0 124-125 1.4625 0.0 0.0 0.0 0.0 126-127 1.5499999999999998 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 2.075 0.0 0.0 0.0 0.0 132-133 2.3 0.0 0.0 0.0 0.0 134-135 2.45 0.0 0.0 0.0 0.0 136-137 2.575 0.0 0.0 0.0 0.0 138-139 2.7249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGGGCT 10 0.006830828 145.0 6 CAACTCT 10 0.006830828 145.0 3 AACTCTC 10 0.006830828 145.0 4 >>END_MODULE Read 751429 spots for SRR7171061.sra Written 751429 spots for SRR7171061.sra Read 751429 spots for SRR7171061.sra Written 751429 spots for SRR7171061.sra Read 751429 spots for SRR7171061.sra Written 751429 spots for SRR7171061.sra Read 751429 spots for SRR7171061.sra Written 751429 spots for SRR7171061.sra Read 751429 spots for SRR7171061.sra Written 751429 spots for SRR7171061.sra Read 751429 spots for SRR7171061.sra Written 751429 spots for SRR7171061.sra Read 751429 spots for SRR7171061.sra Written 751429 spots for SRR7171061.sra Read 751429 spots for SRR7171061.sra Written 751429 spots for SRR7171061.sra Read 751429 spots for SRR7171061.sra Written 751429 spots for SRR7171061.sra Read 751429 spots for SRR7171061.sra Written 751429 spots for SRR7171061.sra Read 751429 spots for SRR7171061.sra Written 751429 spots for SRR7171061.sra Read 751429 spots for SRR7171061.sra Written 751429 spots for SRR7171061.sra Read 751436 spots for SRR7171061.sra Written 751436 spots for SRR7171061.sra Read 751429 spots for SRR7171061.sra Written 751429 spots for SRR7171061.sra Read 751429 spots for SRR7171061.sra Written 751429 spots for SRR7171061.sra Read 751429 spots for SRR7171061.sra Written 751429 spots for SRR7171061.sra Read 751429 spots for SRR7171061.sra Written 751429 spots for SRR7171061.sra Read 751429 spots for SRR7171061.sra Written 751429 spots for SRR7171061.sra Read 751429 spots for SRR7171061.sra Written 751429 spots for SRR7171061.sra Read 751429 spots for SRR7171061.sra Written 751429 spots for SRR7171061.sra SRR ids: ['SRR7171061.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lw0zuhb7 SRR7171061.sra spots: 15028587 blocks: [[1, 751429], [751430, 1502858], [1502859, 2254287], [2254288, 3005716], [3005717, 3757145], [3757146, 4508574], [4508575, 5260003], [5260004, 6011432], [6011433, 6762861], [6762862, 7514290], [7514291, 8265719], [8265720, 9017148], [9017149, 9768577], [9768578, 10520006], [10520007, 11271435], [11271436, 12022864], [12022865, 12774293], [12774294, 13525722], [13525723, 14277151], [14277152, 15028587]] SRR7171061 file size 5070994 SRR7171061 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171061 SRR7171061_1.fastq SRR7171061_2.fastq Input file: SRR7171061_1.fastq Paired file: SRR7171061_2.fastq trimmed: SRR7171061-trimmed-pair1.fastq, SRR7171061-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:03:32 2025 >> started Thu Feb 13 23:03:47 2025 >> done (15.519s) 15028587 read pairs processed; of these: 10121 ( 0.07%) short read pairs filtered out after trimming by size control 38513 ( 0.26%) empty read pairs filtered out after trimming by size control 14979953 (99.68%) read pairs available; of these: 8665108 (57.84%) trimmed read pairs available after processing 6314845 (42.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 8 0.00% 20 5 0.00% 21 15 0.00% 22 7 0.00% 23 12 0.00% 24 12 0.00% 25 11 0.00% 26 9 0.00% 27 16 0.00% 28 11 0.00% 29 12 0.00% 30 7 0.00% 31 16 0.00% 32 13 0.00% 33 7 0.00% 34 15 0.00% 35 10 0.00% 36 6 0.00% 37 14 0.00% 38 16 0.00% 39 24 0.00% 40 21 0.00% 41 28 0.00% 42 36 0.00% 43 25 0.00% 44 25 0.00% 45 31 0.00% 46 41 0.00% 47 41 0.00% 48 36 0.00% 49 52 0.00% 50 48 0.00% 51 57 0.00% 52 76 0.00% 53 81 0.00% 54 84 0.00% 55 62 0.00% 56 109 0.00% 57 103 0.00% 58 132 0.00% 59 144 0.00% 60 166 0.00% 61 154 0.00% 62 196 0.00% 63 195 0.00% 64 215 0.00% 65 243 0.00% 66 253 0.00% 67 250 0.00% 68 317 0.00% 69 341 0.00% 70 334 0.00% 71 404 0.00% 72 526 0.00% 73 517 0.00% 74 625 0.00% 75 662 0.00% 76 903 0.01% 