Starting /dee2/code/volunteer_pipeline.sh SRR7171065 current disk space = 3089284157440 free memory = 1467157820 SRR7171065 SRAfilesize 6ae0437ea4422bc5dd2eac8cafb3fd0f SRR7171065.sra SRR7171065.sra file validated SRR7171065 is paired end SRR7171065 is conventional basespace SRR7171065 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171065_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.40425 18.0 18.0 25.0 18.0 32.0 2 26.554 27.0 25.0 29.0 18.0 31.0 3 27.45225 29.0 25.0 31.0 18.0 33.0 4 30.29625 31.0 29.0 33.0 27.0 33.0 5 31.1455 33.0 31.0 33.0 29.0 33.0 6 36.24025 38.0 36.0 38.0 33.0 38.0 7 37.06675 38.0 37.0 38.0 36.0 38.0 8 37.01775 38.0 38.0 38.0 35.0 38.0 9 36.65875 38.0 38.0 38.0 34.0 38.0 10-14 37.3247 38.0 38.0 38.0 36.6 38.0 15-19 37.44445 38.0 38.0 38.0 37.0 38.0 20-24 37.4434 38.0 38.0 38.0 37.0 38.0 25-29 37.39195 38.0 38.0 38.0 37.0 38.0 30-34 37.344750000000005 38.0 38.0 38.0 37.0 38.0 35-39 36.17395 38.0 36.8 38.0 30.8 38.0 40-44 36.78005 38.0 37.8 38.0 34.6 38.0 45-49 36.99 38.0 37.8 38.0 35.8 38.0 50-54 37.07555 38.0 38.0 38.0 36.0 38.0 55-59 35.7257 38.0 35.6 38.0 30.0 38.0 60-64 36.91655 38.0 38.0 38.0 35.6 38.0 65-69 36.85315 38.0 38.0 38.0 35.6 38.0 70-74 36.69295 38.0 38.0 38.0 34.8 38.0 75-79 36.5264 38.0 38.0 38.0 34.4 38.0 80-84 36.46495 38.0 38.0 38.0 34.2 38.0 85-89 36.1089 38.0 37.6 38.0 33.6 38.0 90-94 35.84695000000001 38.0 37.2 38.0 32.2 38.0 95-99 35.9534 38.0 37.0 38.0 33.0 38.0 100-104 36.00385000000001 38.0 37.0 38.0 33.4 38.0 105-109 35.84105 38.0 37.0 38.0 32.8 38.0 110-114 35.38119999999999 38.0 36.4 38.0 29.8 38.0 115-119 35.23855 38.0 36.2 38.0 29.2 38.0 120-124 35.25425 38.0 36.0 38.0 29.8 38.0 125-129 34.9664 38.0 35.6 38.0 28.4 38.0 130-134 32.46750000000001 37.2 30.4 38.0 18.2 38.0 135-139 33.98945 37.8 34.4 38.0 23.4 38.0 140-144 33.62685 38.0 34.0 38.0 22.0 38.0 145-149 32.7749 38.0 33.2 38.0 16.6 38.0 150-151 28.246875000000003 34.5 17.0 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 3.0 8 2.0 9 0.0 10 2.0 11 2.0 12 1.0 13 5.0 14 2.0 15 0.0 16 4.0 17 12.0 18 9.0 19 12.0 20 2.0 21 6.0 22 5.0 23 4.0 24 11.0 25 12.0 26 15.0 27 21.0 28 21.0 29 42.0 30 57.0 31 72.0 32 92.0 33 150.0 34 247.0 35 477.0 36 1331.0 37 1379.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.39425587467363 17.885117493472585 9.138381201044385 29.5822454308094 2 22.336168084042022 16.45822911455728 33.26663331665833 27.938969484742373 3 19.25 24.25 28.050000000000004 28.449999999999996 4 20.9 31.374999999999996 24.075 23.65 5 22.525000000000002 34.275 24.3 18.9 6 17.549999999999997 35.025 26.724999999999998 20.7 7 14.224999999999998 23.925 43.45 18.4 8 17.224999999999998 24.95 31.624999999999996 26.200000000000003 9 17.849999999999998 24.5 32.6 25.05 10-14 20.015 30.605 26.540000000000003 22.84 15-19 19.985 29.03 27.975 23.01 20-24 19.84 29.294999999999998 27.650000000000002 23.215 25-29 19.71 29.494999999999997 27.584999999999997 23.21 30-34 19.475 29.79 27.584999999999997 23.150000000000002 35-39 19.525000000000002 29.555 27.465 23.455000000000002 40-44 20.125 29.465000000000003 27.49 22.919999999999998 45-49 20.265 28.810000000000002 27.445000000000004 23.48 50-54 19.975 29.104999999999997 27.575 23.345 55-59 20.125 28.754999999999995 27.875 23.244999999999997 60-64 19.74 28.525 28.310000000000002 23.425 65-69 19.814999999999998 28.915000000000003 