Starting /dee2/code/volunteer_pipeline.sh SRR7171064 current disk space = 3088926498816 free memory = 1430424564 SRR7171064 SRAfilesize 90beb84126d5469a85e403db287264f1 SRR7171064.sra SRR7171064.sra file validated SRR7171064 is paired end SRR7171064 is conventional basespace SRR7171064 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171064_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.74225 25.0 18.0 32.0 18.0 33.0 2 24.9725 25.0 18.0 29.0 18.0 33.0 3 28.8755 29.0 27.0 31.0 25.0 33.0 4 31.04525 31.0 30.0 33.0 29.0 33.0 5 31.91625 33.0 31.0 33.0 29.0 33.0 6 36.47975 38.0 37.0 38.0 34.0 38.0 7 37.07075 38.0 38.0 38.0 35.0 38.0 8 37.49425 38.0 38.0 38.0 37.0 38.0 9 36.12175 38.0 38.0 38.0 32.0 38.0 10-14 37.49905 38.0 38.0 38.0 37.4 38.0 15-19 37.642700000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.6525 38.0 38.0 38.0 38.0 38.0 25-29 37.6246 38.0 38.0 38.0 38.0 38.0 30-34 37.59165 38.0 38.0 38.0 38.0 38.0 35-39 37.57305 38.0 38.0 38.0 38.0 38.0 40-44 37.550349999999995 38.0 38.0 38.0 38.0 38.0 45-49 37.43145 38.0 38.0 38.0 37.8 38.0 50-54 36.0753 38.0 35.6 38.0 31.0 38.0 55-59 37.2986 38.0 38.0 38.0 37.0 38.0 60-64 37.320750000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.31135 38.0 38.0 38.0 37.0 38.0 70-74 37.2886 38.0 38.0 38.0 37.0 38.0 75-79 37.1789 38.0 38.0 38.0 36.8 38.0 80-84 36.586200000000005 38.0 38.0 38.0 34.0 38.0 85-89 36.90475 38.0 38.0 38.0 36.0 38.0 90-94 36.912600000000005 38.0 38.0 38.0 36.0 38.0 95-99 36.87925 38.0 38.0 38.0 35.8 38.0 100-104 36.86194999999999 38.0 38.0 38.0 35.6 38.0 105-109 36.805400000000006 38.0 38.0 38.0 35.4 38.0 110-114 36.41955 38.0 38.0 38.0 34.0 38.0 115-119 36.2951 38.0 38.0 38.0 34.0 38.0 120-124 36.14135 38.0 37.4 38.0 33.4 38.0 125-129 35.87015 38.0 36.8 38.0 32.0 38.0 130-134 34.2552 38.0 34.0 38.0 24.8 38.0 135-139 35.05435000000001 38.0 36.0 38.0 30.4 38.0 140-144 34.783 38.0 35.8 38.0 28.0 38.0 145-149 34.101549999999996 38.0 34.8 38.0 26.0 38.0 150-151 28.651 34.5 17.5 37.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 3.0 10 0.0 11 1.0 12 0.0 13 2.0 14 1.0 15 1.0 16 0.0 17 2.0 18 5.0 19 5.0 20 3.0 21 2.0 22 4.0 23 5.0 24 4.0 25 7.0 26 10.0 27 17.0 28 12.0 29 21.0 30 36.0 31 45.0 32 58.0 33 90.0 34 144.0 35 287.0 36 1077.0 37 2155.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.752663029358274 14.367368147570797 8.05404001039231 29.82592881267862 2 22.605651412853213 16.92923230807702 36.25906476619154 24.20605151287822 3 18.275 24.275 28.125 29.325000000000003 4 21.85 31.25 25.15 21.75 5 20.490367775831874 36.50237678258694 24.36827620715537 18.638979234425822 6 17.25 35.85 26.474999999999998 20.424999999999997 7 14.05 23.275000000000002 45.25 17.424999999999997 8 16.275000000000002 24.825 32.975 25.924999999999997 9 16.3 25.45 33.300000000000004 24.95 10-14 19.939999999999998 29.709999999999997 26.775 23.575 15-19 19.689999999999998 29.104999999999997 27.38 23.825 20-24 19.355 29.599999999999998 27.485 23.56 25-29 19.845 29.535 27.24 23.380000000000003 30-34 19.215 29.985 27.62 23.18 35-39 20.025000000000002 29.23 27.975 22.770000000000003 