Starting /dee2/code/volunteer_pipeline.sh SRR7171063 current disk space = 3089310289920 free memory = 1580058624 SRR7171063 SRAfilesize bc4df386b0084cfdda15c0d3f2a4210f SRR7171063.sra SRR7171063.sra file validated SRR7171063 is paired end SRR7171063 is conventional basespace SRR7171063 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171063_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.20575 18.0 18.0 18.0 18.0 32.0 2 27.6075 27.0 27.0 29.0 25.0 31.0 3 27.8845 29.0 27.0 31.0 18.0 33.0 4 30.676 31.0 30.0 33.0 27.0 33.0 5 31.657 33.0 32.0 33.0 30.0 33.0 6 32.79575 36.0 31.0 38.0 16.0 38.0 7 36.0845 38.0 36.0 38.0 31.0 38.0 8 36.65775 38.0 37.0 38.0 34.0 38.0 9 37.285 38.0 38.0 38.0 36.0 38.0 10-14 37.37955 38.0 38.0 38.0 36.8 38.0 15-19 37.44245 38.0 38.0 38.0 37.0 38.0 20-24 37.586149999999996 38.0 38.0 38.0 37.8 38.0 25-29 37.5116 38.0 38.0 38.0 37.8 38.0 30-34 37.462450000000004 38.0 38.0 38.0 37.4 38.0 35-39 36.856849999999994 38.0 38.0 38.0 34.8 38.0 40-44 37.3301 38.0 38.0 38.0 37.0 38.0 45-49 37.27714999999999 38.0 38.0 38.0 36.8 38.0 50-54 34.4564 37.0 31.0 38.0 28.4 38.0 55-59 36.244299999999996 37.8 35.8 38.0 33.2 38.0 60-64 37.07315 38.0 38.0 38.0 36.0 38.0 65-69 37.066700000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.90055 38.0 38.0 38.0 35.6 38.0 75-79 36.844849999999994 38.0 38.0 38.0 35.4 38.0 80-84 36.78465 38.0 38.0 38.0 34.8 38.0 85-89 36.612049999999996 38.0 38.0 38.0 34.2 38.0 90-94 36.42345 38.0 38.0 38.0 34.0 38.0 95-99 36.45575 38.0 38.0 38.0 34.0 38.0 100-104 36.280800000000006 38.0 37.2 38.0 34.0 38.0 105-109 36.317750000000004 38.0 37.2 38.0 34.0 38.0 110-114 35.87585 38.0 37.0 38.0 32.4 38.0 115-119 35.700100000000006 38.0 36.6 38.0 31.4 38.0 120-124 35.644850000000005 38.0 36.4 38.0 31.4 38.0 125-129 35.29015 38.0 36.0 38.0 29.8 38.0 130-134 29.145249999999997 31.8 22.6 37.2 17.8 38.0 135-139 33.88815 37.2 34.0 38.0 25.0 38.0 140-144 34.0947 38.0 34.8 38.0 23.6 38.0 145-149 33.16875 38.0 33.0 38.0 20.0 38.0 150-151 28.902124999999998 36.0 24.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 2.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 2.0 15 2.0 16 4.0 17 3.0 18 4.0 19 5.0 20 1.0 21 3.0 22 2.0 23 2.0 24 16.0 25 10.0 26 16.0 27 19.0 28 17.0 29 35.0 30 43.0 31 68.0 32 95.0 33 160.0 34 266.0 35 628.0 36 1630.0 37 962.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.34239869458798 28.74626053848246 8.457982050584716 29.453358716344844 2 22.1055263815954 18.02950737684421 32.808202050512634 27.056764191047762 3 19.725 24.2 28.175 27.900000000000002 4 22.625 31.075000000000003 24.15 22.15 5 22.075 33.725 25.224999999999998 18.975 6 17.45 36.3 24.8 21.45 7 13.850000000000001 23.425 45.375 17.349999999999998 8 16.225 24.224999999999998 31.424999999999997 28.125 9 17.549999999999997 23.225 33.2 26.025 10-14 20.330000000000002 29.685 26.6 23.385 15-19 19.63 28.735 28.26 23.375 20-24 19.39 29.325000000000003 28.015 23.27 25-29 19.665 29.21 27.68 23.445 30-34 18.98 29.494999999999997 28.12 23.405 35-39 20.330000000000002 28.744999999999997 27.87 23.055 