27.74 23.53 70-74 19.67 29.82 27.32 23.189999999999998 75-79 20.07 28.994999999999997 27.725 23.21 80-84 19.875 28.549999999999997 27.810000000000002 23.765 85-89 19.66 28.785 27.51 24.044999999999998 90-94 20.06 28.194999999999997 27.860000000000003 23.885 95-99 19.99 28.96 27.534999999999997 23.515 100-104 20.36 28.63 27.12 23.89 105-109 20.515 28.9 27.744999999999997 22.84 110-114 20.580000000000002 28.544999999999998 27.025 23.849999999999998 115-119 20.89 28.82 26.340000000000003 23.95 120-124 20.599999999999998 29.15 26.650000000000002 23.599999999999998 125-129 20.665 28.355000000000004 27.125 23.855 130-134 20.22 28.015 27.169999999999998 24.595 135-139 20.52 28.439999999999998 27.089999999999996 23.95 140-144 20.78 28.555000000000003 26.345000000000002 24.32 145-149 20.7 27.735 27.245 24.32 150-151 21.175 28.075 25.7375 25.0125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 2.5 2 2.0 3 2.5 4 1.5 5 0.5 6 0.5 7 1.0 8 0.5 9 0.5 10 1.0 11 1.0 12 1.5 13 1.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.5 19 1.0 20 1.5 21 2.5 22 3.5 23 5.5 24 5.0 25 3.5 26 8.0 27 12.0 28 11.5 29 22.0 30 29.5 31 38.0 32 62.0 33 71.5 34 79.0 35 105.5 36 126.5 37 132.0 38 148.0 39 161.5 40 175.0 41 203.0 42 200.5 43 199.5 44 218.5 45 226.0 46 223.5 47 216.5 48 195.0 49 184.0 50 167.5 51 133.0 52 108.0 53 98.0 54 93.0 55 79.5 56 73.0 57 52.5 58 32.0 59 27.0 60 18.0 61 8.0 62 5.5 63 5.0 64 3.0 65 1.0 66 1.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.25 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.69531849577898 96.45 2 0.920951650038373 1.7999999999999998 3 0.15349194167306215 0.44999999999999996 4 0.12790995139421849 0.5 5 0.051163980557687394 0.25 6 0.025581990278843697 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025581990278843697 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 16 0.4 TruSeq Adapter, Index 27 (97% over 39bp) GTCGGTTCGGTCCTCCAGTTAGTGTTACCCAACCTTCAACCTGCCCATGG 6 0.15 No Hit GCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAA 5 0.125 No Hit GCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0125 0.0 78-79 0.0875 0.0 0.0 0.025 0.0 80-81 0.1375 0.0 0.0 0.025 0.0 82-83 0.225 0.0 0.0 0.025 0.0 84-85 0.32499999999999996 0.0 0.0 0.025 0.0 86-87 0.48750000000000004 0.0 0.0 0.025 0.0 88-89 0.575 0.0 0.0 0.025 0.0 90-91 0.6499999999999999 0.0 0.0 0.025 0.0 92-93 0.8625 0.0 0.0 0.025 0.0 94-95 1.075 0.0 0.0 0.025 0.0 96-97 1.2875 0.0 0.0 0.025 0.0 98-99 1.5875 0.0 0.0 0.025 0.0 100-101 1.875 0.0 0.0 0.025 0.0 102-103 2.3375000000000004 0.0 0.0 0.025 0.0 104-105 2.675 0.0 0.0 0.025 0.0 106-107 3.0875 0.0 0.0 0.025 0.0 108-109 3.5374999999999996 0.0 0.0 0.025 0.0 110-111 4.0125 0.0 0.0 0.025 0.0 112-113 4.449999999999999 0.0 0.0 0.025 0.0 114-115 5.15 0.0 0.0 0.025 0.0 116-117 5.825 0.0 0.0 0.025 0.0 118-119 6.2875 0.0 0.0 0.025 0.0 120-121 6.9125 0.0 0.0 0.025 0.0 122-123 7.487500000000001 0.0 0.0 0.025 0.0 124-125 7.9875 0.0 0.0 0.025 0.0 126-127 8.3875 0.0 0.0 0.025 0.0 128-129 8.774999999999999 0.0 0.0 0.025 0.0 130-131 9.3625 0.0 0.0 0.025 0.0 132-133 10.075 0.0 0.0 0.025 0.0 134-135 10.9875 0.0 0.0 0.025 0.0 136-137 11.675 0.0 0.0 0.025 0.0 138-139 12.45 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171065 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171065_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.742 33.0 33.0 34.0 32.0 