Starting /dee2/code/volunteer_pipeline.sh SRR7171062 current disk space = 3088788406272 free memory = 1468712840 SRR7171062 SRAfilesize 2b8fe7799551e3d869d5e34586b43677 SRR7171062.sra SRR7171062.sra file validated SRR7171062 is paired end SRR7171062 is conventional basespace SRR7171062 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171062_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.322 32.0 25.0 33.0 18.0 33.0 2 27.62525 29.0 25.0 33.0 18.0 33.0 3 30.32975 31.0 29.0 33.0 27.0 33.0 4 31.80975 33.0 31.0 33.0 29.0 33.0 5 32.38075 33.0 33.0 33.0 31.0 34.0 6 36.60325 38.0 37.0 38.0 34.0 38.0 7 36.7655 38.0 37.0 38.0 35.0 38.0 8 37.21925 38.0 38.0 38.0 36.0 38.0 9 35.582 38.0 38.0 38.0 29.0 38.0 10-14 37.2848 38.0 38.0 38.0 36.4 38.0 15-19 37.48205 38.0 38.0 38.0 37.8 38.0 20-24 37.5629 38.0 38.0 38.0 38.0 38.0 25-29 37.573699999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.527 38.0 38.0 38.0 38.0 38.0 35-39 37.49495 38.0 38.0 38.0 37.8 38.0 40-44 37.4612 38.0 38.0 38.0 37.6 38.0 45-49 37.3108 38.0 38.0 38.0 37.0 38.0 50-54 35.986900000000006 38.0 35.6 38.0 31.0 38.0 55-59 37.2253 38.0 38.0 38.0 36.8 38.0 60-64 37.1914 38.0 38.0 38.0 36.6 38.0 65-69 37.181799999999996 38.0 38.0 38.0 36.4 38.0 70-74 37.218399999999995 38.0 38.0 38.0 36.4 38.0 75-79 37.07735 38.0 38.0 38.0 36.2 38.0 80-84 36.3769 38.0 37.8 38.0 33.2 38.0 85-89 36.79725 38.0 38.0 38.0 35.4 38.0 90-94 36.7795 38.0 38.0 38.0 35.0 38.0 95-99 36.736850000000004 38.0 38.0 38.0 34.8 38.0 100-104 36.68515 38.0 38.0 38.0 34.8 38.0 105-109 36.65545 38.0 38.0 38.0 35.0 38.0 110-114 36.24675 38.0 38.0 38.0 33.6 38.0 115-119 36.06400000000001 38.0 37.2 38.0 33.4 38.0 120-124 35.9799 38.0 37.0 38.0 33.2 38.0 125-129 35.681000000000004 38.0 36.8 38.0 31.4 38.0 130-134 34.12235 38.0 33.6 38.0 24.2 38.0 135-139 34.84785 38.0 35.6 38.0 28.8 38.0 140-144 34.396950000000004 38.0 34.8 38.0 27.0 38.0 145-149 33.553399999999996 38.0 33.2 38.0 21.6 38.0 150-151 27.786875000000002 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 2.0 12 0.0 13 0.0 14 2.0 15 1.0 16 2.0 17 2.0 18 5.0 19 5.0 20 2.0 21 3.0 22 3.0 23 5.0 24 5.0 25 12.0 26 13.0 27 27.0 28 17.0 29 31.0 30 41.0 31 49.0 32 87.0 33 116.0 34 160.0 35 330.0 36 937.0 37 2142.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.23016082256789 12.312153967835487 9.438439230160823 39.0192459794358 2 18.629657414353588 17.57939484871218 36.25906476619154 27.53188297074269 3 17.75 22.425 29.175 30.65 4 19.975 31.225 25.624999999999996 23.175 5 21.82182182182182 34.609609609609606 24.724724724724727 18.843843843843842 6 17.75 36.125 25.674999999999997 20.45 7 13.350000000000001 22.975 45.2 18.475 8 16.2 24.075 32.275 27.450000000000003 9 15.950000000000001 24.575 32.225 27.250000000000004 10-14 19.235 30.28 26.889999999999997 23.595 15-19 19.134999999999998 28.815 27.900000000000002 24.15 20-24 19.73 28.749999999999996 27.900000000000002 23.62 25-29 19.744999999999997 29.365000000000002 27.250000000000004 23.64 30-34 19.564999999999998 29.625 27.405 23.405 35-39 20.175 29.005 27.48 23.34 40-44 20.375 29.525000000000002 27.565 22.535 45-49 20.075000000000003 29.555 27.284999999999997 23.085 50-54 20.04 28.794999999999998 27.295 23.87 55-59 