40-44 20.18201820182018 28.69286928692869 28.112811281128113 23.01230123012301 45-49 19.935 28.294999999999998 27.73 24.04 50-54 19.67 29.349999999999998 27.38 23.599999999999998 55-59 20.665 28.634999999999998 27.6 23.1 60-64 19.869999999999997 28.865000000000002 27.700000000000003 23.565 65-69 20.07 28.444999999999997 28.24 23.244999999999997 70-74 20.424999999999997 29.32 27.18 23.075000000000003 75-79 20.29 29.044999999999998 27.48 23.185 80-84 20.080000000000002 28.78 27.12 24.02 85-89 20.275000000000002 28.67 27.060000000000002 23.995 90-94 20.075000000000003 28.689999999999998 27.935 23.3 95-99 20.695 28.57 27.445000000000004 23.29 100-104 20.36 28.71 27.650000000000002 23.28 105-109 20.18 28.389999999999997 27.889999999999997 23.54 110-114 20.705000000000002 28.18 27.465 23.65 115-119 21.035 28.765 26.685 23.515 120-124 20.765 29.005 26.779999999999998 23.45 125-129 21.45 28.09 27.339999999999996 23.119999999999997 130-134 21.185000000000002 28.139999999999997 26.555 24.12 135-139 21.310000000000002 28.33 26.3 24.060000000000002 140-144 21.365000000000002 28.355000000000004 26.224999999999998 24.055 145-149 21.145 28.43 26.474999999999998 23.95 150-151 21.150719199499687 28.030018761726076 26.479049405878673 24.34021263289556 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 1.5 18 1.5 19 0.0 20 0.5 21 1.5 22 1.5 23 3.0 24 6.5 25 7.5 26 7.5 27 7.0 28 10.5 29 17.5 30 31.5 31 44.0 32 52.5 33 57.5 34 70.5 35 83.0 36 108.5 37 142.5 38 146.5 39 168.5 40 190.0 41 208.0 42 228.5 43 221.5 44 229.5 45 238.5 46 224.0 47 219.5 48 215.5 49 188.5 50 158.0 51 137.0 52 115.5 53 95.5 54 91.5 55 80.5 56 55.5 57 45.0 58 29.5 59 13.0 60 14.0 61 11.0 62 4.0 63 3.5 64 2.0 65 1.0 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.775 2 0.025 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9620253164557 97.725 2 0.8860759493670887 1.7500000000000002 3 0.12658227848101267 0.375 4 0.0 0.0 5 0.0 0.0 6 0.025316455696202535 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.2875 0.0 0.0 0.0 0.0 100-101 1.4875 0.0 0.0 0.0 0.0 102-103 1.6875 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.1875 0.0 0.0 0.0 0.0 108-109 2.5375 0.0 0.0 0.0 0.0 110-111 2.8499999999999996 0.0 0.0 0.0 0.0 112-113 3.225 0.0 0.0 0.0 0.0 114-115 3.7 0.0 0.0 0.0 0.0 116-117 4.0 0.0 0.0 0.0 0.0 118-119 4.5 0.0 0.0 0.0 0.0 120-121 4.925 0.0 0.0 0.0 0.0 122-123 5.4 0.0 0.0 0.0 0.0 124-125 5.8125 0.0 0.0 0.0 0.0 126-127 6.137499999999999 0.0 0.0 0.0 0.0 128-129 6.512499999999999 0.0 0.0 0.0 0.0 130-131 7.1875 0.0 0.0 0.0 0.0 132-133 8.0125 0.0 0.0 0.0 0.0 134-135 8.8625 0.0 0.0 0.0 0.0 136-137 9.537500000000001 0.0 0.0 0.0 0.0 138-139 10.