34.0 2 32.851 33.0 33.0 34.0 32.0 34.0 3 32.8355 34.0 33.0 34.0 32.0 34.0 4 32.823 34.0 33.0 34.0 32.0 34.0 5 32.746 34.0 33.0 34.0 32.0 34.0 6 36.85375 38.0 38.0 38.0 36.0 38.0 7 36.6445 38.0 38.0 38.0 35.0 38.0 8 36.7725 38.0 38.0 38.0 36.0 38.0 9 36.695 38.0 38.0 38.0 36.0 38.0 10-14 36.85835 38.0 38.0 38.0 36.0 38.0 15-19 36.82525 38.0 38.0 38.0 36.0 38.0 20-24 35.93095 38.0 37.2 38.0 30.2 38.0 25-29 36.475249999999996 38.0 38.0 38.0 34.4 38.0 30-34 36.63325 38.0 38.0 38.0 35.4 38.0 35-39 36.64665 38.0 38.0 38.0 35.4 38.0 40-44 35.8567 38.0 36.2 38.0 31.4 38.0 45-49 36.32405000000001 38.0 37.4 38.0 33.6 38.0 50-54 36.691700000000004 38.0 38.0 38.0 35.6 38.0 55-59 36.608399999999996 38.0 38.0 38.0 35.2 38.0 60-64 36.4748 38.0 38.0 38.0 34.4 38.0 65-69 36.50665 38.0 38.0 38.0 34.8 38.0 70-74 36.40085 38.0 38.0 38.0 34.0 38.0 75-79 36.32435 38.0 38.0 38.0 34.0 38.0 80-84 36.101299999999995 38.0 38.0 38.0 33.8 38.0 85-89 36.03295 38.0 38.0 38.0 33.8 38.0 90-94 35.98365 38.0 38.0 38.0 34.0 38.0 95-99 35.91265 38.0 37.8 38.0 33.2 38.0 100-104 35.640249999999995 38.0 37.0 38.0 31.8 38.0 105-109 35.193650000000005 38.0 36.4 38.0 29.6 38.0 110-114 34.913 38.0 35.8 38.0 27.4 38.0 115-119 35.06335 38.0 36.0 38.0 29.0 38.0 120-124 34.6545 38.0 35.8 38.0 26.6 38.0 125-129 34.088350000000005 38.0 34.6 38.0 24.0 38.0 130-134 33.92215 38.0 33.6 38.0 23.2 38.0 135-139 33.4051 38.0 33.2 38.0 21.0 38.0 140-144 32.567 38.0 33.0 38.0 13.2 38.0 145-149 31.5785 38.0 32.2 38.0 8.4 38.0 150-151 25.68 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 5.0 4 5.0 5 2.0 6 2.0 7 1.0 8 1.0 9 0.0 10 0.0 11 2.0 12 6.0 13 1.0 14 4.0 15 4.0 16 8.0 17 7.0 18 9.0 19 12.0 20 14.0 21 5.0 22 9.0 23 15.0 24 10.0 25 28.0 26 24.0 27 22.0 28 48.0 29 46.0 30 54.0 31 60.0 32 105.0 33 130.0 34 201.0 35 376.0 36 820.0 37 1948.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.0 21.325 11.475 20.200000000000003 2 28.875 24.275 28.7 18.15 3 21.905476369092273 26.78169542385596 32.10802700675169 19.204801200300075 4 24.956239059764943 32.75818954738685 22.655663915978995 19.629907476869217 5 25.656414103525883 36.70917729432358 20.7551887971993 16.879219804951237 6 21.224999999999998 38.5 22.55 17.724999999999998 7 20.225 19.950000000000003 38.875 20.95 8 20.599999999999998 25.45 27.575 26.375 9 23.075000000000003 25.074999999999996 28.15 23.7 10-14 23.685000000000002 28.73 25.935000000000002 21.65 15-19 23.41 28.15 27.21 21.23 20-24 24.505 28.68 26.76 20.055 25-29 23.830000000000002 28.660000000000004 27.439999999999998 20.07 30-34 23.54 27.54 27.894999999999996 21.025 35-39 23.255 28.139999999999997 27.744999999999997 20.86 40-44 23.635 28.305000000000003 27.965 20.095 45-49 23.03 28.205000000000002 28.185 20.580000000000002 50-54 23.45 28.02 27.950000000000003 20.580000000000002 55-59 23.555 27.665 28.09 20.69 60-64 23.105 27.82 28.155 20.919999999999998 65-69 23.57 27.295 28.105000000000004 21.029999999999998 70-74 23.505000000000003 27.99 28.050000000000004 20.455000000000002 75-79 23.31 27.6 27.965 21.125 80-84 22.75 28.595 27.689999999999998 20.965 85-89 23.445 27.560000000000002 28.310000000000002 20.685000000000002 90-94 24.135 27.87 27.445000000000004 20.549999999999997 95-99 23.03115155757788 28.181409070453523 28.21141057052853 20.57602880144007 100-104 24.099999999999998 27.425 27.834999999999997 20.64 105-109 