40-44 20.150000000000002 28.92 27.275 23.655 45-49 20.175 28.815 27.700000000000003 23.31 50-54 19.865 28.65 28.405 23.080000000000002 55-59 19.8 28.455000000000002 28.134999999999998 23.61 60-64 20.195 28.4 27.775 23.630000000000003 65-69 19.91 28.565 28.075 23.45 70-74 19.88 28.575 27.994999999999997 23.549999999999997 75-79 19.63 29.020000000000003 27.095000000000002 24.255 80-84 20.119999999999997 29.134999999999998 27.250000000000004 23.494999999999997 85-89 20.415 28.910000000000004 27.415 23.26 90-94 20.175 28.349999999999998 27.534999999999997 23.94 95-99 20.32 28.994999999999997 27.605 23.080000000000002 100-104 20.47 29.175 27.16 23.195 105-109 20.46 28.884999999999998 27.185 23.47 110-114 20.91 28.58 27.200000000000003 23.31 115-119 20.555 29.01 27.35 23.085 120-124 20.96 28.23 26.76 24.05 125-129 21.815 28.165000000000003 26.474999999999998 23.544999999999998 130-134 20.84 28.939999999999998 26.465 23.755000000000003 135-139 21.81 28.57 25.679999999999996 23.94 140-144 20.974999999999998 29.160000000000004 26.145000000000003 23.72 145-149 21.34 28.515 26.150000000000002 23.995 150-151 21.15 28.4375 26.775 23.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.5 2 1.5 3 0.5 4 1.5 5 1.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 1.5 18 1.0 19 1.0 20 1.0 21 1.0 22 1.5 23 3.5 24 5.0 25 7.0 26 7.0 27 9.5 28 17.5 29 18.5 30 19.0 31 33.0 32 42.0 33 49.5 34 78.5 35 94.0 36 97.5 37 114.0 38 137.0 39 164.5 40 195.0 41 233.5 42 253.5 43 252.5 44 251.0 45 241.5 46 237.5 47 230.0 48 212.5 49 192.0 50 165.0 51 128.5 52 109.5 53 96.0 54 68.0 55 53.5 56 47.5 57 39.0 58 32.5 59 22.0 60 8.0 61 5.0 62 4.5 63 3.0 64 1.5 65 0.5 66 0.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.075000000000001 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.23750000000000002 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.2125 0.0 0.0 0.0 0.0 100-101 1.45 0.0 0.0 0.0 0.0 102-103 1.675 0.0 0.0 0.0 0.0 104-105 1.8875000000000002 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.575 0.0 0.0 0.0 0.0 110-111 3.0 0.0 0.0 0.0 0.0 112-113 3.2249999999999996 0.0 0.0 0.0 0.0 114-115 3.725 0.0 0.0 0.0 0.0 116-117 4.25 0.0 0.0 0.0 0.0 118-119 4.699999999999999 0.0 0.0 0.0 0.0 120-121 5.0375 0.0 0.0 0.0 0.0 122-123 5.3375 0.0 0.0 0.0 0.0 124-125 5.625 0.0 0.0 0.0 0.0 126-127 5.9375 0.0 0.0 0.0 0.0 128-129 6.375 0.0 0.0 0.0 0.0 130-131 6.8125 0.0 0.0 0.0 0.0 132-133 7.4 0.0 0.0 0.0 0.0 134-135 8.0625 0.0 0.0 0.0 0.0 136-137 8.575 0.0 0.0 0.0 0.0 138-139 9.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGATGT 10 0.006843168 144.91249 6 GCTGATG 10 0.006843168 144.91249 5 CTCATTT 10 0.006843168 144.91249 2 >>END_MODULE SRR7171063 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171063_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78075 33.0 33.0 34.0 32.0 34.0 2 32.78775 33.0 33.0 34.0 32.0 34.0 3 32.683 34.0 33.0 34.0 32.0 34.0 4 32.6845 34.0 33.0 34.0 32.0 34.0 5 32.80025 34.0 33.0 34.0 32.0 34.0 6 36.7585 38.0 38.0 38.0 36.0 38.0 7 35.58075 38.0 38.0 38.0 29.0 38.0 8 36.62075 38.0 38.0 38.0 