20.0 28.360000000000003 28.375 23.265 60-64 19.915 29.015 27.375 23.695 65-69 19.945 28.88 27.584999999999997 23.59 70-74 20.09 28.37 26.884999999999998 24.654999999999998 75-79 20.555 28.525 27.295 23.625 80-84 20.025000000000002 28.79 27.544999999999998 23.64 85-89 19.885 28.910000000000004 27.425 23.78 90-94 20.31 27.805000000000003 27.975 23.91 95-99 20.59 28.625 27.27 23.515 100-104 20.685000000000002 28.865000000000002 26.745 23.705000000000002 105-109 20.880000000000003 29.065 27.05 23.005 110-114 20.945 28.360000000000003 26.979999999999997 23.715 115-119 21.01 29.154999999999998 26.06 23.775 120-124 20.885 28.305000000000003 26.224999999999998 24.585 125-129 20.93 28.999999999999996 26.19 23.880000000000003 130-134 20.755000000000003 29.04 25.765 24.44 135-139 21.615000000000002 28.65 26.08 23.655 140-144 21.16 27.855 26.36 24.625 145-149 21.185000000000002 28.615000000000002 25.840000000000003 24.36 150-151 21.53595590077675 27.83763467802556 26.196441994487596 24.429967426710096 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 1.5 23 3.0 24 4.0 25 4.0 26 7.0 27 10.0 28 17.0 29 27.0 30 33.0 31 39.5 32 46.5 33 60.0 34 80.0 35 93.5 36 106.0 37 129.0 38 151.0 39 165.5 40 171.5 41 180.5 42 204.0 43 216.0 44 222.0 45 234.5 46 236.0 47 225.0 48 224.0 49 212.0 50 178.0 51 143.5 52 122.0 53 105.5 54 81.5 55 68.0 56 58.5 57 43.5 58 29.0 59 22.0 60 16.0 61 8.5 62 5.0 63 3.0 64 1.0 65 0.5 66 1.0 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.175 2 0.025 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.7036095577021 97.075 2 1.0930350788002035 2.15 3 0.12709710218607015 0.375 4 0.0 0.0 5 0.05083884087442806 0.25 6 0.02541942043721403 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 6 0.15 TruSeq Adapter, Index 1 (97% over 36bp) CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.2625 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.425 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.7125 0.0 0.0 0.0 0.0 88-89 0.925 0.0 0.0 0.0 0.0 90-91 1.125 0.0 0.0 0.0 0.0 92-93 1.4874999999999998 0.0 0.0 0.0 0.0 94-95 1.9125 0.0 0.0 0.0 0.0 96-97 2.375 0.0 0.0 0.0 0.0 98-99 2.6500000000000004 0.0 0.0 0.0 0.0 100-101 2.925 0.0 0.0 0.0 0.0 102-103 3.2375 0.0 0.0 0.0 0.0 104-105 3.7125000000000004 0.0 0.0 0.0 0.0 106-107 4.4 0.0 0.0 0.0 0.0 108-109 4.9125 0.0 0.0 0.0 0.0 110-111 5.45 0.0 0.0 0.0 0.0 112-113 5.800000000000001 0.0 0.0 0.0 0.0 114-115 6.2875 0.0 0.0 0.0 0.0 116-117 6.7375 0.0 0.0 0.0 0.0 118-119 7.3 0.0 0.0 0.0 0.0 120-121 7.800000000000001 0.0 0.0 0.0 0.0 122-123 8.275 0.0 0.0 0.0 0.0 124-125 8.925 0.0 0.0 0.0 0.0 126-127 9.4625 0.0 0.0 0.0 0.0 128-129 10.075 0.0 0.0 0.0 0.0 130-131 10.625 0.0 0.0 0.0 0.0 132-133 11.4375 0.0 0.0 0.0 0.0 134-135 12.0875 0.0 0.0 0.0 0.0 136-137 12.975 0.0 0.0 0.0 0.0 138-139 13.725000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAGTT 10 0.0056249425 154.6 1 ACATAGG 10 0.0068396386 144.9375 4 >>END_MODULE SRR7171062 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171062_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.14825 33.0 32.0 34.0 28.0 34.0 2 29.74025 33.0 27.0 34.0 18.0 34.0 3 31.80475 33.0 32.0 34.0 27.0 34.0 4 32.38825 33.0 33.0 34.0 32.0 34.0 5 32.65225 