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCATA 10 0.0068343505 144.975 9 >>END_MODULE SRR7171064 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171064_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2965 33.0 32.0 34.0 30.0 34.0 2 30.067 33.0 28.0 34.0 18.0 34.0 3 31.97275 33.0 32.0 34.0 27.0 34.0 4 32.45675 33.0 33.0 34.0 32.0 34.0 5 32.73975 33.0 33.0 34.0 32.0 34.0 6 37.01125 38.0 38.0 38.0 36.0 38.0 7 37.203 38.0 38.0 38.0 37.0 38.0 8 37.175 38.0 38.0 38.0 37.0 38.0 9 37.09 38.0 38.0 38.0 37.0 38.0 10-14 37.01425 38.0 38.0 38.0 37.0 38.0 15-19 37.0695 38.0 38.0 38.0 37.0 38.0 20-24 36.019549999999995 38.0 37.6 38.0 31.4 38.0 25-29 36.83325 38.0 38.0 38.0 35.4 38.0 30-34 37.08635 38.0 38.0 38.0 37.0 38.0 35-39 37.0807 38.0 38.0 38.0 37.0 38.0 40-44 36.947700000000005 38.0 38.0 38.0 36.8 38.0 45-49 36.40185 38.0 37.8 38.0 33.8 38.0 50-54 36.94865 38.0 38.0 38.0 36.8 38.0 55-59 36.825599999999994 38.0 38.0 38.0 36.0 38.0 60-64 35.82545 38.0 37.0 38.0 30.2 38.0 65-69 36.73915 38.0 38.0 38.0 36.0 38.0 70-74 36.73965 38.0 38.0 38.0 36.0 38.0 75-79 36.71765 38.0 38.0 38.0 36.0 38.0 80-84 35.0413 38.0 34.8 38.0 29.0 38.0 85-89 36.295550000000006 38.0 37.8 38.0 34.4 38.0 90-94 36.41375 38.0 38.0 38.0 34.8 38.0 95-99 36.3093 38.0 38.0 38.0 34.6 38.0 100-104 36.0701 38.0 38.0 38.0 33.8 38.0 105-109 35.183350000000004 38.0 36.6 38.0 28.8 38.0 110-114 34.09555 38.0 34.4 38.0 23.6 38.0 115-119 35.37105 38.0 37.0 38.0 31.0 38.0 120-124 35.1359 38.0 36.6 38.0 30.6 38.0 125-129 34.85165 38.0 36.0 38.0 28.4 38.0 130-134 34.4129 38.0 35.8 38.0 26.8 38.0 135-139 33.75395 38.0 34.0 38.0 22.2 38.0 140-144 32.78375 38.0 33.0 38.0 15.2 38.0 145-149 31.6684 38.0 32.6 38.0 8.4 38.0 150-151 25.190125000000002 32.0 16.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 7.0 4 2.0 5 3.0 6 1.0 7 0.0 8 1.0 9 2.0 10 2.0 11 0.0 12 5.0 13 4.0 14 3.0 15 3.0 16 7.0 17 4.0 18 3.0 19 8.0 20 10.0 21 6.0 22 10.0 23 12.0 24 15.0 25 10.0 26 22.0 27 28.0 28 32.0 29 44.0 30 43.0 31 69.0 32 79.0 33 130.0 34 176.0 35 350.0 36 985.0 37 1908.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.3 20.75 11.600000000000001 23.35 2 26.825 24.55 32.074999999999996 16.55 3 21.48037009252313 26.731682920730183 32.83320830207552 18.95473868467117 4 24.0 34.050000000000004 22.775000000000002 19.175 5 23.1 37.325 23.175 16.400000000000002 6 19.975 38.025 23.5 18.5 7 20.474999999999998 19.275000000000002 38.9 21.349999999999998 8 20.8 25.174999999999997 27.575 26.450000000000003 9 20.275000000000002 25.4 29.875 24.45 10-14 24.0 28.735 25.650000000000002 21.615000000000002 15-19 23.35 28.305000000000003 27.48 20.865000000000002 20-24 23.21 27.54 28.139999999999997 21.11 25-29 23.28 28.294999999999998 27.634999999999998 20.79 30-34 23.415 28.04 27.6 20.945 35-39 22.85 28.155 27.800000000000004 21.195 40-44 23.064999999999998 28.03 28.000000000000004 20.905 45-49 23.315 28.165000000000003 27.97 20.549999999999997 50-54 23.025000000000002 28.565 27.27 21.14 55-59 23.1 28.1 27.955000000000002 20.845 60-64 23.064999999999998 27.555000000000003 28.15 21.23 65-69 23.3 27.189999999999998 28.585 20.925 70-74 23.474999999999998 27.889999999999997 27.98 20.655 75-79 23.34 27.36 28.065 21.235 80-84 23.98 27.505000000000003 27.455000000000002 21.060000000000002 85-89 23.835 27.215 28.16 20.79 90-94 23.46 28.050000000000004 27.634999999999998 20.855 95-99 23.705000000000002 27.68 28.265 20.349999999999998 100-104 24.044999999999998 27.750000000000004 27.46 20.745 105-109 23.974999999999998 27.810000000000002 28.16 