34.0 38.0 9 36.7375 38.0 38.0 38.0 36.0 38.0 10-14 36.86565 38.0 38.0 38.0 36.0 38.0 15-19 36.814750000000004 38.0 38.0 38.0 35.8 38.0 20-24 36.68695 38.0 38.0 38.0 35.6 38.0 25-29 36.4006 38.0 38.0 38.0 34.0 38.0 30-34 36.73864999999999 38.0 38.0 38.0 35.8 38.0 35-39 36.7177 38.0 38.0 38.0 35.8 38.0 40-44 36.6633 38.0 38.0 38.0 35.6 38.0 45-49 35.28339999999999 38.0 35.4 38.0 29.4 38.0 50-54 36.68405 38.0 38.0 38.0 35.6 38.0 55-59 36.53175 38.0 38.0 38.0 34.8 38.0 60-64 36.56815 38.0 38.0 38.0 35.0 38.0 65-69 36.5198 38.0 38.0 38.0 35.0 38.0 70-74 36.4596 38.0 38.0 38.0 35.0 38.0 75-79 36.41305 38.0 38.0 38.0 34.4 38.0 80-84 36.272400000000005 38.0 38.0 38.0 34.0 38.0 85-89 36.23495 38.0 38.0 38.0 34.0 38.0 90-94 36.09935 38.0 38.0 38.0 33.8 38.0 95-99 36.038850000000004 38.0 38.0 38.0 34.0 38.0 100-104 35.7314 38.0 37.0 38.0 32.0 38.0 105-109 35.539649999999995 38.0 37.0 38.0 31.0 38.0 110-114 33.251400000000004 37.4 32.4 38.0 21.4 38.0 115-119 35.135149999999996 38.0 35.8 38.0 29.2 38.0 120-124 35.0346 38.0 36.0 38.0 29.0 38.0 125-129 34.6849 38.0 35.2 38.0 27.0 38.0 130-134 34.35895000000001 38.0 34.6 38.0 24.8 38.0 135-139 33.8013 38.0 33.2 38.0 22.8 38.0 140-144 33.02425000000001 38.0 33.0 38.0 18.2 38.0 145-149 31.841650000000005 38.0 32.6 38.0 10.8 38.0 150-151 26.536 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 8.0 4 5.0 5 2.0 6 3.0 7 2.0 8 1.0 9 4.0 10 2.0 11 0.0 12 1.0 13 3.0 14 7.0 15 2.0 16 3.0 17 1.0 18 2.0 19 5.0 20 10.0 21 7.0 22 10.0 23 12.0 24 13.0 25 18.0 26 18.0 27 26.0 28 30.0 29 44.0 30 57.0 31 77.0 32 109.0 33 133.0 34 223.0 35 360.0 36 852.0 37 1934.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.075 20.825 11.825 21.275 2 26.625 22.900000000000002 31.374999999999996 19.1 3 21.4 26.3 33.050000000000004 19.25 4 25.237618809404704 33.71685842921461 23.186593296648326 17.858929464732366 5 23.875 36.775000000000006 21.325 18.025 6 20.599999999999998 37.525 23.0 18.875 7 20.75 19.625 38.975 20.65 8 20.825 24.75 27.650000000000002 26.775 9 22.2 25.525 29.049999999999997 23.225 10-14 23.62 28.715000000000003 26.56 21.105 15-19 23.69 28.42 27.375 20.515 20-24 23.03 28.13 27.665 21.175 25-29 23.305 27.845 28.775000000000002 20.075000000000003 30-34 23.69 27.68 28.185 20.445 35-39 23.095 27.944999999999997 27.705000000000002 21.255 40-44 23.155 27.939999999999998 28.13 20.775 45-49 23.56 27.700000000000003 28.27 20.47 50-54 23.125 27.87 28.455000000000002 20.549999999999997 55-59 24.03 27.37 28.015 20.585 60-64 23.044999999999998 28.000000000000004 28.389999999999997 20.565 65-69 23.665 27.810000000000002 27.88 20.645 70-74 23.885 27.544999999999998 27.775 20.794999999999998 75-79 23.285 27.715 27.96 21.04 80-84 23.3 27.689999999999998 27.965 21.044999999999998 85-89 23.755000000000003 27.41 28.07 20.765 90-94 23.66 27.785 27.905 20.65 95-99 23.0 27.68 28.62 20.7 100-104 23.745 28.035 27.88 20.34 105-109 24.205 27.525 28.065 20.205000000000002 110-114 23.169999999999998 28.02 27.939999999999998 20.87 115-119 24.335 27.589999999999996 27.485 20.59 120-124 24.3 27.74 27.665 20.294999999999998 125-129 25.040000000000003 27.905 26.955000000000002 20.1 130-134 24.595 27.779999999999998 27.115000000000002 20.51 135-139 24.88 27.229999999999997 28.139999999999997 19.75 140-144 25.34 26.875 27.655 20.13 145-149 25.330000000000002 27.060000000000002 27.48 20.13 150-151 26.0 28.15 26.5125 19.