33.0 33.0 34.0 32.0 34.0 6 36.93375 38.0 38.0 38.0 36.0 38.0 7 37.102 38.0 38.0 38.0 37.0 38.0 8 37.09975 38.0 38.0 38.0 37.0 38.0 9 37.03575 38.0 38.0 38.0 37.0 38.0 10-14 37.00995 38.0 38.0 38.0 37.0 38.0 15-19 37.080400000000004 38.0 38.0 38.0 37.0 38.0 20-24 36.05215 38.0 37.4 38.0 30.4 38.0 25-29 36.78645 38.0 37.8 38.0 35.2 38.0 30-34 37.06 38.0 38.0 38.0 37.0 38.0 35-39 37.0683 38.0 38.0 38.0 37.0 38.0 40-44 36.98545 38.0 38.0 38.0 37.0 38.0 45-49 36.59054999999999 38.0 38.0 38.0 34.8 38.0 50-54 36.8951 38.0 38.0 38.0 36.4 38.0 55-59 36.859300000000005 38.0 38.0 38.0 36.2 38.0 60-64 35.898450000000004 38.0 37.0 38.0 30.2 38.0 65-69 36.83875 38.0 38.0 38.0 36.0 38.0 70-74 36.7376 38.0 38.0 38.0 35.8 38.0 75-79 36.7587 38.0 38.0 38.0 36.0 38.0 80-84 34.82555 37.8 34.2 38.0 28.6 38.0 85-89 36.326800000000006 38.0 37.8 38.0 34.4 38.0 90-94 36.471199999999996 38.0 38.0 38.0 34.8 38.0 95-99 36.388549999999995 38.0 38.0 38.0 34.4 38.0 100-104 36.13154999999999 38.0 38.0 38.0 33.6 38.0 105-109 35.2862 38.0 36.8 38.0 28.6 38.0 110-114 34.5089 38.0 35.0 38.0 24.8 38.0 115-119 35.485850000000006 38.0 37.0 38.0 31.0 38.0 120-124 35.21895 38.0 36.6 38.0 30.6 38.0 125-129 34.874700000000004 38.0 36.0 38.0 28.4 38.0 130-134 34.498400000000004 38.0 35.6 38.0 26.6 38.0 135-139 33.85015 38.0 33.8 38.0 23.2 38.0 140-144 32.95865 38.0 33.0 38.0 16.8 38.0 145-149 31.623699999999996 38.0 32.6 38.0 8.4 38.0 150-151 24.858625 32.0 16.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 3.0 4 2.0 5 1.0 6 0.0 7 2.0 8 1.0 9 0.0 10 0.0 11 2.0 12 1.0 13 5.0 14 2.0 15 3.0 16 6.0 17 5.0 18 3.0 19 7.0 20 8.0 21 9.0 22 7.0 23 11.0 24 14.0 25 15.0 26 21.0 27 21.0 28 29.0 29 37.0 30 58.0 31 63.0 32 102.0 33 130.0 34 198.0 35 379.0 36 907.0 37 1929.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.25 21.0 12.25 26.5 2 26.174999999999997 25.2 33.35 15.275 3 20.42042042042042 27.2022022022022 33.30830830830831 19.06906906906907 4 23.775 34.75 22.6 18.875 5 25.2 35.725 23.075000000000003 16.0 6 20.474999999999998 38.35 24.275 16.900000000000002 7 21.4 19.475 39.45 19.675 8 21.45 24.575 28.225 25.75 9 22.35 24.025 29.225 24.4 10-14 24.375 27.83 25.945 21.85 15-19 23.785 28.1 27.105 21.01 20-24 23.415 28.775000000000002 26.97 20.84 25-29 23.485 27.755000000000003 27.91 20.849999999999998 30-34 23.745 28.075 27.815 20.365 35-39 23.75 27.77 28.255000000000003 20.225 40-44 23.810000000000002 27.505000000000003 27.529999999999998 21.154999999999998 45-49 23.330000000000002 28.449999999999996 27.279999999999998 20.94 50-54 23.599999999999998 28.470000000000002 27.29 20.64 55-59 23.965 27.744999999999997 27.655 20.635 60-64 22.5 27.27 28.615000000000002 21.615000000000002 65-69 24.07 27.41 27.77 20.75 70-74 23.56 28.055000000000003 27.560000000000002 20.825 75-79 23.405 27.889999999999997 27.725 20.979999999999997 80-84 24.654999999999998 27.48 27.41 20.455000000000002 85-89 24.15 27.57 27.735 20.544999999999998 90-94 23.385 27.96 27.72 20.935000000000002 95-99 23.995 27.735 28.15 20.119999999999997 100-104 24.625 27.694999999999997 27.415 20.265 105-109 23.79 27.875 27.534999999999997 20.8 110-114 24.474999999999998 28.005000000000003 27.92 19.6 115-119 25.430000000000003 28.09 27.045 