24.279999999999998 27.865000000000002 27.939999999999998 19.915 110-114 24.45 28.425 27.16 19.965 115-119 24.63 28.425 27.245 19.7 120-124 25.235000000000003 27.779999999999998 27.27 19.715 125-129 24.946247312365617 28.40642032101605 27.031351567578376 19.615980799039953 130-134 25.064999999999998 27.839999999999996 27.29 19.805 135-139 25.44627231361568 27.40137006850343 27.211360568028404 19.940997049852495 140-144 25.935000000000002 27.625 26.96 19.48 145-149 26.31 26.83 27.26 19.6 150-151 27.187499999999996 26.7125 26.625 19.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 0.5 18 1.0 19 1.0 20 0.0 21 1.0 22 1.5 23 2.5 24 6.5 25 6.0 26 3.0 27 4.0 28 10.0 29 18.0 30 22.5 31 25.0 32 34.0 33 41.0 34 48.0 35 59.0 36 80.0 37 106.0 38 135.0 39 159.5 40 184.0 41 214.0 42 241.5 43 245.5 44 246.0 45 251.5 46 246.0 47 245.5 48 229.0 49 200.0 50 155.5 51 134.0 52 125.5 53 108.5 54 99.5 55 85.5 56 70.0 57 46.0 58 28.0 59 22.0 60 16.0 61 12.0 62 9.5 63 6.0 64 2.5 65 2.5 66 2.0 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.51014641664526 95.875 2 1.0274852298998203 2.0 3 0.25687130747495507 0.75 4 0.07706139224248652 0.3 5 0.0 0.0 6 0.07706139224248652 0.44999999999999996 7 0.025687130747495505 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025687130747495505 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCT 18 0.44999999999999996 Illumina Single End PCR Primer 1 (96% over 32bp) AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.48750000000000004 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.6499999999999999 0.0 0.0 0.0 0.0 92-93 0.85 0.0 0.0 0.0 0.0 94-95 1.05 0.0 0.0 0.0 0.0 96-97 1.275 0.0 0.0 0.0 0.0 98-99 1.6 0.0 0.0 0.0 0.0 100-101 1.875 0.0 0.0 0.0 0.0 102-103 2.3625 0.0 0.0 0.0 0.0 104-105 2.7 0.0 0.0 0.0 0.0 106-107 3.0625 0.0 0.0 0.0 0.0 108-109 3.5 0.0 0.0 0.0 0.0 110-111 3.9625000000000004 0.0 0.0 0.0 0.0 112-113 4.3875 0.0 0.0 0.0 0.0 114-115 5.1375 0.0 0.0 0.0 0.0 116-117 5.8125 0.0 0.0 0.0 0.0 118-119 6.237500000000001 0.0 0.0 0.0 0.0 120-121 6.862500000000001 0.0 0.0 0.0 0.0 122-123 7.5 0.0 0.0 0.0 0.0 124-125 8.0125 0.0 0.0 0.0 0.0 126-127 8.4625 0.0 0.0 0.0 0.0 128-129 8.899999999999999 0.0 0.0 0.0 0.0 130-131 9.6125 0.0 0.0 0.0 0.0 132-133 10.3875 0.0 0.0 0.0 0.0 134-135 11.275 0.0 0.0 0.0 0.0 136-137 11.962499999999999 0.0 0.0 0.0 0.0 138-139 12.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCAATC 30 0.0014437955 24.166668 50-54 >>END_MODULE Read 742784 spots for SRR7171065.sra Written 742784 spots for SRR7171065.sra Read 742784 spots for SRR7171065.sra Written 742784 spots for SRR7171065.sra Read 742784 spots for SRR7171065.sra Written 742784 spots for SRR7171065.sra Read 742784 spots for SRR7171065.sra Written 742784 spots for SRR7171065.sra Read 742784 spots for SRR7171065.sra Written 742784 spots for SRR7171065.sra Read 742784 spots for SRR7171065.sra Written 742784 spots for SRR7171065.sra Read 742784 spots for SRR7171065.sra Written 742784 spots for SRR7171065.sra Read 742784 spots for SRR7171065.sra Written 742784 spots for SRR7171065.sra Read 742784 spots for SRR7171065.sra Written 742784 spots for SRR7171065.sra Read 742784 spots for SRR7171065.sra Written 742784 spots for SRR7171065.sra Read 742784 spots for SRR7171065.sra Written 742784 spots for SRR7171065.sra Read 742784 spots for SRR7171065.sra Written 742784 spots for SRR7171065.sra