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 2.0 22 2.5 23 2.5 24 4.0 25 4.5 26 5.0 27 6.5 28 7.0 29 11.0 30 14.5 31 18.0 32 24.0 33 34.5 34 54.0 35 69.0 36 82.0 37 102.0 38 129.5 39 161.5 40 196.0 41 225.0 42 248.5 43 267.5 44 270.0 45 254.0 46 248.0 47 244.5 48 223.0 49 199.5 50 173.5 51 155.5 52 125.5 53 102.0 54 94.0 55 69.0 56 39.0 57 32.0 58 28.0 59 17.5 60 15.5 61 10.0 62 8.0 63 6.0 64 3.5 65 2.5 66 1.5 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26915322580645 98.475 2 0.6804435483870968 1.35 3 0.025201612903225805 0.075 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.23750000000000002 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.4625 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 1.8875000000000002 0.0 0.0 0.0 0.0 106-107 2.175 0.0 0.0 0.0 0.0 108-109 2.4375 0.0 0.0 0.0 0.0 110-111 2.825 0.0 0.0 0.0 0.0 112-113 3.05 0.0 0.0 0.0 0.0 114-115 3.5374999999999996 0.0 0.0 0.0 0.0 116-117 4.0625 0.0 0.0 0.0 0.0 118-119 4.5 0.0 0.0 0.0 0.0 120-121 4.9375 0.0 0.0 0.0 0.0 122-123 5.4 0.0 0.0 0.0 0.0 124-125 5.9375 0.0 0.0 0.0 0.0 126-127 6.637499999999999 0.0 0.0 0.0 0.0 128-129 7.3 0.0 0.0 0.0 0.0 130-131 8.0375 0.0 0.0 0.0 0.0 132-133 8.725 0.0 0.0 0.0 0.0 134-135 9.375 0.0 0.0 0.0 0.0 136-137 9.925 0.0 0.0 0.0 0.0 138-139 10.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGCAAT 10 0.006830828 145.0 1 TTGGAGC 10 0.006830828 145.0 3 TTTTTTT 30 0.0014437955 24.166668 140-144 >>END_MODULE Read 868070 spots for SRR7171063.sra Written 868070 spots for SRR7171063.sra Read 868070 spots for SRR7171063.sra Written 868070 spots for SRR7171063.sra Read 868070 spots for SRR7171063.sra Written 868070 spots for SRR7171063.sra Read 868070 spots for SRR7171063.sra Written 868070 spots for SRR7171063.sra Read 868070 spots for SRR7171063.sra Written 868070 spots for SRR7171063.sra Read 868070 spots for SRR7171063.sra Written 868070 spots for SRR7171063.sra Read 868070 spots for SRR7171063.sra Written 868070 spots for SRR7171063.sra Read 868070 spots for SRR7171063.sra Written 868070 spots for SRR7171063.sra Read 868075 spots for SRR7171063.sra Written 868075 spots for SRR7171063.sra Read 868070 spots for SRR7171063.sra Written 868070 spots for SRR7171063.sra Read 868070 spots for SRR7171063.sra Written 868070 spots for SRR7171063.sra Read 868070 spots for SRR7171063.sra Written 868070 spots for SRR7171063.sra Read 868070 spots for SRR7171063.sra Written 868070 spots for SRR7171063.sra Read 868070 spots for SRR7171063.sra Written 868070 spots for SRR7171063.sra Read 868070 spots for SRR7171063.sra Written 868070 spots for SRR7171063.sra Read 868070 spots for SRR7171063.sra Written 868070 spots for SRR7171063.sra Read 868070 spots for SRR7171063.sra Written 868070 spots for SRR7171063.sra Read 868070 spots for SRR7171063.sra Written 868070 spots for SRR7171063.sra Read 868070 spots for SRR7171063.sra Written 868070 spots for SRR7171063.sra Read 868070 spots for SRR7171063.sra Written 868070 spots for SRR7171063.sra SRR ids: ['SRR7171063.