20.055 110-114 23.93 27.955000000000002 27.815 20.3 115-119 24.240000000000002 28.185 27.639999999999997 19.935 120-124 24.205 28.875 26.825 20.095 125-129 24.84 27.88 27.58 19.7 130-134 25.145 28.455000000000002 26.86 19.54 135-139 25.19 27.705000000000002 27.115000000000002 19.99 140-144 25.275 27.839999999999996 27.26 19.625 145-149 25.540000000000003 27.575 27.025 19.86 150-151 26.504065040650403 27.517198248905565 26.40400250156348 19.57473420888055 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 1.0 23 2.0 24 2.0 25 2.0 26 4.5 27 6.5 28 5.0 29 6.0 30 15.5 31 27.0 32 34.0 33 38.0 34 49.0 35 72.5 36 85.5 37 100.0 38 132.0 39 165.0 40 186.0 41 202.0 42 222.0 43 247.5 44 262.5 45 260.5 46 260.0 47 244.5 48 242.5 49 213.5 50 179.5 51 158.0 52 122.5 53 102.0 54 87.0 55 74.0 56 55.0 57 39.5 58 21.0 59 15.0 60 15.0 61 11.5 62 10.0 63 4.5 64 2.5 65 2.5 66 1.5 67 1.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3198992443325 98.575 2 0.6297229219143577 1.25 3 0.025188916876574305 0.075 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.175 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.5125 0.0 0.0 0.0 0.0 102-103 1.7125 0.0 0.0 0.0 0.0 104-105 1.9 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.55 0.0 0.0 0.0 0.0 110-111 2.8 0.0 0.0 0.0 0.0 112-113 3.2125000000000004 0.0 0.0 0.0 0.0 114-115 3.6875 0.0 0.0 0.0 0.0 116-117 4.0 0.0 0.0 0.0 0.0 118-119 4.425000000000001 0.0 0.0 0.0 0.0 120-121 4.9 0.0 0.0 0.0 0.0 122-123 5.4875 0.0 0.0 0.0 0.0 124-125 5.887499999999999 0.0 0.0 0.0 0.0 126-127 6.300000000000001 0.0 0.0 0.0 0.0 128-129 6.7125 0.0 0.0 0.0 0.0 130-131 7.425000000000001 0.0 0.0 0.0 0.0 132-133 8.2125 0.0 0.0 0.0 0.0 134-135 9.075 0.0 0.0 0.0 0.0 136-137 9.75 0.0 0.0 0.0 0.0 138-139 10.350000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTGCC 10 0.006830828 145.0 6 >>END_MODULE Read 919828 spots for SRR7171064.sra Written 919828 spots for SRR7171064.sra Read 919828 spots for SRR7171064.sra Written 919828 spots for SRR7171064.sra Read 919828 spots for SRR7171064.sra Written 919828 spots for SRR7171064.sra Read 919828 spots for SRR7171064.sra Written 919828 spots for SRR7171064.sra Read 919828 spots for SRR7171064.sra Written 919828 spots for SRR7171064.sra Read 919828 spots for SRR7171064.sra Written 919828 spots for SRR7171064.sra Read 919828 spots for SRR7171064.sra Written 919828 spots for SRR7171064.sra Read 919828 spots for SRR7171064.sra Written 919828 spots for SRR7171064.sra Read 919828 spots for SRR7171064.sra Written 919828 spots for SRR7171064.sra Read 919828 spots for SRR7171064.sra Written 919828 spots for SRR7171064.sra Read 919828 spots for SRR7171064.sra Written 919828 spots for SRR7171064.sra Read 919828 spots for SRR7171064.sra Written 919828 spots for SRR7171064.sra Read 919828 spots for SRR7171064.sra Written 919828 spots for SRR7171064.sra Read 919828 spots for SRR7171064.sra Written 919828 spots for SRR7171064.sra Read 919828 spots for SRR7171064.sra Written 919828 spots for SRR7171064.sra Read 919828 spots for SRR7171064.sra Written 919828 spots for SRR7171064.sra Read 919828 spots for SRR7171064.sra Written 919828 spots for SRR7171064.sra Read 919828 spots for SRR7171064.sra Written 919828 spots for SRR7171064.sra Read 919828 spots for SRR7171064.sra Written 919828 spots for SRR7171064.sra Read 919831 spots for SRR7171064.sra Written 919831 spots for SRR7171064.sra SRR ids: ['SRR7171064.