Read 742784 spots for SRR7171065.sra Written 742784 spots for SRR7171065.sra Read 742784 spots for SRR7171065.sra Written 742784 spots for SRR7171065.sra Read 742784 spots for SRR7171065.sra Written 742784 spots for SRR7171065.sra Read 742788 spots for SRR7171065.sra Written 742788 spots for SRR7171065.sra Read 742784 spots for SRR7171065.sra Written 742784 spots for SRR7171065.sra Read 742784 spots for SRR7171065.sra Written 742784 spots for SRR7171065.sra Read 742784 spots for SRR7171065.sra Written 742784 spots for SRR7171065.sra Read 742784 spots for SRR7171065.sra Written 742784 spots for SRR7171065.sra SRR ids: ['SRR7171065.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wnedzepo SRR7171065.sra spots: 14855684 blocks: [[1, 742784], [742785, 1485568], [1485569, 2228352], [2228353, 2971136], [2971137, 3713920], [3713921, 4456704], [4456705, 5199488], [5199489, 5942272], [5942273, 6685056], [6685057, 7427840], [7427841, 8170624], [8170625, 8913408], [8913409, 9656192], [9656193, 10398976], [10398977, 11141760], [11141761, 11884544], [11884545, 12627328], [12627329, 13370112], [13370113, 14112896], [14112897, 14855684]] SRR7171065 file size 5012403 SRR7171065 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171065 SRR7171065_1.fastq SRR7171065_2.fastq Input file: SRR7171065_1.fastq Paired file: SRR7171065_2.fastq trimmed: SRR7171065-trimmed-pair1.fastq, SRR7171065-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:54:30 2025 >> started Thu Feb 13 22:54:48 2025 >> done (18.040s) 14855684 read pairs processed; of these: 25328 ( 0.17%) short read pairs filtered out after trimming by size control 102775 ( 0.69%) empty read pairs filtered out after trimming by size control 14727581 (99.14%) read pairs available; of these: 9202329 (62.48%) trimmed read pairs available after processing 5525252 (37.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 10 0.00% 20 13 0.00% 21 21 0.00% 22 27 0.00% 23 23 0.00% 24 30 0.00% 25 21 0.00% 26 33 0.00% 27 38 0.00% 28 32 0.00% 29 21 0.00% 30 22 0.00% 31 31 0.00% 32 28 0.00% 33 28 0.00% 34 23 0.00% 35 31 0.00% 36 38 0.00% 37 23 0.00% 38 51 0.00% 39 56 0.00% 40 73 0.00% 41 56 0.00% 42 54 0.00% 43 60 0.00% 44 75 0.00% 45 116 0.00% 46 143 0.00% 47 138 0.00% 48 156 0.00% 49 180 0.00% 50 232 0.00% 51 267 0.00% 52 310 0.00% 53 297 0.00% 54 310 0.00% 55 344 0.00% 56 388 0.00% 57 425 0.00% 58 575 0.00% 59 626 0.00% 60 740 0.01% 61 788 0.01% 62 891 0.01% 63 982 0.01% 64 1070 0.01% 65 1168 0.01% 66 1236 0.01% 67 1396 0.01% 68 1495 0.01% 69 1791 0.01% 70 2058 0.01% 71 2314 0.02% 72 2712 0.02% 73 2901 0.02% 74 3464 0.02% 75 4184 0.03% 76 6063 0.04% 77 6619 0.04% 78 5308 0.04% 79 5674 0.04% 80 6232 0.04% 81 7114 0.05% 82 8101 0.06% 83 8916 0.06% 84 11213 0.08% 85 12369 0.08% 86 13680 0.09% 87 15300 0.10% 88 16709 0.11% 89 17024 0.12% 90 17753 0.12% 91 18694 0.13% 92 19330 0.13% 93 21531 0.15% 94 22490 0.15% 95 24079 0.16% 96 24608 0.17% 97 25351 0.17% 98 26201 0.18% 99 27152 0.18% 100 30030 0.20% 101 30254 0.21% 102 32878 0.22% 103 34510 0.23% 104 36794 0.25% 105 38947 0.26% 106 39763 0.27% 107 40494 0.27% 108 41551 0.28% 109 44192 0.30% 110 45187 0.31% 111 45515 0.31% 112 47821 0.32% 113 51130 0.35% 114 53061 0.36% 115 54321 0.37% 116 55071 0.37% 117 55830 0.38% 118 56230 0.38% 119 56464 0.38% 120 58638 0.40% 121 59114 0.40% 122 60823 0.41% 123 63721 0.43% 