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5tcfsbki SRR7171063.sra spots: 17361405 blocks: [[1, 868070], [868071, 1736140], [1736141, 2604210], [2604211, 3472280], [3472281, 4340350], [4340351, 5208420], [5208421, 6076490], [6076491, 6944560], [6944561, 7812630], [7812631, 8680700], [8680701, 9548770], [9548771, 10416840], [10416841, 11284910], [11284911, 12152980], [12152981, 13021050], [13021051, 13889120], [13889121, 14757190], [14757191, 15625260], [15625261, 16493330], [16493331, 17361405]] SRR7171063 file size 5861510 SRR7171063 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171063 SRR7171063_1.fastq SRR7171063_2.fastq Input file: SRR7171063_1.fastq Paired file: SRR7171063_2.fastq trimmed: SRR7171063-trimmed-pair1.fastq, SRR7171063-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:16:27 2025 >> started Thu Feb 13 23:16:53 2025 >> done (25.971s) 17361405 read pairs processed; of these: 25702 ( 0.15%) short read pairs filtered out after trimming by size control 36455 ( 0.21%) empty read pairs filtered out after trimming by size control 17299248 (99.64%) read pairs available; of these: 9995727 (57.78%) trimmed read pairs available after processing 7303521 (42.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 9 0.00% 20 16 0.00% 21 10 0.00% 22 15 0.00% 23 17 0.00% 24 15 0.00% 25 15 0.00% 26 21 0.00% 27 20 0.00% 28 12 0.00% 29 10 0.00% 30 27 0.00% 31 15 0.00% 32 12 0.00% 33 14 0.00% 34 10 0.00% 35 28 0.00% 36 16 0.00% 37 29 0.00% 38 44 0.00% 39 24 0.00% 40 28 0.00% 41 37 0.00% 42 48 0.00% 43 36 0.00% 44 45 0.00% 45 62 0.00% 46 80 0.00% 47 90 0.00% 48 92 0.00% 49 133 0.00% 50 153 0.00% 51 167 0.00% 52 160 0.00% 53 180 0.00% 54 193 0.00% 55 234 0.00% 56 233 0.00% 57 275 0.00% 58 301 0.00% 59 358 0.00% 60 430 0.00% 61 508 0.00% 62 536 0.00% 63 581 0.00% 64 667 0.00% 65 719 0.00% 66 770 0.00% 67 827 0.00% 68 974 0.01% 69 1136 0.01% 70 1330 0.01% 71 1514 0.01% 72 1769 0.01% 73 1962 0.01% 74 2168 0.01% 75 2524 0.01% 76 3025 0.02% 77 3349 0.02% 78 3151 0.02% 79 3435 0.02% 80 3894 0.02% 81 4437 0.03% 82 5125 0.03% 83 5798 0.03% 84 7648 0.04% 85 8610 0.05% 86 9510 0.05% 87 10434 0.06% 88 11258 0.07% 89 11695 0.07% 90 12337 0.07% 91 13084 0.08% 92 14102 0.08% 93 15357 0.09% 94 16323 0.09% 95 17689 0.10% 96 18374 0.11% 97 18944 0.11% 98 19679 0.11% 99 20988 0.12% 100 22616 0.13% 101 23739 0.14% 102 25680 0.15% 103 27419 0.16% 104 29175 0.17% 105 30666 0.18% 106 31988 0.18% 107 33106 0.19% 108 33973 0.20% 109 35717 0.21% 110 36703 0.21% 111 38600 0.22% 112 40887 0.24% 113 42693 0.25% 114 44121 0.26% 115 46621 0.27% 116 47622 0.28% 117 49054 0.28% 118 49553 0.29% 119 50712 0.29% 120 52320 0.30% 121 53872 0.31% 122 55353 0.32% 123 57982 0.34% 124 60209 0.35% 125 61993 0.36% 126 64037 0.37% 127 65884 0.38% 128 67542 0.39% 129 69832 