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vb8i8eky SRR7171064.sra spots: 18396563 blocks: [[1, 919828], [919829, 1839656], [1839657, 2759484], [2759485, 3679312], [3679313, 4599140], [4599141, 5518968], [5518969, 6438796], [6438797, 7358624], [7358625, 8278452], [8278453, 9198280], [9198281, 10118108], [10118109, 11037936], [11037937, 11957764], [11957765, 12877592], [12877593, 13797420], [13797421, 14717248], [14717249, 15637076], [15637077, 16556904], [16556905, 17476732], [17476733, 18396563]] SRR7171064 file size 6212291 SRR7171064 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171064 SRR7171064_1.fastq SRR7171064_2.fastq Input file: SRR7171064_1.fastq Paired file: SRR7171064_2.fastq trimmed: SRR7171064-trimmed-pair1.fastq, SRR7171064-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:43:52 2025 >> started Thu Feb 13 22:44:12 2025 >> done (20.030s) 18396563 read pairs processed; of these: 22073 ( 0.12%) short read pairs filtered out after trimming by size control 53333 ( 0.29%) empty read pairs filtered out after trimming by size control 18321157 (99.59%) read pairs available; of these: 10977509 (59.92%) trimmed read pairs available after processing 7343648 (40.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 11 0.00% 20 19 0.00% 21 16 0.00% 22 9 0.00% 23 10 0.00% 24 20 0.00% 25 14 0.00% 26 16 0.00% 27 13 0.00% 28 24 0.00% 29 16 0.00% 30 25 0.00% 31 24 0.00% 32 27 0.00% 33 29 0.00% 34 22 0.00% 35 28 0.00% 36 33 0.00% 37 31 0.00% 38 43 0.00% 39 45 0.00% 40 58 0.00% 41 58 0.00% 42 66 0.00% 43 58 0.00% 44 63 0.00% 45 97 0.00% 46 102 0.00% 47 100 0.00% 48 149 0.00% 49 155 0.00% 50 185 0.00% 51 209 0.00% 52 202 0.00% 53 263 0.00% 54 274 0.00% 55 279 0.00% 56 317 0.00% 57 388 0.00% 58 376 0.00% 59 433 0.00% 60 515 0.00% 61 610 0.00% 62 626 0.00% 63 813 0.00% 64 860 0.00% 65 884 0.00% 66 980 0.01% 67 1165 0.01% 68 1219 0.01% 69 1416 0.01% 70 1684 0.01% 71 1879 0.01% 72 2158 0.01% 73 2527 0.01% 74 2807 0.02% 75 3247 0.02% 76 4284 0.02% 77 5334 0.03% 78 4956 0.03% 79 4860 0.03% 80 5142 0.03% 81 5850 0.03% 82 6569 0.04% 83 7381 0.04% 84 9285 0.05% 85 10132 0.06% 86 10999 0.06% 87 12001 0.07% 88 12699 0.07% 89 13542 0.07% 90 14350 0.08% 91 15753 0.09% 92 16800 0.09% 93 18597 0.10% 94 19817 0.11% 95 21119 0.12% 96 21707 0.12% 97 22890 0.12% 98 23572 0.13% 99 24964 0.14% 100 26422 0.14% 101 27472 0.15% 102 29283 0.16% 103 30844 0.17% 104 32611 0.18% 105 34866 0.19% 106 35882 0.20% 107 36764 0.20% 108 37669 0.21% 109 39444 0.22% 110 40530 0.22% 111 41712 0.23% 112 43657 0.24% 113 45743 0.25% 114 47257 0.26% 115 49731 0.27% 116 50798 0.28% 117 52465 0.29% 118 53315 0.29% 119 54611 0.30% 120 56276 0.31% 121 57488 0.31% 122 59602 0.33% 123 61738 0.34% 124 64924 0.35% 125 66497 0.36% 126 69235 0.38% 127 71304 0.39% 