77 944 0.01% 78 915 0.01% 79 970 0.01% 80 1059 0.01% 81 1220 0.01% 82 1365 0.01% 83 1631 0.01% 84 2155 0.01% 85 2487 0.02% 86 2795 0.02% 87 3186 0.02% 88 3398 0.02% 89 3700 0.02% 90 3865 0.03% 91 4036 0.03% 92 4219 0.03% 93 4418 0.03% 94 4565 0.03% 95 4722 0.03% 96 4896 0.03% 97 5216 0.03% 98 5367 0.04% 99 5609 0.04% 100 5985 0.04% 101 6339 0.04% 102 6661 0.04% 103 6971 0.05% 104 7468 0.05% 105 7895 0.05% 106 8467 0.06% 107 8798 0.06% 108 9117 0.06% 109 9688 0.06% 110 10320 0.07% 111 10560 0.07% 112 11287 0.08% 113 11673 0.08% 114 11985 0.08% 115 12929 0.09% 116 13736 0.09% 117 14078 0.09% 118 14921 0.10% 119 15711 0.10% 120 16532 0.11% 121 17476 0.12% 122 18599 0.12% 123 19588 0.13% 124 20645 0.14% 125 22084 0.15% 126 23576 0.16% 127 25691 0.17% 128 27105 0.18% 129 28959 0.19% 130 31207 0.21% 131 33500 0.22% 132 36656 0.24% 133 40197 0.27% 134 43873 0.29% 135 48206 0.32% 136 53925 0.36% 137 60013 0.40% 138 66722 0.45% 139 75357 0.50% 140 85624 0.57% 141 98171 0.66% 142 112806 0.75% 143 132701 0.89% 144 160272 1.07% 145 198137 1.32% 146 255061 1.70% 147 354211 2.36% 148 561176 3.75% 149 1121610 7.49% 150 4590320 30.64% 151 6314845 42.16% 14979953 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=22 prefix-density=0.38 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=14.64 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=2.0 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCT criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=24 prefix-density=0.43 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=20.42 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.6 sequence=CCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7171061 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:04:33 Started mapping on | Feb 13 23:04:33 Finished on | Feb 13 23:06:23 Mapping speed, Million of reads per hour | 490.25 Number of input reads | 14979953 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13974916 Uniquely mapped reads % | 93.29% Average mapped length | 295.46 Number of splices: Total | 13817765 Number of splices: Annotated (sjdb) | 13512411 Number of splices: GT/AG | 13556793 Number of splices: GC/AG | 205040 Number of splices: AT/AC | 8061 Number of splices: Non-canonical | 47871 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 425505 % of reads mapped to multiple loci | 2.84% Number of reads mapped to too many loci | 61680 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.36% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 593840 593840 593840 N_multimapping 425505 425505 425505 N_noFeature 528121 13796132 581949 N_ambiguous 237086 888 111623 UnstrandedReadsAssigned:13209709 PositiveStrandReadsAssigned:177896 NegativeStrandReadsAssigned:13281344 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7171061 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171061-trimmed-pair1.fastq SRR7171061-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,979,953 reads, 13,220,088 reads pseudoaligned [quant] estimated average fragment length: 271.694 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 977 rounds 52401 SRR7171061.ke.tsv 34699 SRR7171061.se.tsv 87100 total ==> SRR7171061.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.31 807 32.6613 Potri.005G024800.1.v4.1 1035 764.306 201 18.5976 Potri.004G059700.1.v4.1 961 690.322 15 1.53663 Potri.007G009000.2.v4.1 1416 1145.31 0 0 Potri.003G141000.2.v4.1 2943 2672.31 735.412 19.4614 Potri.016G087400.1.v4.1 270 67.3665 995 1044.5 Potri.015G069301.1.v4.1 564 299.815 0 0 Potri.010G195200.1.v4.1 1773 1502.31 158 7.43752 Potri.012G127500.1.v4.1 977 706.311 49 4.90602 ==> SRR7171061.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 935 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 189 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 27 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7171061 completed mapping pipeline successfully