0.40% 130 71295 0.41% 131 73271 0.42% 132 76898 0.44% 133 81178 0.47% 134 84455 0.49% 135 89550 0.52% 136 94063 0.54% 137 99043 0.57% 138 104599 0.60% 139 112241 0.65% 140 119240 0.69% 141 130583 0.75% 142 144589 0.84% 143 165005 0.95% 144 190776 1.10% 145 228136 1.32% 146 283779 1.64% 147 380289 2.20% 148 570585 3.30% 149 1070781 6.19% 150 4195747 24.25% 151 7303521 42.22% 17299248 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=21 prefix-density=0.62 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=238.64 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=15.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=24 prefix-density=0.45 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=40.47 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.3 sequence=CCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7171063 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:17:37 Started mapping on | Feb 13 23:17:38 Finished on | Feb 13 23:19:31 Mapping speed, Million of reads per hour | 551.13 Number of input reads | 17299248 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16225052 Uniquely mapped reads % | 93.79% Average mapped length | 290.32 Number of splices: Total | 14826181 Number of splices: Annotated (sjdb) | 14504874 Number of splices: GT/AG | 14537995 Number of splices: GC/AG | 232740 Number of splices: AT/AC | 9121 Number of splices: Non-canonical | 46325 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 436624 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 55930 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.28% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 665769 665769 665769 N_multimapping 436624 436624 436624 N_noFeature 596897 15952747 696439 N_ambiguous 285508 1054 112321 UnstrandedReadsAssigned:15342647 PositiveStrandReadsAssigned:271251 NegativeStrandReadsAssigned:15416292 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7171063 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171063-trimmed-pair1.fastq SRR7171063-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,299,248 reads, 15,372,303 reads pseudoaligned [quant] estimated average fragment length: 227.24 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52401 SRR7171063.ke.tsv 34699 SRR7171063.se.tsv 87100 total ==> SRR7171063.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.76 590 19.975 Potri.005G024800.1.v4.1 1035 808.76 173 12.976 Potri.004G059700.1.v4.1 961 734.784 22 1.81626 Potri.007G009000.2.v4.1 1416 1189.76 0 0 Potri.003G141000.2.v4.1 2943 2716.76 954.167 21.3053 Potri.016G087400.1.v4.1 270 90.3859 931.051 624.866 Potri.015G069301.1.v4.1 564 342.115 0 0 Potri.010G195200.1.v4.1 1773 1546.76 46 1.80405 Potri.012G127500.1.v4.1 977 750.77 89 7.19113 ==> SRR7171063.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1180 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 379 Potri.001G212900.v4.1 32 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 23 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 5 SRR7171063 completed mapping pipeline successfully