124 65146 0.44% 125 66124 0.45% 126 68635 0.47% 127 69172 0.47% 128 70863 0.48% 129 71649 0.49% 130 73708 0.50% 131 74861 0.51% 132 77853 0.53% 133 80830 0.55% 134 84804 0.58% 135 89688 0.61% 136 92138 0.63% 137 96982 0.66% 138 101754 0.69% 139 108461 0.74% 140 114333 0.78% 141 125179 0.85% 142 136011 0.92% 143 152480 1.04% 144 176154 1.20% 145 207767 1.41% 146 256574 1.74% 147 348078 2.36% 148 499750 3.39% 149 916875 6.23% 150 3441986 23.37% 151 5525252 37.52% 14727581 reads passed initial QC criterion=sequence-density sequence-density=1.24 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=21 prefix-density=1.22 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=61.13 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.3 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=1.66 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=21 prefix-density=1.69 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=33.50 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.5 sequence=CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR7171065 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:55:36 Started mapping on | Feb 13 22:55:36 Finished on | Feb 13 22:58:08 Mapping speed, Million of reads per hour | 348.81 Number of input reads | 14727581 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 13256099 Uniquely mapped reads % | 90.01% Average mapped length | 287.06 Number of splices: Total | 11727563 Number of splices: Annotated (sjdb) | 11441972 Number of splices: GT/AG | 11500551 Number of splices: GC/AG | 170177 Number of splices: AT/AC | 9279 Number of splices: Non-canonical | 47556 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.42 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 388150 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 41089 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.94% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1116154 1116154 1116154 N_multimapping 388150 388150 388150 N_noFeature 500990 12840831 620756 N_ambiguous 401433 1094 105339 UnstrandedReadsAssigned:12353676 PositiveStrandReadsAssigned:414174 NegativeStrandReadsAssigned:12530004 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=142 echo kmer=137 SRR7171065 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171065-trimmed-pair1.fastq SRR7171065-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,727,581 reads, 12,443,188 reads pseudoaligned [quant] estimated average fragment length: 212.996 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52401 SRR7171065.ke.tsv 34699 SRR7171065.se.tsv 87100 total ==> SRR7171065.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1806 532 14.9872 Potri.005G024800.1.v4.1 1035 823.004 334 20.6477 Potri.004G059700.1.v4.1 961 749.013 16 1.08682 Potri.007G009000.2.v4.1 1416 1204 0 0 Potri.003G141000.2.v4.1 2943 2731 599.418 11.167 Potri.016G087400.1.v4.1 270 96.0841 1071 567.108 Potri.015G069301.1.v4.1 564 354.645 0 0 Potri.010G195200.1.v4.1 1773 1561 155 5.05191 Potri.012G127500.1.v4.1 977 765.009 176 11.7051 ==> SRR7171065.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 546 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 545 Potri.001G212900.v4.1 16 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 25 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR7171065 completed mapping pipeline successfully