19.435 120-124 25.22 28.084999999999997 27.42 19.275000000000002 125-129 25.81 27.639999999999997 26.884999999999998 19.665 130-134 26.040000000000003 27.68 27.235 19.045 135-139 26.07 28.410000000000004 26.424999999999997 19.095000000000002 140-144 26.340000000000003 27.834999999999997 27.305 18.52 145-149 27.015 27.884999999999998 26.27 18.83 150-151 28.170426065162907 28.145363408521302 26.278195488721806 17.406015037593985 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 1.0 23 1.5 24 2.5 25 3.5 26 5.0 27 9.5 28 11.0 29 11.0 30 17.0 31 21.5 32 24.0 33 28.5 34 42.5 35 64.0 36 84.0 37 110.5 38 134.0 39 154.0 40 180.5 41 193.0 42 226.0 43 253.0 44 263.5 45 273.0 46 254.5 47 236.0 48 227.0 49 221.5 50 193.0 51 151.5 52 121.0 53 106.5 54 94.0 55 73.0 56 58.0 57 45.0 58 30.5 59 20.5 60 13.5 61 10.0 62 11.0 63 8.0 64 3.5 65 2.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.1 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.13793103448276 97.75 2 0.5578093306288032 1.0999999999999999 3 0.12677484787018256 0.375 4 0.12677484787018256 0.5 5 0.02535496957403651 0.125 6 0.02535496957403651 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 6 0.15 Illumina Single End PCR Primer 1 (97% over 34bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.32499999999999996 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.8999999999999999 0.0 0.0 0.0 0.0 90-91 1.1 0.0 0.0 0.0 0.0 92-93 1.4625 0.0 0.0 0.0 0.0 94-95 1.85 0.0 0.0 0.0 0.0 96-97 2.2875 0.0 0.0 0.0 0.0 98-99 2.5375 0.0 0.0 0.0 0.0 100-101 2.8 0.0 0.0 0.0 0.0 102-103 3.1 0.0 0.0 0.0 0.0 104-105 3.525 0.0 0.0 0.0 0.0 106-107 4.1625 0.0 0.0 0.0 0.0 108-109 4.6125 0.0 0.0 0.0 0.0 110-111 5.125 0.0 0.0 0.0 0.0 112-113 5.449999999999999 0.0 0.0 0.0 0.0 114-115 5.95 0.0 0.0 0.0 0.0 116-117 6.4125 0.0 0.0 0.0 0.0 118-119 6.9625 0.0 0.0 0.0 0.0 120-121 7.475 0.0 0.0 0.0 0.0 122-123 7.9875 0.0 0.0 0.0 0.0 124-125 8.6375 0.0 0.0 0.0 0.0 126-127 9.2625 0.0 0.0 0.0 0.0 128-129 9.975000000000001 0.0 0.0 0.0 0.0 130-131 10.5625 0.0 0.0 0.0 0.0 132-133 11.3375 0.0 0.0 0.0 0.0 134-135 11.9875 0.0 0.0 0.0 0.0 136-137 12.85 0.0 0.0 0.0 0.0 138-139 13.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATTGAA 10 0.006830828 145.0 5 TCTCTGC 10 0.006830828 145.0 6 >>END_MODULE Read 911296 spots for SRR7171062.sra Written 911296 spots for SRR7171062.sra Read 911296 spots for SRR7171062.sra Written 911296 spots for SRR7171062.sra Read 911296 spots for SRR7171062.sra Written 911296 spots for SRR7171062.sra Read 911296 spots for SRR7171062.sra Written 911296 spots for SRR7171062.sra Read 911296 spots for SRR7171062.sra Written 911296 spots for SRR7171062.sra Read 911296 spots for SRR7171062.sra Written 911296 spots for SRR7171062.sra Read 911296 spots for SRR7171062.sra Written 911296 spots for SRR7171062.sra Read 911296 spots for SRR7171062.sra Written 911296 spots for SRR7171062.sra Read 911296 spots for SRR7171062.sra Written 911296 spots for SRR7171062.sra Read 911296 spots for SRR7171062.sra Written 911296 spots for SRR7171062.sra Read 911296 spots for SRR7171062.sra Written 911296 spots for SRR7171062.sra Read 911305 spots for SRR7171062.sra Written 911305 spots for SRR7171062.sra Read 911296 spots