128 73285 0.40% 129 75844 0.41% 130 78017 0.43% 131 79887 0.44% 132 83655 0.46% 133 88517 0.48% 134 92912 0.51% 135 99121 0.54% 136 103560 0.57% 137 110530 0.60% 138 117568 0.64% 139 125536 0.69% 140 133946 0.73% 141 145015 0.79% 142 158217 0.86% 143 174085 0.95% 144 198030 1.08% 145 229711 1.25% 146 281498 1.54% 147 369772 2.02% 148 547627 2.99% 149 1065558 5.82% 150 4887165 26.67% 151 7343648 40.08% 18321157 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=26 prefix-density=0.57 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=83.97 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=20 prefix-density=0.78 prefix-fanout=2.1 sequence=GCTCGAGAATTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=63.80 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.6 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGC SRR7171064 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:44:55 Started mapping on | Feb 13 22:44:55 Finished on | Feb 13 22:47:24 Mapping speed, Million of reads per hour | 442.66 Number of input reads | 18321157 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 16840059 Uniquely mapped reads % | 91.92% Average mapped length | 289.98 Number of splices: Total | 15590688 Number of splices: Annotated (sjdb) | 15252322 Number of splices: GT/AG | 15315084 Number of splices: GC/AG | 217563 Number of splices: AT/AC | 11215 Number of splices: Non-canonical | 46826 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 481944 % of reads mapped to multiple loci | 2.63% Number of reads mapped to too many loci | 54346 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.06% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1023084 1023084 1023084 N_multimapping 481944 481944 481944 N_noFeature 598900 16496957 703471 N_ambiguous 351119 975 112175 UnstrandedReadsAssigned:15890040 PositiveStrandReadsAssigned:342127 NegativeStrandReadsAssigned:16024413 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7171064 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171064-trimmed-pair1.fastq SRR7171064-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,321,157 reads, 16,053,592 reads pseudoaligned [quant] estimated average fragment length: 220.822 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52401 SRR7171064.ke.tsv 34699 SRR7171064.se.tsv 87100 total ==> SRR7171064.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798.18 654 16.5724 Potri.005G024800.1.v4.1 1035 815.178 546 30.5197 Potri.004G059700.1.v4.1 961 741.195 11 0.67624 Potri.007G009000.2.v4.1 1416 1196.18 0 0 Potri.003G141000.2.v4.1 2943 2723.18 625 10.4579 Potri.016G087400.1.v4.1 270 89.475 1982 1009.35 Potri.015G069301.1.v4.1 564 346.5 0 0 Potri.010G195200.1.v4.1 1773 1553.18 128 3.75516 Potri.012G127500.1.v4.1 977 757.195 169 10.17 ==> SRR7171064.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1185 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 390 Potri.001G212900.v4.1 59 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 37 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 19 SRR7171064 completed mapping pipeline successfully