for SRR7171062.sra Written 911296 spots for SRR7171062.sra Read 911296 spots for SRR7171062.sra Written 911296 spots for SRR7171062.sra Read 911296 spots for SRR7171062.sra Written 911296 spots for SRR7171062.sra Read 911296 spots for SRR7171062.sra Written 911296 spots for SRR7171062.sra Read 911296 spots for SRR7171062.sra Written 911296 spots for SRR7171062.sra Read 911296 spots for SRR7171062.sra Written 911296 spots for SRR7171062.sra Read 911296 spots for SRR7171062.sra Written 911296 spots for SRR7171062.sra Read 911296 spots for SRR7171062.sra Written 911296 spots for SRR7171062.sra SRR ids: ['SRR7171062.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_05oukqvc SRR7171062.sra spots: 18225929 blocks: [[1, 911296], [911297, 1822592], [1822593, 2733888], [2733889, 3645184], [3645185, 4556480], [4556481, 5467776], [5467777, 6379072], [6379073, 7290368], [7290369, 8201664], [8201665, 9112960], [9112961, 10024256], [10024257, 10935552], [10935553, 11846848], [11846849, 12758144], [12758145, 13669440], [13669441, 14580736], [14580737, 15492032], [15492033, 16403328], [16403329, 17314624], [17314625, 18225929]] SRR7171062 file size 6154468 SRR7171062 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171062 SRR7171062_1.fastq SRR7171062_2.fastq Input file: SRR7171062_1.fastq Paired file: SRR7171062_2.fastq trimmed: SRR7171062-trimmed-pair1.fastq, SRR7171062-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:35:52 2025 >> started Thu Feb 13 22:36:22 2025 >> done (30.231s) 18225929 read pairs processed; of these: 16560 ( 0.09%) short read pairs filtered out after trimming by size control 52784 ( 0.29%) empty read pairs filtered out after trimming by size control 18156585 (99.62%) read pairs available; of these: 11028884 (60.74%) trimmed read pairs available after processing 7127701 (39.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 8 0.00% 20 16 0.00% 21 9 0.00% 22 14 0.00% 23 23 0.00% 24 17 0.00% 25 23 0.00% 26 24 0.00% 27 22 0.00% 28 27 0.00% 29 35 0.00% 30 38 0.00% 31 36 0.00% 32 45 0.00% 33 50 0.00% 34 48 0.00% 35 54 0.00% 36 73 0.00% 37 73 0.00% 38 95 0.00% 39 108 0.00% 40 137 0.00% 41 132 0.00% 42 156 0.00% 43 138 0.00% 44 148 0.00% 45 217 0.00% 46 245 0.00% 47 254 0.00% 48 318 0.00% 49 338 0.00% 50 376 0.00% 51 463 0.00% 52 513 0.00% 53 567 0.00% 54 563 0.00% 55 642 0.00% 56 664 0.00% 57 753 0.00% 58 871 0.00% 59 1009 0.01% 60 1212 0.01% 61 1365 0.01% 62 1515 0.01% 63 1634 0.01% 64 1778 0.01% 65 1904 0.01% 66 2025 0.01% 67 2308 0.01% 68 2469 0.01% 69 2864 0.02% 70 3233 0.02% 71 3499 0.02% 72 4243 0.02% 73 4659 0.03% 74 5119 0.03% 75 5812 0.03% 76 7775 0.04% 77 8188 0.05% 78 7367 0.04% 79 7795 0.04% 80 8603 0.05% 81 9922 0.05% 82 10858 0.06% 83 12280 0.07% 84 14359 0.08% 85 15451 0.09% 86 16626 0.09% 87 17385 0.10% 88 18595 0.10% 89 19635 0.11% 90 20771 0.11% 91 22096 0.12% 92 23595 0.13% 93 26500 0.15% 94 27314 0.15% 95 29428 0.16% 96 30466 0.17% 97 31115 0.17% 98 31730 0.17% 99 32690 0.18% 100 34876 0.19% 101 35840 0.20% 102 37814 0.21% 103 39772 0.22% 104 41430 0.23% 105 43537 0.24% 106 44404 0.24% 107 45539 0.25% 108 46093 0.25% 109 47850 0.26% 110 48357 0.27% 111 49471 0.27% 112 50576 0.28% 113 53274 0.29% 114 54778 0.30% 115 56665 0.31% 116 57942 0.32% 117 59254 0.33% 118 59927 0.33% 119 61178 0.34% 120 62881 0.35% 121 63597 0.35% 122 65087 0.36% 123 67432 0.37% 124 69396 0.38% 125 71466 0.39% 126 73368 0.40% 127 74959 0.41% 128 77285 0.43% 129 79087 0.44% 130 80275 0.44% 131 82800 0.46% 132 85015 0.47% 133 89476 0.49% 134 93752 0.52% 135 99016 0.55% 136 103414 0.57% 137 110157 0.61% 138 115246 0.63% 139 123112 0.68% 140 129577 0.71% 141 140141 0.77% 142 151303 0.83% 143 167109 0.92% 144 189360 1.04% 145 218916 1.21% 146 268143 1.48% 147 349100 1.92% 148 516898 2.85% 149 1012172 5.57% 150 4725227 26.02% 151 7127701 39.26% 18156585 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=33 prefix-density=0.55 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=71.18 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=10.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=22 prefix-density=0.49 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=44.65 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.5 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAA SRR7171062 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:37:10 Started mapping on | Feb 13 22:37:10 Finished on | Feb 13 22:39:51 Mapping speed, Million of reads per hour | 405.99 Number of input reads | 18156585 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 17002185 Uniquely mapped reads % | 93.64% Average mapped length | 287.96 Number of splices: Total | 15285090 Number of splices: Annotated (sjdb) | 14918188 Number of splices: GT/AG | 14986636 Number of splices: GC/AG | 229095 Number of splices: AT/AC | 10924 Number of splices: Non-canonical | 58435 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 466044 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 44077 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.47% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 707077 707077 707077 N_multimapping 466044 466044 466044 N_noFeature 659889 16634733 781447 N_ambiguous 385081 1230 138541 UnstrandedReadsAssigned:15957215 PositiveStrandReadsAssigned:366222 NegativeStrandReadsAssigned:16082197 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7171062 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171062-trimmed-pair1.fastq SRR7171062-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,156,585 reads, 16,016,669 reads pseudoaligned [quant] estimated average fragment length: 215.472 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR7171062.ke.tsv 34699 SRR7171062.se.tsv 87100 total ==> SRR7171062.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1803.53 450 11.831 Potri.005G024800.1.v4.1 1035 820.528 234 13.5224 Potri.004G059700.1.v4.1 961 746.528 52 3.30284 Potri.007G009000.2.v4.1 1416 1201.53 0 0 Potri.003G141000.2.v4.1 2943 2728.53 820.396 14.2569 Potri.016G087400.1.v4.1 270 93.4897 1125.99 571.085 Potri.015G069301.1.v4.1 564 351.989 0 0 Potri.010G195200.1.v4.1 1773 1558.53 19 0.578055 Potri.012G127500.1.v4.1 977 762.528 171 10.6334 ==> SRR7171062.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 978 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 497 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7171062 completed mapping pipeline successfully